Starting /dee2/code/volunteer_pipeline.sh SRR12917533 current disk space = 3092549758976 free memory = 1489800156 SRR12917533 SRAfilesize 111fafe47e57ea8c3b9889c43a06becb SRR12917533.sra SRR12917533.sra file validated SRR12917533 is paired end SRR12917533 is conventional basespace SRR12917533 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917533_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.63825 37.0 37.0 37.0 37.0 37.0 2 36.463 37.0 37.0 37.0 37.0 37.0 3 36.656 37.0 37.0 37.0 37.0 37.0 4 36.6585 37.0 37.0 37.0 37.0 37.0 5 36.7055 37.0 37.0 37.0 37.0 37.0 6 36.7115 37.0 37.0 37.0 37.0 37.0 7 36.609 37.0 37.0 37.0 37.0 37.0 8 36.6465 37.0 37.0 37.0 37.0 37.0 9 36.651 37.0 37.0 37.0 37.0 37.0 10-14 36.663 37.0 37.0 37.0 37.0 37.0 15-19 36.624 37.0 37.0 37.0 37.0 37.0 20-24 36.59310000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.5653 37.0 37.0 37.0 37.0 37.0 30-34 36.4859 37.0 37.0 37.0 37.0 37.0 35-39 36.497699999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.5072 37.0 37.0 37.0 37.0 37.0 45-49 36.4135 37.0 37.0 37.0 37.0 37.0 50-54 36.4243 37.0 37.0 37.0 37.0 37.0 55-59 36.411 37.0 37.0 37.0 37.0 37.0 60-64 36.372 37.0 37.0 37.0 37.0 37.0 65-69 36.269800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.375 37.0 37.0 37.0 37.0 37.0 75-79 36.3269 37.0 37.0 37.0 37.0 37.0 80-84 36.3193 37.0 37.0 37.0 37.0 37.0 85-89 36.2791 37.0 37.0 37.0 37.0 37.0 90-94 36.2778 37.0 37.0 37.0 37.0 37.0 95-99 36.223699999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.1983 37.0 37.0 37.0 37.0 37.0 105-109 36.147400000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.0467 37.0 37.0 37.0 37.0 37.0 115-119 36.0812 37.0 37.0 37.0 37.0 37.0 120-124 36.0916 37.0 37.0 37.0 37.0 37.0 125-129 35.951100000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9621 37.0 37.0 37.0 37.0 37.0 135-139 35.9294 37.0 37.0 37.0 37.0 37.0 140-144 35.7558 37.0 37.0 37.0 37.0 37.0 145-149 35.6971 37.0 37.0 37.0 37.0 37.0 150-151 35.46575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 0.0 23 1.0 24 3.0 25 2.0 26 8.0 27 4.0 28 6.0 29 8.0 30 22.0 31 40.0 32 34.0 33 67.0 34 102.0 35 321.0 36 3078.0 37 301.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.484871217804454 14.50362590647662 5.0012503125781445 41.01025256314079 2 17.525 10.75 39.5 32.225 3 15.4 14.325 29.325000000000003 40.949999999999996 4 20.95 20.275000000000002 24.55 34.225 5 23.775 27.575 25.724999999999998 22.925 6 20.75 31.874999999999996 23.0 24.375 7 15.075 30.4 38.0 16.525000000000002 8 15.225 27.925 33.175 23.674999999999997 9 16.175 24.375 37.1 22.35 10-14 19.259999999999998 30.425 27.54 22.775000000000002 15-19 19.205 28.62 27.82 24.355 20-24 19.185 27.955000000000002 28.705000000000002 24.154999999999998 25-29 19.335 28.720000000000002 28.365000000000002 23.580000000000002 30-34 19.885 28.575 27.529999999999998 24.01 35-39 19.595000000000002 28.970000000000002 27.88 23.555 40-44 19.805 28.575 27.63 23.990000000000002 45-49 19.485 28.634999999999998 27.529999999999998 24.349999999999998 50-54 19.55 28.985 26.955000000000002 24.51 55-59 19.97 28.005000000000003 28.315 23.71 60-64 19.965 28.77 27.555000000000003 23.71 65-69 19.68 27.93 27.994999999999997 24.395 70-74 20.46 28.96 26.965 23.615 75-79 19.985 28.925 27.32 23.77 80-84 20.255000000000003 28.68 27.12 23.945 85-89 20.04 28.060000000000002 27.93 23.97 90-94 20.01 28.025 27.689999999999998 24.275 95-99 20.31 27.810000000000002 27.625 24.255 100-104 19.895 27.775 28.075 24.255 105-109 20.26 27.6 27.125 25.014999999999997 110-114 20.07 28.515 27.365000000000002 24.05 115-119 20.03 28.444999999999997 27.455000000000002 24.07 120-124 20.25 28.22 27.05 24.48 125-129 20.015 28.115000000000002 27.310000000000002 24.560000000000002 130-134 20.810000000000002 28.199999999999996 27.339999999999996 23.65 135-139 21.044999999999998 27.22 27.389999999999997 24.345 140-144 20.599999999999998 27.950000000000003 27.71 23.74 145-149 20.79 27.455000000000002 27.339999999999996 24.415 150-151 19.9375 28.4125 27.3375 24.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 1.5 24 2.5 25 5.0 26 5.0 27 5.0 28 8.0 29 12.0 30 18.5 31 29.0 32 39.5 33 43.5 34 51.5 35 61.5 36 76.0 37 104.0 38 131.5 39 151.0 40 184.0 41 221.5 42 251.0 43 259.0 44 265.0 45 261.0 46 253.0 47 258.0 48 223.5 49 200.5 50 178.5 51 151.0 52 133.0 53 103.0 54 71.5 55 51.5 56 41.5 57 32.0 58 30.5 59 22.0 60 13.0 61 8.0 62 7.5 63 8.0 64 7.0 65 5.5 66 1.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.325 #Duplication Level Percentage of deduplicated Percentage of total 1 89.72851945144137 80.15 2 9.012034704729919 16.1 3 1.035544360481388 2.775 4 0.1399384270920795 0.5 5 0.027987685418415897 0.125 6 0.027987685418415897 0.15 7 0.0 0.0 8 0.027987685418415897 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCGATTTTGCAGTTGCTTCTCTCGATTTCAGCAATGGGGTCTATCAAA 8 0.2 No Hit CACTACTCTCTTCATTGAAAATAAAAAATTGCATAACATTTGTTGTCCCA 6 0.15 No Hit CTTGCATCTTCTCCAAAGACATCAAAAAGGGCTGGCCTCAGCTTCCCAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 1.9749999999999999 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.7875 0.0 0.0 0.0 0.0 128-129 2.9749999999999996 0.0 0.0 0.0 0.0 130-131 3.3375 0.0 0.0 0.0 0.0 132-133 3.5250000000000004 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 4.075 0.0 0.0 0.0 0.0 138-139 4.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917533 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917533_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.351 37.0 37.0 37.0 37.0 37.0 2 36.2865 37.0 37.0 37.0 37.0 37.0 3 36.3565 37.0 37.0 37.0 37.0 37.0 4 36.324 37.0 37.0 37.0 37.0 37.0 5 36.408 37.0 37.0 37.0 37.0 37.0 6 36.3035 37.0 37.0 37.0 37.0 37.0 7 36.361 37.0 37.0 37.0 37.0 37.0 8 36.3065 37.0 37.0 37.0 37.0 37.0 9 36.51 37.0 37.0 37.0 37.0 37.0 10-14 36.414699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.354099999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.3182 37.0 37.0 37.0 37.0 37.0 25-29 36.2193 37.0 37.0 37.0 37.0 37.0 30-34 36.2115 37.0 37.0 37.0 37.0 37.0 35-39 36.0947 37.0 37.0 37.0 37.0 37.0 40-44 36.183299999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0689 37.0 37.0 37.0 37.0 37.0 50-54 36.0538 37.0 37.0 37.0 37.0 37.0 55-59 36.0813 37.0 37.0 37.0 37.0 37.0 60-64 36.061800000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.0286 37.0 37.0 37.0 37.0 37.0 70-74 36.0424 37.0 37.0 37.0 37.0 37.0 75-79 35.928999999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.007 37.0 37.0 37.0 37.0 37.0 85-89 35.977599999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.9327 37.0 37.0 37.0 37.0 37.0 95-99 35.9605 37.0 37.0 37.0 37.0 37.0 100-104 35.94840000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.8361 37.0 37.0 37.0 37.0 37.0 110-114 35.8449 37.0 37.0 37.0 37.0 37.0 115-119 35.7596 37.0 37.0 37.0 37.0 37.0 120-124 35.705 37.0 37.0 37.0 37.0 37.0 125-129 35.728899999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.5665 37.0 37.0 37.0 37.0 37.0 135-139 35.5441 37.0 37.0 37.0 37.0 37.0 140-144 35.395799999999994 37.0 37.0 37.0 34.6 37.0 145-149 35.3694 37.0 37.0 37.0 32.2 37.0 150-151 34.85675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 1.0 16 2.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 2.0 23 2.0 24 2.0 25 5.0 26 2.0 27 12.0 28 11.0 29 19.0 30 13.0 31 32.0 32 60.0 33 103.0 34 210.0 35 644.0 36 2691.0 37 184.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.025 28.575 8.55 27.85 2 26.700000000000003 24.9 32.175 16.225 3 18.775 28.15 33.800000000000004 19.275000000000002 4 23.25 33.15 24.7 18.9 5 25.525 36.25 21.05 17.175 6 21.625 38.800000000000004 21.925 17.65 7 20.599999999999998 23.75 37.55 18.099999999999998 8 19.725 25.825 30.049999999999997 24.4 9 21.7 24.575 31.324999999999996 22.400000000000002 10-14 23.28 29.385 26.484999999999996 20.849999999999998 15-19 23.115 28.65 27.365000000000002 20.87 20-24 23.25 28.43 26.86 21.46 25-29 23.075000000000003 28.449999999999996 27.365000000000002 21.11 30-34 22.935 28.275 27.694999999999997 21.095 35-39 24.165 27.900000000000002 26.985 20.95 40-44 23.175 28.084999999999997 27.54 21.2 45-49 22.89 28.555000000000003 27.235 21.32 50-54 23.515 28.485 27.200000000000003 20.8 55-59 23.625 28.634999999999998 27.51 20.23 60-64 24.635 27.37 27.05 20.945 65-69 24.545 28.1 27.1 20.255000000000003 70-74 24.365000000000002 27.26 27.3 21.075 75-79 23.835 28.21 27.155 20.8 80-84 23.89 27.54 27.694999999999997 20.875 85-89 23.865 27.565 27.644999999999996 20.925 90-94 24.435000000000002 27.865000000000002 27.405 20.294999999999998 95-99 24.44 27.544999999999998 26.955000000000002 21.060000000000002 100-104 24.34 27.894999999999996 27.365000000000002 20.4 105-109 24.224999999999998 27.97 27.250000000000004 20.555 110-114 23.925 28.439999999999998 26.755000000000003 20.880000000000003 115-119 24.515 27.77 27.544999999999998 20.169999999999998 120-124 25.180000000000003 28.28 26.22 20.32 125-129 24.75 27.99 26.924999999999997 20.335 130-134 24.425 28.12 27.26 20.195 135-139 24.39 27.74 27.700000000000003 20.169999999999998 140-144 25.415 27.310000000000002 27.49 19.785 145-149 25.09 28.54 26.565 19.805 150-151 25.837500000000002 27.975 26.400000000000002 19.787499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 2.5 26 3.5 27 3.5 28 3.0 29 7.5 30 10.5 31 17.5 32 24.0 33 29.5 34 42.5 35 53.5 36 65.0 37 83.5 38 129.0 39 182.0 40 225.0 41 244.5 42 246.5 43 261.0 44 276.5 45 281.0 46 274.5 47 269.0 48 251.0 49 211.5 50 167.5 51 135.5 52 110.5 53 88.0 54 65.5 55 56.0 56 47.5 57 28.0 58 20.5 59 15.5 60 11.0 61 8.5 62 7.5 63 8.0 64 4.0 65 1.5 66 1.5 67 1.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.325 #Duplication Level Percentage of deduplicated Percentage of total 1 90.06437167646236 80.45 2 8.536244052616848 15.25 3 1.119507416736636 3.0 4 0.11195074167366359 0.4 5 0.055975370836831795 0.25 6 0.055975370836831795 0.3 7 0.055975370836831795 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAGTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTA 7 0.17500000000000002 No Hit GTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTACATA 7 0.17500000000000002 No Hit CCCCAGCTGCTCTCAAATCCCACATGCCAGCCCTTCAACTTCGTTCACTT 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit TTCACATTCCTTCTGGATTGCACCCCAGCCGGCATGTCAAGGAGGAAGAT 5 0.125 No Hit GCAGCCTAAGAATGGGATATCTGTGAAAATTGAAGCTTGAACAAACCCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 1.9749999999999999 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.7875 0.0 0.0 0.0 0.0 128-129 2.9749999999999996 0.0 0.0 0.0 0.0 130-131 3.3499999999999996 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.7125 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTA 10 0.006830828 145.0 1 ATAACTC 10 0.006830828 145.0 3 TGATAAC 10 0.006830828 145.0 1 >>END_MODULE Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612526 spots for SRR12917533.sra Written 612526 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra Read 612510 spots for SRR12917533.sra Written 612510 spots for SRR12917533.sra SRR ids: ['SRR12917533.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wm6xpip7 SRR12917533.sra spots: 12250216 blocks: [[1, 612510], [612511, 1225020], [1225021, 1837530], [1837531, 2450040], [2450041, 3062550], [3062551, 3675060], [3675061, 4287570], [4287571, 4900080], [4900081, 5512590], [5512591, 6125100], [6125101, 6737610], [6737611, 7350120], [7350121, 7962630], [7962631, 8575140], [8575141, 9187650], [9187651, 9800160], [9800161, 10412670], [10412671, 11025180], [11025181, 11637690], [11637691, 12250216]] SRR12917533 file size 4141458 SRR12917533 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917533 SRR12917533_1.fastq SRR12917533_2.fastq Input file: SRR12917533_1.fastq Paired file: SRR12917533_2.fastq trimmed: SRR12917533-trimmed-pair1.fastq, SRR12917533-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:14:26 2025 >> started Thu Feb 13 12:14:39 2025 >> done (12.729s) 12250216 read pairs processed; of these: 78 ( 0.00%) short read pairs filtered out after trimming by size control 5153 ( 0.04%) empty read pairs filtered out after trimming by size control 12244985 (99.96%) read pairs available; of these: 866308 ( 7.07%) trimmed read pairs available after processing 11378677 (92.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 13 0.00% 20 8 0.00% 21 12 0.00% 22 11 0.00% 23 11 0.00% 24 13 0.00% 25 3 0.00% 26 13 0.00% 27 21 0.00% 28 17 0.00% 29 17 0.00% 30 22 0.00% 31 16 0.00% 32 21 0.00% 33 21 0.00% 34 21 0.00% 35 33 0.00% 36 31 0.00% 37 16 0.00% 38 27 0.00% 39 20 0.00% 40 27 0.00% 41 27 0.00% 42 20 0.00% 43 31 0.00% 44 35 0.00% 45 35 0.00% 46 43 0.00% 47 50 0.00% 48 54 0.00% 49 58 0.00% 50 63 0.00% 51 70 0.00% 52 76 0.00% 53 98 0.00% 54 127 0.00% 55 88 0.00% 56 133 0.00% 57 156 0.00% 58 174 0.00% 59 181 0.00% 60 244 0.00% 61 253 0.00% 62 291 0.00% 63 302 0.00% 64 371 0.00% 65 367 0.00% 66 444 0.00% 67 467 0.00% 68 502 0.00% 69 561 0.00% 70 672 0.01% 71 731 0.01% 72 890 0.01% 73 1015 0.01% 74 1092 0.01% 75 1221 0.01% 76 1363 0.01% 77 1491 0.01% 78 1597 0.01% 79 1787 0.01% 80 1764 0.01% 81 1961 0.02% 82 2247 0.02% 83 2427 0.02% 84 2857 0.02% 85 2990 0.02% 86 3231 0.03% 87 3330 0.03% 88 3572 0.03% 89 3616 0.03% 90 3735 0.03% 91 4142 0.03% 92 4334 0.04% 93 4564 0.04% 94 4930 0.04% 95 5259 0.04% 96 5623 0.05% 97 5823 0.05% 98 5914 0.05% 99 6138 0.05% 100 6389 0.05% 101 6658 0.05% 102 6859 0.06% 103 7461 0.06% 104 7553 0.06% 105 8203 0.07% 106 8578 0.07% 107 8799 0.07% 108 9217 0.08% 109 9243 0.08% 110 9428 0.08% 111 9614 0.08% 112 9972 0.08% 113 10194 0.08% 114 10363 0.08% 115 10996 0.09% 116 11572 0.09% 117 11823 0.10% 118 12556 0.10% 119 12578 0.10% 120 13061 0.11% 121 12855 0.10% 122 13393 0.11% 123 13289 0.11% 124 13839 0.11% 125 14557 0.12% 126 14930 0.12% 127 15539 0.13% 128 16014 0.13% 129 16172 0.13% 130 16614 0.14% 131 17025 0.14% 132 17505 0.14% 133 17522 0.14% 134 17811 0.15% 135 18540 0.15% 136 18923 0.15% 137 19622 0.16% 138 20235 0.17% 139 20605 0.17% 140 21151 0.17% 141 21772 0.18% 142 22009 0.18% 143 22027 0.18% 144 22695 0.19% 145 22974 0.19% 146 23095 0.19% 147 23699 0.19% 148 24615 0.20% 149 24764 0.20% 150 25361 0.21% 151 11378677 92.93% 12244985 reads passed initial QC criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=22 prefix-density=1.14 prefix-fanout=2.0 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=28.04 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=4.7 sequence=TTATTTATTTAAGCAAAGTACCCAGCAACGCCACACATATGAAAAACAAGTAAGAGACTGGCCATGACATGGTTGCTGCATTTTTCTTTTGCGCGAGTTGCATTATTTCACTAACAAGGCTTGGCGCAAAAACAGCGGCGGCGGAACCCTTTGCATTCACCACCGGGAAAACCTTCAGTCTTGCACACACTAGCACAGTTGTGGCCTCTTACACATGGTCCTTTAAAACTATGGCTCTGTGACAAACAAACCCTAGCCTCAGCAGGTACCATCATTTCCTGGGAAGCCAGGGCAATGAGCAGCAACAAGAAAAGACCATAGCATTTCTTCTCCATCTCTCTGTCTAACAAGAAC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.87 prefix-fanout=2.0 sequence=AAGCGCTCAAGGATATGAAGTTAAGAAAATGCTATTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=404.78 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=16.0 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12917533 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:15:23 Started mapping on | Feb 13 12:15:23 Finished on | Feb 13 12:17:02 Mapping speed, Million of reads per hour | 445.27 Number of input reads | 12244985 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11369963 Uniquely mapped reads % | 92.85% Average mapped length | 297.26 Number of splices: Total | 10964255 Number of splices: Annotated (sjdb) | 10732953 Number of splices: GT/AG | 10763644 Number of splices: GC/AG | 157312 Number of splices: AT/AC | 13251 Number of splices: Non-canonical | 30048 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 350294 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 60840 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 524728 524728 524728 N_multimapping 350294 350294 350294 N_noFeature 259332 11243806 308602 N_ambiguous 165731 564 88534 UnstrandedReadsAssigned:10944900 PositiveStrandReadsAssigned:125593 NegativeStrandReadsAssigned:10972827 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917533 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917533-trimmed-pair1.fastq SRR12917533-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,244,985 reads, 10,909,843 reads pseudoaligned [quant] estimated average fragment length: 279.784 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR12917533.ke.tsv 34699 SRR12917533.se.tsv 87100 total ==> SRR12917533.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.22 470 20.7915 Potri.005G024800.1.v4.1 1035 756.216 191 19.4325 Potri.004G059700.1.v4.1 961 682.397 23 2.59318 Potri.007G009000.2.v4.1 1416 1137.22 0 0 Potri.003G141000.2.v4.1 2943 2664.22 343 9.90528 Potri.016G087400.1.v4.1 270 76.6975 1097 1100.44 Potri.015G069301.1.v4.1 564 302.537 0 0 Potri.010G195200.1.v4.1 1773 1494.22 53 2.72901 Potri.012G127500.1.v4.1 977 698.315 6085 670.427 ==> SRR12917533.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 39 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 154 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 43 SRR12917533 completed mapping pipeline successfully