Starting /dee2/code/volunteer_pipeline.sh SRR12917535 current disk space = 3092481064960 free memory = 1414581448 SRR12917535 SRAfilesize 2193cb92ef5f336e165d82f820127e33 SRR12917535.sra SRR12917535.sra file validated SRR12917535 is paired end SRR12917535 is conventional basespace SRR12917535 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917535_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.56775 37.0 37.0 37.0 37.0 37.0 2 36.4795 37.0 37.0 37.0 37.0 37.0 3 36.522 37.0 37.0 37.0 37.0 37.0 4 36.5905 37.0 37.0 37.0 37.0 37.0 5 36.5935 37.0 37.0 37.0 37.0 37.0 6 36.662 37.0 37.0 37.0 37.0 37.0 7 36.602 37.0 37.0 37.0 37.0 37.0 8 36.523 37.0 37.0 37.0 37.0 37.0 9 36.6445 37.0 37.0 37.0 37.0 37.0 10-14 36.62220000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.6156 37.0 37.0 37.0 37.0 37.0 20-24 36.5615 37.0 37.0 37.0 37.0 37.0 25-29 36.5292 37.0 37.0 37.0 37.0 37.0 30-34 36.496500000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.47580000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.441 37.0 37.0 37.0 37.0 37.0 45-49 36.376999999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.4099 37.0 37.0 37.0 37.0 37.0 55-59 36.3317 37.0 37.0 37.0 37.0 37.0 60-64 36.3183 37.0 37.0 37.0 37.0 37.0 65-69 36.238099999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.281400000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.2965 37.0 37.0 37.0 37.0 37.0 80-84 36.3009 37.0 37.0 37.0 37.0 37.0 85-89 36.248900000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.269 37.0 37.0 37.0 37.0 37.0 95-99 36.1594 37.0 37.0 37.0 37.0 37.0 100-104 36.1344 37.0 37.0 37.0 37.0 37.0 105-109 36.108799999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.0589 37.0 37.0 37.0 37.0 37.0 115-119 36.011900000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.030199999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.9101 37.0 37.0 37.0 37.0 37.0 130-134 35.875299999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.7812 37.0 37.0 37.0 37.0 37.0 140-144 35.660700000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.5043 37.0 37.0 37.0 37.0 37.0 150-151 35.25925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 3.0 22 0.0 23 1.0 24 0.0 25 9.0 26 3.0 27 6.0 28 10.0 29 10.0 30 19.0 31 35.0 32 48.0 33 86.0 34 113.0 35 327.0 36 3045.0 37 282.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.41085271317829 14.553638409602401 5.401350337584396 36.63415853963491 2 18.525 11.0 38.85 31.624999999999996 3 15.25 15.8 28.449999999999996 40.5 4 19.45 22.25 26.125 32.175 5 22.625 27.575 26.450000000000003 23.35 6 20.4 32.9 23.150000000000002 23.549999999999997 7 14.7 28.799999999999997 41.475 15.024999999999999 8 16.425 26.275 33.074999999999996 24.224999999999998 9 15.775 23.525 37.45 23.25 10-14 19.005 29.759999999999998 27.57 23.665 15-19 19.525000000000002 27.950000000000003 27.500000000000004 25.025 20-24 20.175 27.860000000000003 27.925 24.04 25-29 19.34 28.32 27.845 24.495 30-34 19.03 28.515 27.72 24.735 35-39 19.71 28.235 27.355 24.7 40-44 19.675 28.575 27.615000000000002 24.135 45-49 20.385 28.51 27.01 24.095 50-54 20.125 28.425 27.884999999999998 23.565 55-59 19.7 28.555000000000003 27.47 24.275 60-64 20.32 27.79 27.46 24.43 65-69 20.21 28.65 27.12 24.02 70-74 19.865 28.115000000000002 27.91 24.11 75-79 20.615 28.194999999999997 26.695 24.495 80-84 20.810000000000002 27.925 27.62 23.645 85-89 20.080000000000002 28.110000000000003 27.750000000000004 24.060000000000002 90-94 20.080000000000002 27.49 27.439999999999998 24.990000000000002 95-99 20.369999999999997 27.61 27.689999999999998 24.33 100-104 20.49 27.58 28.465 23.465 105-109 20.695 27.685 27.955000000000002 23.665 110-114 20.93 28.37 27.02 23.68 115-119 20.915 28.475 26.395000000000003 24.215 120-124 20.785 28.4 26.68 24.135 125-129 21.3 27.98 26.77 23.95 130-134 20.51 27.500000000000004 27.775 24.215 135-139 21.41 27.18 26.815 24.595 140-144 21.415 26.99 26.889999999999997 24.705 145-149 20.825 27.095000000000002 27.495000000000005 24.585 150-151 21.0625 27.5875 26.375 24.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 1.0 23 2.5 24 1.5 25 1.0 26 3.5 27 5.5 28 6.0 29 9.0 30 12.5 31 18.0 32 24.5 33 30.5 34 41.5 35 56.0 36 76.5 37 105.5 38 133.0 39 152.0 40 181.0 41 208.0 42 231.0 43 247.0 44 255.0 45 259.0 46 268.0 47 268.5 48 250.0 49 230.0 50 209.0 51 174.5 52 127.0 53 98.0 54 81.5 55 58.5 56 35.5 57 27.0 58 21.5 59 19.0 60 19.0 61 14.0 62 7.5 63 4.5 64 2.5 65 2.5 66 5.0 67 3.0 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.81892555222252 84.175 2 7.444777747477501 13.65 3 0.5999454595036815 1.6500000000000001 4 0.109080992637033 0.4 5 0.02727024815925825 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAACCGTTTAGTGTCCCGCTATGGAACCTTCTGCCCGCAATGTCAACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.11249999999999999 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.425 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.6875 0.0 0.0 0.0 0.0 112-113 3.1625 0.0 0.0 0.0 0.0 114-115 3.4749999999999996 0.0 0.0 0.0 0.0 116-117 3.8625000000000003 0.0 0.0 0.0 0.0 118-119 4.237500000000001 0.0 0.0 0.0 0.0 120-121 4.675 0.0 0.0 0.0 0.0 122-123 5.2 0.0 0.0 0.0 0.0 124-125 5.5625 0.0 0.0 0.0 0.0 126-127 5.975 0.0 0.0 0.0 0.0 128-129 6.45 0.0 0.0 0.0 0.0 130-131 7.0375 0.0 0.0 0.0 0.0 132-133 7.5875 0.0 0.0 0.0 0.0 134-135 8.2125 0.0 0.0 0.0 0.0 136-137 8.6875 0.0 0.0 0.0 0.0 138-139 9.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGTG 10 0.006830828 145.0 7 CTTCTGT 10 0.006830828 145.0 6 AAAAAAA 35 0.0035366106 20.714287 75-79 >>END_MODULE SRR12917535 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917535_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.24925 37.0 37.0 37.0 37.0 37.0 2 36.1575 37.0 37.0 37.0 37.0 37.0 3 36.1365 37.0 37.0 37.0 37.0 37.0 4 36.193 37.0 37.0 37.0 37.0 37.0 5 36.3505 37.0 37.0 37.0 37.0 37.0 6 36.2435 37.0 37.0 37.0 37.0 37.0 7 36.294 37.0 37.0 37.0 37.0 37.0 8 36.3015 37.0 37.0 37.0 37.0 37.0 9 36.3 37.0 37.0 37.0 37.0 37.0 10-14 36.319900000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.278800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.231700000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.0988 37.0 37.0 37.0 37.0 37.0 30-34 36.097 37.0 37.0 37.0 37.0 37.0 35-39 36.1152 37.0 37.0 37.0 37.0 37.0 40-44 36.0592 37.0 37.0 37.0 37.0 37.0 45-49 35.9656 37.0 37.0 37.0 37.0 37.0 50-54 35.9485 37.0 37.0 37.0 37.0 37.0 55-59 36.010299999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.978899999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.926700000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9552 37.0 37.0 37.0 37.0 37.0 75-79 35.8459 37.0 37.0 37.0 37.0 37.0 80-84 35.88420000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.9018 37.0 37.0 37.0 37.0 37.0 90-94 35.8733 37.0 37.0 37.0 37.0 37.0 95-99 35.9006 37.0 37.0 37.0 37.0 37.0 100-104 35.7846 37.0 37.0 37.0 37.0 37.0 105-109 35.76520000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.6565 37.0 37.0 37.0 37.0 37.0 115-119 35.6462 37.0 37.0 37.0 37.0 37.0 120-124 35.52419999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.479099999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4051 37.0 37.0 37.0 37.0 37.0 135-139 35.3682 37.0 37.0 37.0 37.0 37.0 140-144 35.23369999999999 37.0 37.0 37.0 32.2 37.0 145-149 35.0686 37.0 37.0 37.0 27.4 37.0 150-151 34.624 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 3.0 16 0.0 17 2.0 18 1.0 19 3.0 20 2.0 21 3.0 22 4.0 23 6.0 24 9.0 25 7.0 26 9.0 27 8.0 28 11.0 29 20.0 30 25.0 31 40.0 32 59.0 33 91.0 34 187.0 35 646.0 36 2669.0 37 191.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.38459614903726 28.032008002000502 8.927231807951989 24.656164041010253 2 27.700000000000003 26.200000000000003 32.275 13.825000000000001 3 19.0 27.425 34.225 19.35 4 22.650000000000002 34.525 24.4 18.425 5 26.25 35.975 20.075000000000003 17.7 6 21.224999999999998 38.95 22.225 17.599999999999998 7 21.25 24.55 36.15 18.05 8 20.125 26.900000000000002 29.375 23.599999999999998 9 20.925 25.124999999999996 31.1 22.85 10-14 23.89 29.28 26.465 20.365 15-19 23.515 28.02 27.235 21.23 20-24 23.419999999999998 28.299999999999997 27.250000000000004 21.029999999999998 25-29 23.285 28.54 27.284999999999997 20.89 30-34 23.01 28.065 28.035 20.89 35-39 23.369999999999997 28.16 27.05 21.42 40-44 24.224999999999998 28.355000000000004 26.915 20.505000000000003 45-49 23.369999999999997 28.565 27.200000000000003 20.865000000000002 50-54 23.330000000000002 28.444999999999997 27.650000000000002 20.575 55-59 24.44 27.955000000000002 26.99 20.615 60-64 23.46 28.005000000000003 27.26 21.275 65-69 23.86 27.845 27.46 20.835 70-74 23.674999999999997 27.555000000000003 27.93 20.84 75-79 24.075 27.825 27.565 20.535 80-84 24.7 27.215 27.250000000000004 20.835 85-89 24.275 27.495000000000005 26.935 21.295 90-94 24.64 27.755000000000003 27.060000000000002 20.544999999999998 95-99 24.3 28.215 26.88 20.605 100-104 23.94 28.499999999999996 27.134999999999998 20.424999999999997 105-109 24.45 27.894999999999996 26.779999999999998 20.875 110-114 24.695 28.535 26.245 20.525 115-119 25.345000000000002 28.560000000000002 26.755000000000003 19.34 120-124 25.369999999999997 28.32 26.640000000000004 19.67 125-129 25.28 27.935 26.625 20.16 130-134 25.540000000000003 28.765 26.334999999999997 19.36 135-139 25.330000000000002 28.799999999999997 26.355 19.515 140-144 26.135 28.349999999999998 26.13 19.384999999999998 145-149 26.415 28.09 26.14 19.355 150-151 26.85 28.287499999999998 25.137500000000003 19.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 2.0 16 2.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 1.5 24 1.5 25 1.0 26 2.5 27 4.5 28 4.5 29 4.5 30 4.5 31 7.0 32 18.0 33 31.5 34 39.0 35 54.0 36 75.0 37 98.5 38 128.0 39 160.5 40 205.0 41 233.0 42 258.5 43 302.0 44 301.5 45 270.5 46 269.5 47 273.5 48 231.0 49 187.5 50 172.0 51 148.5 52 110.5 53 88.0 54 74.5 55 56.0 56 46.5 57 28.5 58 17.0 59 15.5 60 13.5 61 9.0 62 5.5 63 5.5 64 2.5 65 3.0 66 2.5 67 3.0 68 2.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.2846237731734 84.625 2 6.870229007633588 12.6 3 0.5997818974918212 1.6500000000000001 4 0.16357688113413305 0.6 5 0.02726281352235551 0.125 6 0.0 0.0 7 0.02726281352235551 0.17500000000000002 8 0.0 0.0 9 0.02726281352235551 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit TTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTACATAGAATGT 7 0.17500000000000002 No Hit CAAACATCTAATTCTACAATAAGCTAGCTTTTACGTTGCAAACCTTGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.11249999999999999 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 1.925 0.0 0.0 0.0 0.0 108-109 2.2249999999999996 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.2125 0.0 0.0 0.0 0.0 114-115 3.5250000000000004 0.0 0.0 0.0 0.0 116-117 3.9125 0.0 0.0 0.0 0.0 118-119 4.2875 0.0 0.0 0.0 0.0 120-121 4.725 0.0 0.0 0.0 0.0 122-123 5.275 0.0 0.0 0.0 0.0 124-125 5.6375 0.0 0.0 0.0 0.0 126-127 6.05 0.0 0.0 0.0 0.0 128-129 6.5375 0.0 0.0 0.0 0.0 130-131 7.125 0.0 0.0 0.0 0.0 132-133 7.6625 0.0 0.0 0.0 0.0 134-135 8.2875 0.0 0.0 0.0 0.0 136-137 8.7625 0.0 0.0 0.0 0.0 138-139 9.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTTT 10 0.006830828 145.0 4 AACTTTT 10 0.006830828 145.0 3 TTTTTTT 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575537 spots for SRR12917535.sra Written 575537 spots for SRR12917535.sra Read 575547 spots for SRR12917535.sra Written 575547 spots for SRR12917535.sra SRR ids: ['SRR12917535.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pp9jphgj SRR12917535.sra spots: 11510750 blocks: [[1, 575537], [575538, 1151074], [1151075, 1726611], [1726612, 2302148], [2302149, 2877685], [2877686, 3453222], [3453223, 4028759], [4028760, 4604296], [4604297, 5179833], [5179834, 5755370], [5755371, 6330907], [6330908, 6906444], [6906445, 7481981], [7481982, 8057518], [8057519, 8633055], [8633056, 9208592], [9208593, 9784129], [9784130, 10359666], [10359667, 10935203], [10935204, 11510750]] SRR12917535 file size 3890156 SRR12917535 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917535 SRR12917535_1.fastq SRR12917535_2.fastq Input file: SRR12917535_1.fastq Paired file: SRR12917535_2.fastq trimmed: SRR12917535-trimmed-pair1.fastq, SRR12917535-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:16:28 2025 >> started Thu Feb 13 12:16:42 2025 >> done (14.434s) 11510750 read pairs processed; of these: 90 ( 0.00%) short read pairs filtered out after trimming by size control 4806 ( 0.04%) empty read pairs filtered out after trimming by size control 11505854 (99.96%) read pairs available; of these: 1548299 (13.46%) trimmed read pairs available after processing 9957555 (86.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 11 0.00% 21 14 0.00% 22 6 0.00% 23 12 0.00% 24 18 0.00% 25 14 0.00% 26 22 0.00% 27 22 0.00% 28 22 0.00% 29 24 0.00% 30 27 0.00% 31 32 0.00% 32 24 0.00% 33 32 0.00% 34 28 0.00% 35 19 0.00% 36 33 0.00% 37 27 0.00% 38 43 0.00% 39 49 0.00% 40 48 0.00% 41 44 0.00% 42 37 0.00% 43 56 0.00% 44 46 0.00% 45 42 0.00% 46 51 0.00% 47 64 0.00% 48 65 0.00% 49 64 0.00% 50 86 0.00% 51 105 0.00% 52 112 0.00% 53 111 0.00% 54 130 0.00% 55 151 0.00% 56 145 0.00% 57 150 0.00% 58 226 0.00% 59 245 0.00% 60 286 0.00% 61 326 0.00% 62 363 0.00% 63 428 0.00% 64 457 0.00% 65 530 0.00% 66 615 0.01% 67 642 0.01% 68 692 0.01% 69 840 0.01% 70 968 0.01% 71 1097 0.01% 72 1309 0.01% 73 1538 0.01% 74 1669 0.01% 75 1722 0.01% 76 2076 0.02% 77 2234 0.02% 78 2357 0.02% 79 2616 0.02% 80 2901 0.03% 81 3167 0.03% 82 3714 0.03% 83 4058 0.04% 84 4516 0.04% 85 5093 0.04% 86 5263 0.05% 87 5713 0.05% 88 6060 0.05% 89 6323 0.05% 90 6678 0.06% 91 7318 0.06% 92 7770 0.07% 93 8254 0.07% 94 9248 0.08% 95 9726 0.08% 96 10331 0.09% 97 11037 0.10% 98 11354 0.10% 99 11833 0.10% 100 12082 0.11% 101 12476 0.11% 102 12784 0.11% 103 14035 0.12% 104 14960 0.13% 105 15353 0.13% 106 16308 0.14% 107 16883 0.15% 108 17380 0.15% 109 18092 0.16% 110 17920 0.16% 111 18703 0.16% 112 19457 0.17% 113 19413 0.17% 114 20438 0.18% 115 20882 0.18% 116 21900 0.19% 117 22940 0.20% 118 23672 0.21% 119 23921 0.21% 120 24567 0.21% 121 24892 0.22% 122 24693 0.21% 123 25711 0.22% 124 26414 0.23% 125 27142 0.24% 126 27859 0.24% 127 29160 0.25% 128 29817 0.26% 129 30406 0.26% 130 31202 0.27% 131 30907 0.27% 132 31569 0.27% 133 31706 0.28% 134 32297 0.28% 135 33019 0.29% 136 33656 0.29% 137 34916 0.30% 138 35290 0.31% 139 35987 0.31% 140 36704 0.32% 141 37133 0.32% 142 37040 0.32% 143 37012 0.32% 144 37888 0.33% 145 38080 0.33% 146 38468 0.33% 147 39409 0.34% 148 39336 0.34% 149 40242 0.35% 150 40586 0.35% 151 9957555 86.54% 11505854 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=29 prefix-density=0.45 prefix-fanout=2.2 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCCAGAGTCTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACA criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=113.52 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=17.0 sequence=TCCTTCTTCACAATG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=34 prefix-density=0.33 prefix-fanout=2.3 sequence=AATGCCTGCCCGGAAAACCCAAAGTTGTCTTTGGATCGAAGAGTTCTACTTCTGATTTTTACGTTCGAAATAAAGCATACGGAGACTTCCTTAACGATAATTTTGATGCAAAAATTGCCGATACAGCAAGTGCTTCTGTAGCTTTGACATCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=463.77 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=17.7 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCGGAGAGGAGAAAGAAGGGGCCAAGTATGTGAGAATGGAAAGGAGGGTTGGTAAGTTTATGAGGAAGTTTGTGTTGCCTGAGAA SRR12917535 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:17:28 Started mapping on | Feb 13 12:17:29 Finished on | Feb 13 12:19:09 Mapping speed, Million of reads per hour | 414.21 Number of input reads | 11505854 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10677791 Uniquely mapped reads % | 92.80% Average mapped length | 293.76 Number of splices: Total | 9840657 Number of splices: Annotated (sjdb) | 9640704 Number of splices: GT/AG | 9652309 Number of splices: GC/AG | 147277 Number of splices: AT/AC | 11958 Number of splices: Non-canonical | 29113 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 3.11 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297485 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 97107 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 530578 530578 530578 N_multimapping 297485 297485 297485 N_noFeature 249239 10543696 302965 N_ambiguous 137456 587 56794 UnstrandedReadsAssigned:10291096 PositiveStrandReadsAssigned:133508 NegativeStrandReadsAssigned:10318032 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917535 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917535-trimmed-pair1.fastq SRR12917535-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,505,854 reads, 10,423,801 reads pseudoaligned [quant] estimated average fragment length: 250.238 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR12917535.ke.tsv 34699 SRR12917535.se.tsv 87100 total ==> SRR12917535.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.76 358 16.85 Potri.005G024800.1.v4.1 1035 785.762 181 19.1767 Potri.004G059700.1.v4.1 961 711.943 14 1.63707 Potri.007G009000.2.v4.1 1416 1166.76 0 0 Potri.003G141000.2.v4.1 2943 2693.76 342 10.5694 Potri.016G087400.1.v4.1 270 90.3466 1250 1151.82 Potri.015G069301.1.v4.1 564 329.407 0 0 Potri.010G195200.1.v4.1 1773 1523.76 8 0.437077 Potri.012G127500.1.v4.1 977 727.872 12170 1391.94 ==> SRR12917535.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 155 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12917535 completed mapping pipeline successfully