Starting /dee2/code/volunteer_pipeline.sh SRR12917534 current disk space = 3092772278272 free memory = 1450151816 SRR12917534 SRAfilesize 4294f37628c39ded71c7c6613625bb64 SRR12917534.sra SRR12917534.sra file validated SRR12917534 is paired end SRR12917534 is conventional basespace SRR12917534 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917534_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.51625 37.0 37.0 37.0 37.0 37.0 2 36.5395 37.0 37.0 37.0 37.0 37.0 3 36.6445 37.0 37.0 37.0 37.0 37.0 4 36.657 37.0 37.0 37.0 37.0 37.0 5 36.624 37.0 37.0 37.0 37.0 37.0 6 36.7355 37.0 37.0 37.0 37.0 37.0 7 36.563 37.0 37.0 37.0 37.0 37.0 8 36.618 37.0 37.0 37.0 37.0 37.0 9 36.6235 37.0 37.0 37.0 37.0 37.0 10-14 36.6534 37.0 37.0 37.0 37.0 37.0 15-19 36.6359 37.0 37.0 37.0 37.0 37.0 20-24 36.6118 37.0 37.0 37.0 37.0 37.0 25-29 36.5619 37.0 37.0 37.0 37.0 37.0 30-34 36.5407 37.0 37.0 37.0 37.0 37.0 35-39 36.495400000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4927 37.0 37.0 37.0 37.0 37.0 45-49 36.4573 37.0 37.0 37.0 37.0 37.0 50-54 36.4796 37.0 37.0 37.0 37.0 37.0 55-59 36.363600000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.357 37.0 37.0 37.0 37.0 37.0 65-69 36.332699999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3549 37.0 37.0 37.0 37.0 37.0 75-79 36.3572 37.0 37.0 37.0 37.0 37.0 80-84 36.3404 37.0 37.0 37.0 37.0 37.0 85-89 36.3092 37.0 37.0 37.0 37.0 37.0 90-94 36.3366 37.0 37.0 37.0 37.0 37.0 95-99 36.1933 37.0 37.0 37.0 37.0 37.0 100-104 36.2168 37.0 37.0 37.0 37.0 37.0 105-109 36.185199999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1416 37.0 37.0 37.0 37.0 37.0 115-119 36.036899999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0754 37.0 37.0 37.0 37.0 37.0 125-129 36.0127 37.0 37.0 37.0 37.0 37.0 130-134 35.9224 37.0 37.0 37.0 37.0 37.0 135-139 35.863800000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.7147 37.0 37.0 37.0 37.0 37.0 145-149 35.6713 37.0 37.0 37.0 37.0 37.0 150-151 35.542 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 2.0 24 0.0 25 6.0 26 4.0 27 5.0 28 7.0 29 21.0 30 15.0 31 36.0 32 50.0 33 50.0 34 105.0 35 293.0 36 3107.0 37 298.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.92994746059544 12.284213159869903 5.504128096072054 42.2817112834626 2 19.85 12.6 36.1 31.45 3 17.849999999999998 16.275000000000002 26.924999999999997 38.95 4 21.9 23.125 26.125 28.849999999999998 5 23.625 29.325000000000003 24.05 23.0 6 20.525 33.324999999999996 23.474999999999998 22.675 7 16.3 27.250000000000004 41.6 14.85 8 16.25 28.025 30.9 24.825 9 17.549999999999997 25.4 33.900000000000006 23.150000000000002 10-14 19.325 29.93 28.515 22.23 15-19 19.705000000000002 28.04 27.99 24.265 20-24 19.64 27.76 28.735 23.865 25-29 19.54 29.145 27.310000000000002 24.005000000000003 30-34 19.42 28.99 27.605 23.985 35-39 19.939999999999998 28.315 27.675 24.07 40-44 19.56 28.799999999999997 27.529999999999998 24.11 45-49 20.015 28.405 27.24 24.34 50-54 19.365 29.195 27.794999999999998 23.645 55-59 19.805 28.505000000000003 27.51 24.18 60-64 19.985 27.825 27.839999999999996 24.349999999999998 65-69 20.080000000000002 28.325 27.71 23.885 70-74 19.99 28.895 27.37 23.745 75-79 20.145 27.985 28.139999999999997 23.73 80-84 20.105 28.544999999999998 27.36 23.990000000000002 85-89 20.474999999999998 28.605000000000004 27.435 23.485 90-94 20.455000000000002 27.845 28.1 23.599999999999998 95-99 20.195 27.750000000000004 27.76 24.295 100-104 20.419999999999998 28.13 27.67 23.78 105-109 20.419999999999998 28.499999999999996 27.36 23.72 110-114 20.535 28.08 27.029999999999998 24.355 115-119 20.424999999999997 28.235 27.825 23.515 120-124 20.72 28.24 26.88 24.16 125-129 20.974999999999998 27.38 27.605 24.04 130-134 20.880000000000003 28.785 26.36 23.974999999999998 135-139 20.625 27.62 27.215 24.54 140-144 21.185000000000002 28.294999999999998 26.82 23.7 145-149 21.560000000000002 27.87 27.065 23.505000000000003 150-151 21.175 27.987499999999997 26.875 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.5 21 1.5 22 2.0 23 1.5 24 0.5 25 2.0 26 4.5 27 5.5 28 6.0 29 13.5 30 17.5 31 22.0 32 33.0 33 45.5 34 61.0 35 70.5 36 86.5 37 109.0 38 131.5 39 147.0 40 172.0 41 205.0 42 238.5 43 255.5 44 267.0 45 282.0 46 276.0 47 243.0 48 221.5 49 218.0 50 185.0 51 144.0 52 123.0 53 95.5 54 71.0 55 65.5 56 47.5 57 34.0 58 25.0 59 15.5 60 15.0 61 11.0 62 2.5 63 3.5 64 4.5 65 4.0 66 5.0 67 3.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.9 #Duplication Level Percentage of deduplicated Percentage of total 1 91.47414741474147 83.15 2 7.2607260726072615 13.200000000000001 3 1.1001100110011002 3.0 4 0.13751375137513752 0.5 5 0.0 0.0 6 0.0275027502750275 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCTTCTTCTTGTGTGGCTTATTGCCATTTACCCCGTCATTGACATTG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.1625 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.4124999999999996 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 3.9 0.0 0.0 0.0 0.0 132-133 4.25 0.0 0.0 0.0 0.0 134-135 4.5 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTTCA 10 0.006830828 145.0 4 >>END_MODULE SRR12917534 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917534_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3395 37.0 37.0 37.0 37.0 37.0 2 36.192 37.0 37.0 37.0 37.0 37.0 3 36.092 37.0 37.0 37.0 37.0 37.0 4 36.192 37.0 37.0 37.0 37.0 37.0 5 36.2895 37.0 37.0 37.0 37.0 37.0 6 36.2455 37.0 37.0 37.0 37.0 37.0 7 36.29 37.0 37.0 37.0 37.0 37.0 8 36.2625 37.0 37.0 37.0 37.0 37.0 9 36.2615 37.0 37.0 37.0 37.0 37.0 10-14 36.309 37.0 37.0 37.0 37.0 37.0 15-19 36.3116 37.0 37.0 37.0 37.0 37.0 20-24 36.2354 37.0 37.0 37.0 37.0 37.0 25-29 36.1495 37.0 37.0 37.0 37.0 37.0 30-34 36.0336 37.0 37.0 37.0 37.0 37.0 35-39 36.0234 37.0 37.0 37.0 37.0 37.0 40-44 36.07039999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.9918 37.0 37.0 37.0 37.0 37.0 50-54 35.9876 37.0 37.0 37.0 37.0 37.0 55-59 35.96679999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.9889 37.0 37.0 37.0 37.0 37.0 65-69 35.9239 37.0 37.0 37.0 37.0 37.0 70-74 35.9253 37.0 37.0 37.0 37.0 37.0 75-79 35.78660000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.84009999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.84100000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.852999999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.8017 37.0 37.0 37.0 37.0 37.0 100-104 35.7924 37.0 37.0 37.0 37.0 37.0 105-109 35.69699999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.6836 37.0 37.0 37.0 37.0 37.0 115-119 35.642999999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.54299999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.42190000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.4941 37.0 37.0 37.0 37.0 37.0 135-139 35.391999999999996 37.0 37.0 37.0 32.2 37.0 140-144 35.140699999999995 37.0 37.0 37.0 27.4 37.0 145-149 35.0383 37.0 37.0 37.0 25.0 37.0 150-151 34.598749999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 0.0 16 1.0 17 0.0 18 0.0 19 2.0 20 1.0 21 1.0 22 2.0 23 3.0 24 2.0 25 3.0 26 8.0 27 7.0 28 11.0 29 28.0 30 22.0 31 46.0 32 67.0 33 108.0 34 254.0 35 715.0 36 2587.0 37 127.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.825 26.25 10.025 27.900000000000002 2 27.200000000000003 25.525 30.7 16.575 3 20.4 27.575 33.175 18.85 4 22.425 35.175 23.474999999999998 18.925 5 26.125 36.6 20.549999999999997 16.725 6 20.599999999999998 39.775 21.65 17.974999999999998 7 20.625 23.400000000000002 37.2 18.775 8 20.95 25.825 29.7 23.525 9 21.875 24.675 30.8 22.650000000000002 10-14 23.369999999999997 29.220000000000002 26.064999999999998 21.345 15-19 23.474999999999998 28.73 26.619999999999997 21.175 20-24 22.805 28.655 27.36 21.18 25-29 23.630000000000003 28.144999999999996 26.979999999999997 21.245 30-34 22.650000000000002 28.09 27.83 21.43 35-39 23.72 27.925 27.665 20.69 40-44 22.975 27.944999999999997 28.335 20.745 45-49 23.275000000000002 27.58 28.26 20.885 50-54 23.32 27.415 27.894999999999996 21.37 55-59 24.04 28.000000000000004 27.235 20.724999999999998 60-64 23.849999999999998 28.144999999999996 27.384999999999998 20.62 65-69 23.14 28.435 27.175 21.25 70-74 24.22 27.02 27.794999999999998 20.965 75-79 24.07 28.355000000000004 27.325 20.25 80-84 24.05 27.97 27.339999999999996 20.64 85-89 23.669999999999998 27.725 28.015 20.59 90-94 23.87 28.28 27.405 20.445 95-99 23.72 28.410000000000004 27.065 20.805 100-104 24.13 27.700000000000003 27.755000000000003 20.415 105-109 24.585 28.27 26.96 20.185 110-114 24.36 27.275 27.67 20.695 115-119 24.395 28.33 26.745 20.53 120-124 24.335 27.689999999999998 27.474999999999998 20.5 125-129 24.73 27.71 27.065 20.495 130-134 25.665 27.715 26.5 20.119999999999997 135-139 25.185000000000002 27.63 27.275 19.91 140-144 25.36 27.925 26.52 20.195 145-149 25.805 26.855 27.435 19.905 150-151 26.575 26.937499999999996 26.737499999999997 19.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.0 24 0.5 25 2.0 26 2.5 27 3.0 28 7.5 29 12.0 30 14.0 31 18.0 32 22.5 33 31.0 34 44.0 35 57.5 36 70.5 37 87.0 38 126.0 39 166.0 40 193.0 41 225.5 42 252.0 43 296.5 44 306.0 45 278.5 46 269.0 47 262.0 48 239.5 49 204.0 50 165.5 51 148.5 52 130.0 53 90.0 54 66.0 55 43.5 56 30.5 57 27.5 58 24.0 59 17.0 60 11.5 61 11.0 62 10.0 63 7.0 64 4.5 65 2.5 66 1.0 67 0.5 68 0.5 69 2.0 70 2.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.825 #Duplication Level Percentage of deduplicated Percentage of total 1 91.71483622350675 83.3 2 6.881365262868153 12.5 3 1.1835948252133224 3.225 4 0.13762730525736308 0.5 5 0.0 0.0 6 0.055050922102945224 0.3 7 0.027525461051472612 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GAACCTTTTGCACCAAACAATCCAAAAGGTTTTGTTGGCAAAGCTCTTGG 6 0.15 No Hit GTTACAAGCGCAAATCACTCGAAGCAGAAGCTTACTCATTTTAATTACTC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3624999999999998 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 2.0250000000000004 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.4625000000000004 0.0 0.0 0.0 0.0 128-129 3.7750000000000004 0.0 0.0 0.0 0.0 130-131 3.975 0.0 0.0 0.0 0.0 132-133 4.325 0.0 0.0 0.0 0.0 134-135 4.575 0.0 0.0 0.0 0.0 136-137 4.762499999999999 0.0 0.0 0.0 0.0 138-139 5.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGTTTA 10 0.006830828 145.0 2 AGGTAGA 10 0.006830828 145.0 4 >>END_MODULE Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744429 spots for SRR12917534.sra Written 744429 spots for SRR12917534.sra Read 744438 spots for SRR12917534.sra Written 744438 spots for SRR12917534.sra SRR ids: ['SRR12917534.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_54_utt4k SRR12917534.sra spots: 14888589 blocks: [[1, 744429], [744430, 1488858], [1488859, 2233287], [2233288, 2977716], [2977717, 3722145], [3722146, 4466574], [4466575, 5211003], [5211004, 5955432], [5955433, 6699861], [6699862, 7444290], [7444291, 8188719], [8188720, 8933148], [8933149, 9677577], [9677578, 10422006], [10422007, 11166435], [11166436, 11910864], [11910865, 12655293], [12655294, 13399722], [13399723, 14144151], [14144152, 14888589]] SRR12917534 file size 5038093 SRR12917534 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917534 SRR12917534_1.fastq SRR12917534_2.fastq Input file: SRR12917534_1.fastq Paired file: SRR12917534_2.fastq trimmed: SRR12917534-trimmed-pair1.fastq, SRR12917534-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:05:51 2025 >> started Thu Feb 13 12:06:07 2025 >> done (16.149s) 14888589 read pairs processed; of these: 81 ( 0.00%) short read pairs filtered out after trimming by size control 15645 ( 0.11%) empty read pairs filtered out after trimming by size control 14872863 (99.89%) read pairs available; of these: 1142409 ( 7.68%) trimmed read pairs available after processing 13730454 (92.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 15 0.00% 21 11 0.00% 22 9 0.00% 23 16 0.00% 24 9 0.00% 25 14 0.00% 26 19 0.00% 27 14 0.00% 28 20 0.00% 29 18 0.00% 30 15 0.00% 31 24 0.00% 32 24 0.00% 33 18 0.00% 34 18 0.00% 35 30 0.00% 36 27 0.00% 37 23 0.00% 38 37 0.00% 39 36 0.00% 40 31 0.00% 41 32 0.00% 42 38 0.00% 43 53 0.00% 44 52 0.00% 45 44 0.00% 46 58 0.00% 47 48 0.00% 48 65 0.00% 49 77 0.00% 50 82 0.00% 51 108 0.00% 52 162 0.00% 53 146 0.00% 54 175 0.00% 55 166 0.00% 56 204 0.00% 57 231 0.00% 58 264 0.00% 59 288 0.00% 60 339 0.00% 61 396 0.00% 62 479 0.00% 63 510 0.00% 64 585 0.00% 65 680 0.00% 66 752 0.01% 67 815 0.01% 68 861 0.01% 69 1030 0.01% 70 1188 0.01% 71 1267 0.01% 72 1515 0.01% 73 1622 0.01% 74 1826 0.01% 75 2030 0.01% 76 2135 0.01% 77 2281 0.02% 78 2449 0.02% 79 2683 0.02% 80 2841 0.02% 81 3142 0.02% 82 3514 0.02% 83 3679 0.02% 84 4067 0.03% 85 4402 0.03% 86 4544 0.03% 87 4651 0.03% 88 4964 0.03% 89 5021 0.03% 90 5317 0.04% 91 5554 0.04% 92 5985 0.04% 93 6303 0.04% 94 6750 0.05% 95 6937 0.05% 96 7374 0.05% 97 7729 0.05% 98 7918 0.05% 99 8116 0.05% 100 8435 0.06% 101 8616 0.06% 102 8832 0.06% 103 9261 0.06% 104 9864 0.07% 105 10315 0.07% 106 11067 0.07% 107 11275 0.08% 108 11472 0.08% 109 11900 0.08% 110 11790 0.08% 111 12326 0.08% 112 12584 0.08% 113 13294 0.09% 114 13565 0.09% 115 14033 0.09% 116 14930 0.10% 117 15220 0.10% 118 15891 0.11% 119 16161 0.11% 120 16682 0.11% 121 16869 0.11% 122 17210 0.12% 123 17534 0.12% 124 18109 0.12% 125 18737 0.13% 126 19855 0.13% 127 20435 0.14% 128 20547 0.14% 129 21287 0.14% 130 21906 0.15% 131 22341 0.15% 132 22573 0.15% 133 23147 0.16% 134 23361 0.16% 135 24516 0.16% 136 25160 0.17% 137 25548 0.17% 138 26515 0.18% 139 27138 0.18% 140 27621 0.19% 141 27820 0.19% 142 29003 0.20% 143 29008 0.20% 144 29878 0.20% 145 30399 0.20% 146 30975 0.21% 147 31589 0.21% 148 32307 0.22% 149 32761 0.22% 150 33764 0.23% 151 13730454 92.32% 14872863 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=5.93 fanout-score-rank=18 prefix-density=0.28 prefix-fanout=4.1 sequence=CAATTTTCTCAATAGCTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=78.60 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.7 sequence=AACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=33 prefix-density=0.30 prefix-fanout=2.3 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=720.88 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=17.3 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12917534 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:06:52 Started mapping on | Feb 13 12:06:52 Finished on | Feb 13 12:08:55 Mapping speed, Million of reads per hour | 435.30 Number of input reads | 14872863 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13963526 Uniquely mapped reads % | 93.89% Average mapped length | 296.90 Number of splices: Total | 13324307 Number of splices: Annotated (sjdb) | 13082896 Number of splices: GT/AG | 13083558 Number of splices: GC/AG | 192487 Number of splices: AT/AC | 13402 Number of splices: Non-canonical | 34860 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 367535 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 72403 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.02% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 541802 541802 541802 N_multimapping 367535 367535 367535 N_noFeature 333409 13802684 397705 N_ambiguous 169980 1013 72716 UnstrandedReadsAssigned:13460137 PositiveStrandReadsAssigned:159829 NegativeStrandReadsAssigned:13493105 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917534 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917534-trimmed-pair1.fastq SRR12917534-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,872,863 reads, 13,535,777 reads pseudoaligned [quant] estimated average fragment length: 273.277 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,030 rounds 52401 SRR12917534.ke.tsv 34699 SRR12917534.se.tsv 87100 total ==> SRR12917534.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.72 434 16.8601 Potri.005G024800.1.v4.1 1035 762.723 134 11.9147 Potri.004G059700.1.v4.1 961 688.907 171 16.8338 Potri.007G009000.2.v4.1 1416 1143.72 0 0 Potri.003G141000.2.v4.1 2943 2670.72 636 16.1501 Potri.016G087400.1.v4.1 270 78.352 1408 1218.71 Potri.015G069301.1.v4.1 564 308.057 0 0 Potri.010G195200.1.v4.1 1773 1500.72 85 3.84118 Potri.012G127500.1.v4.1 977 704.839 14005 1347.53 ==> SRR12917534.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 308 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 356 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR12917534 completed mapping pipeline successfully