Starting /dee2/code/volunteer_pipeline.sh SRR12917536 current disk space = 3092472467456 free memory = 1395446984 SRR12917536 SRAfilesize 40780160cee7410634fb0dc8f8750716 SRR12917536.sra SRR12917536.sra file validated SRR12917536 is paired end SRR12917536 is conventional basespace SRR12917536 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917536_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.607 37.0 37.0 37.0 37.0 37.0 2 36.454 37.0 37.0 37.0 37.0 37.0 3 36.651 37.0 37.0 37.0 37.0 37.0 4 36.6555 37.0 37.0 37.0 37.0 37.0 5 36.7055 37.0 37.0 37.0 37.0 37.0 6 36.664 37.0 37.0 37.0 37.0 37.0 7 36.6325 37.0 37.0 37.0 37.0 37.0 8 36.595 37.0 37.0 37.0 37.0 37.0 9 36.6645 37.0 37.0 37.0 37.0 37.0 10-14 36.6128 37.0 37.0 37.0 37.0 37.0 15-19 36.589999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5556 37.0 37.0 37.0 37.0 37.0 25-29 36.5208 37.0 37.0 37.0 37.0 37.0 30-34 36.484300000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.4907 37.0 37.0 37.0 37.0 37.0 40-44 36.471199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.413199999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4054 37.0 37.0 37.0 37.0 37.0 55-59 36.3874 37.0 37.0 37.0 37.0 37.0 60-64 36.3452 37.0 37.0 37.0 37.0 37.0 65-69 36.2731 37.0 37.0 37.0 37.0 37.0 70-74 36.3442 37.0 37.0 37.0 37.0 37.0 75-79 36.3329 37.0 37.0 37.0 37.0 37.0 80-84 36.334199999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.29 37.0 37.0 37.0 37.0 37.0 90-94 36.2846 37.0 37.0 37.0 37.0 37.0 95-99 36.21589999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.2178 37.0 37.0 37.0 37.0 37.0 105-109 36.1111 37.0 37.0 37.0 37.0 37.0 110-114 36.103 37.0 37.0 37.0 37.0 37.0 115-119 36.0631 37.0 37.0 37.0 37.0 37.0 120-124 36.0028 37.0 37.0 37.0 37.0 37.0 125-129 35.961 37.0 37.0 37.0 37.0 37.0 130-134 35.8863 37.0 37.0 37.0 37.0 37.0 135-139 35.808299999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.7168 37.0 37.0 37.0 37.0 37.0 145-149 35.7025 37.0 37.0 37.0 37.0 37.0 150-151 35.370999999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 1.0 24 2.0 25 2.0 26 4.0 27 11.0 28 12.0 29 10.0 30 20.0 31 24.0 32 40.0 33 71.0 34 131.0 35 330.0 36 3059.0 37 281.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.097048524262135 13.10655327663832 5.552776388194097 37.24362181090545 2 19.475 11.275 37.5 31.75 3 16.85 15.075 27.3 40.775 4 20.8 22.2 24.675 32.324999999999996 5 22.85 28.675 24.95 23.525 6 20.375 32.525 23.025000000000002 24.075 7 14.524999999999999 29.425 39.625 16.425 8 15.975 26.700000000000003 33.25 24.075 9 16.475 24.425 35.125 23.974999999999998 10-14 19.45 30.19 27.634999999999998 22.725 15-19 20.23 27.575 27.72 24.474999999999998 20-24 19.25 29.24 27.76 23.75 25-29 20.22 27.875 27.705000000000002 24.2 30-34 19.759999999999998 28.084999999999997 28.015 24.14 35-39 19.23 28.345 27.825 24.6 40-44 19.86 28.299999999999997 27.884999999999998 23.955000000000002 45-49 20.3 27.955000000000002 27.12 24.625 50-54 19.435 28.115000000000002 27.560000000000002 24.89 55-59 19.345000000000002 28.955 27.315 24.385 60-64 19.8 27.884999999999998 27.595 24.72 65-69 20.169999999999998 28.165000000000003 28.095 23.57 70-74 20.46 28.285 26.88 24.375 75-79 20.03 28.115000000000002 27.825 24.03 80-84 20.495 27.755000000000003 27.589999999999996 24.16 85-89 20.005 28.375 27.24 24.38 90-94 19.759999999999998 28.144999999999996 27.43 24.665 95-99 20.28 28.249999999999996 27.36 24.11 100-104 21.025 27.639999999999997 26.935 24.4 105-109 19.6 28.235 27.46 24.705 110-114 20.69 28.095 27.295 23.919999999999998 115-119 20.195 27.985 27.560000000000002 24.26 120-124 20.979999999999997 27.415 27.485 24.12 125-129 20.485 28.139999999999997 27.034999999999997 24.34 130-134 20.755000000000003 27.975 27.425 23.845 135-139 19.869999999999997 27.950000000000003 27.88 24.3 140-144 20.73 27.85 26.99 24.43 145-149 20.925 27.55 27.57 23.955000000000002 150-151 20.974999999999998 27.5875 27.275 24.1625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 1.0 21 2.0 22 1.0 23 1.0 24 3.0 25 5.0 26 4.0 27 3.5 28 7.0 29 11.0 30 15.5 31 26.5 32 32.5 33 35.5 34 49.0 35 68.0 36 79.0 37 92.5 38 119.0 39 141.5 40 181.0 41 208.5 42 212.5 43 246.5 44 265.5 45 259.5 46 273.0 47 277.0 48 256.5 49 227.5 50 188.0 51 141.5 52 110.5 53 94.0 54 76.5 55 60.0 56 49.0 57 38.5 58 30.0 59 24.0 60 20.0 61 15.5 62 8.5 63 7.0 64 6.0 65 5.5 66 5.5 67 3.5 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.75 #Duplication Level Percentage of deduplicated Percentage of total 1 91.74386920980926 84.175 2 7.574931880108991 13.900000000000002 3 0.6267029972752043 1.725 4 0.05449591280653951 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.625 0.0 0.0 0.0 0.0 128-129 2.975 0.0 0.0 0.0 0.0 130-131 3.275 0.0 0.0 0.0 0.0 132-133 3.4749999999999996 0.0 0.0 0.0 0.0 134-135 3.75 0.0 0.0 0.0 0.0 136-137 4.025 0.0 0.0 0.0 0.0 138-139 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTGT 10 0.006830828 145.0 1 GTCCATG 10 0.006830828 145.0 1 CAAACAT 10 0.006830828 145.0 8 >>END_MODULE SRR12917536 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917536_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.43575 37.0 37.0 37.0 37.0 37.0 2 36.391 37.0 37.0 37.0 37.0 37.0 3 36.3705 37.0 37.0 37.0 37.0 37.0 4 36.4415 37.0 37.0 37.0 37.0 37.0 5 36.511 37.0 37.0 37.0 37.0 37.0 6 36.4055 37.0 37.0 37.0 37.0 37.0 7 36.4635 37.0 37.0 37.0 37.0 37.0 8 36.509 37.0 37.0 37.0 37.0 37.0 9 36.477 37.0 37.0 37.0 37.0 37.0 10-14 36.4582 37.0 37.0 37.0 37.0 37.0 15-19 36.42649999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.381600000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.319599999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.2405 37.0 37.0 37.0 37.0 37.0 35-39 36.2081 37.0 37.0 37.0 37.0 37.0 40-44 36.1919 37.0 37.0 37.0 37.0 37.0 45-49 36.121500000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.126799999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.0881 37.0 37.0 37.0 37.0 37.0 60-64 36.1224 37.0 37.0 37.0 37.0 37.0 65-69 36.1076 37.0 37.0 37.0 37.0 37.0 70-74 36.062599999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9388 37.0 37.0 37.0 37.0 37.0 80-84 36.019000000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0401 37.0 37.0 37.0 37.0 37.0 90-94 36.0535 37.0 37.0 37.0 37.0 37.0 95-99 36.0256 37.0 37.0 37.0 37.0 37.0 100-104 35.9463 37.0 37.0 37.0 37.0 37.0 105-109 35.91 37.0 37.0 37.0 37.0 37.0 110-114 35.9288 37.0 37.0 37.0 37.0 37.0 115-119 35.8256 37.0 37.0 37.0 37.0 37.0 120-124 35.769999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.6703 37.0 37.0 37.0 37.0 37.0 130-134 35.6438 37.0 37.0 37.0 37.0 37.0 135-139 35.6334 37.0 37.0 37.0 37.0 37.0 140-144 35.4842 37.0 37.0 37.0 37.0 37.0 145-149 35.351 37.0 37.0 37.0 32.2 37.0 150-151 34.881 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 4.0 15 3.0 16 1.0 17 2.0 18 0.0 19 2.0 20 5.0 21 1.0 22 1.0 23 2.0 24 4.0 25 8.0 26 0.0 27 7.0 28 16.0 29 13.0 30 16.0 31 24.0 32 53.0 33 91.0 34 170.0 35 507.0 36 2824.0 37 244.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.03450862715679 27.53188297074269 9.077269317329332 25.35633908477119 2 29.099999999999998 25.424999999999997 29.125 16.35 3 20.599999999999998 28.725 32.275 18.4 4 24.05 34.1 23.5 18.35 5 26.650000000000002 35.15 21.05 17.150000000000002 6 21.05 40.150000000000006 20.724999999999998 18.075 7 22.0 23.075000000000003 36.125 18.8 8 20.225 27.474999999999998 27.900000000000002 24.4 9 20.7 25.3 29.775000000000002 24.224999999999998 10-14 23.61 30.17 25.674999999999997 20.544999999999998 15-19 23.39 28.310000000000002 27.37 20.93 20-24 23.549999999999997 29.26 26.155 21.035 25-29 23.425 28.455000000000002 27.08 21.04 30-34 22.795 28.155 27.73 21.32 35-39 23.425 28.13 27.215 21.23 40-44 23.64 28.23 27.279999999999998 20.849999999999998 45-49 24.169999999999998 27.889999999999997 26.99 20.95 50-54 23.735 28.294999999999998 26.85 21.12 55-59 24.085 27.985 27.27 20.66 60-64 23.935000000000002 27.41 27.665 20.990000000000002 65-69 23.66 28.58 26.939999999999998 20.82 70-74 23.895 27.765 27.165 21.175 75-79 24.3 27.689999999999998 27.265 20.745 80-84 23.630000000000003 27.98 27.16 21.23 85-89 24.115000000000002 27.43 27.644999999999996 20.810000000000002 90-94 24.115000000000002 28.025 27.224999999999998 20.635 95-99 23.849999999999998 27.534999999999997 27.685 20.93 100-104 24.44 28.005000000000003 26.93 20.625 105-109 24.099999999999998 27.275 27.310000000000002 21.315 110-114 24.22 28.405 27.060000000000002 20.315 115-119 24.55 27.825 26.805 20.82 120-124 24.115000000000002 28.465 26.669999999999998 20.75 125-129 24.585 28.555000000000003 26.445 20.415 130-134 24.675 27.779999999999998 27.13 20.415 135-139 25.11 27.61 27.095000000000002 20.185 140-144 24.89 28.26 26.415 20.435 145-149 25.5 27.839999999999996 26.674999999999997 19.985 150-151 26.2125 28.299999999999997 25.95 19.537499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.5 21 1.0 22 0.0 23 0.0 24 1.0 25 1.5 26 3.0 27 4.0 28 4.0 29 8.5 30 13.5 31 15.0 32 16.5 33 23.0 34 38.5 35 62.0 36 88.0 37 93.0 38 105.5 39 150.5 40 201.0 41 235.0 42 265.5 43 266.0 44 258.5 45 285.0 46 278.5 47 253.5 48 247.0 49 216.0 50 187.0 51 157.5 52 114.5 53 92.0 54 63.5 55 47.0 56 41.0 57 30.0 58 27.5 59 24.0 60 16.0 61 11.0 62 8.0 63 6.0 64 7.5 65 6.5 66 2.0 67 1.5 68 3.0 69 2.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.20743958729297 84.89999999999999 2 7.1409177301113225 13.15 3 0.5701873472712462 1.575 4 0.054303556882975834 0.2 5 0.0 0.0 6 0.0 0.0 7 0.027151778441487917 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.0999999999999996 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.6125 0.0 0.0 0.0 0.0 128-129 3.0 0.0 0.0 0.0 0.0 130-131 3.3375000000000004 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.8499999999999996 0.0 0.0 0.0 0.0 136-137 4.125 0.0 0.0 0.0 0.0 138-139 4.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519602 spots for SRR12917536.sra Written 519602 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra Read 519592 spots for SRR12917536.sra Written 519592 spots for SRR12917536.sra SRR ids: ['SRR12917536.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u1du6v5r SRR12917536.sra spots: 10391850 blocks: [[1, 519592], [519593, 1039184], [1039185, 1558776], [1558777, 2078368], [2078369, 2597960], [2597961, 3117552], [3117553, 3637144], [3637145, 4156736], [4156737, 4676328], [4676329, 5195920], [5195921, 5715512], [5715513, 6235104], [6235105, 6754696], [6754697, 7274288], [7274289, 7793880], [7793881, 8313472], [8313473, 8833064], [8833065, 9352656], [9352657, 9872248], [9872249, 10391850]] SRR12917536 file size 3509904 SRR12917536 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917536 SRR12917536_1.fastq SRR12917536_2.fastq Input file: SRR12917536_1.fastq Paired file: SRR12917536_2.fastq trimmed: SRR12917536-trimmed-pair1.fastq, SRR12917536-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:16:26 2025 >> started Thu Feb 13 12:16:38 2025 >> done (12.231s) 10391850 read pairs processed; of these: 86 ( 0.00%) short read pairs filtered out after trimming by size control 9997 ( 0.10%) empty read pairs filtered out after trimming by size control 10381767 (99.90%) read pairs available; of these: 831945 ( 8.01%) trimmed read pairs available after processing 9549822 (91.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 9 0.00% 21 10 0.00% 22 12 0.00% 23 5 0.00% 24 8 0.00% 25 16 0.00% 26 14 0.00% 27 17 0.00% 28 10 0.00% 29 14 0.00% 30 22 0.00% 31 22 0.00% 32 17 0.00% 33 34 0.00% 34 31 0.00% 35 27 0.00% 36 29 0.00% 37 34 0.00% 38 23 0.00% 39 13 0.00% 40 31 0.00% 41 23 0.00% 42 23 0.00% 43 31 0.00% 44 30 0.00% 45 32 0.00% 46 24 0.00% 47 39 0.00% 48 42 0.00% 49 37 0.00% 50 81 0.00% 51 48 0.00% 52 86 0.00% 53 74 0.00% 54 76 0.00% 55 90 0.00% 56 88 0.00% 57 102 0.00% 58 122 0.00% 59 138 0.00% 60 181 0.00% 61 199 0.00% 62 221 0.00% 63 210 0.00% 64 298 0.00% 65 341 0.00% 66 363 0.00% 67 389 0.00% 68 408 0.00% 69 486 0.00% 70 547 0.01% 71 618 0.01% 72 777 0.01% 73 875 0.01% 74 872 0.01% 75 997 0.01% 76 1123 0.01% 77 1246 0.01% 78 1283 0.01% 79 1446 0.01% 80 1584 0.02% 81 1729 0.02% 82 1926 0.02% 83 2128 0.02% 84 2408 0.02% 85 2691 0.03% 86 2740 0.03% 87 2937 0.03% 88 3135 0.03% 89 3179 0.03% 90 3392 0.03% 91 3678 0.04% 92 3777 0.04% 93 4225 0.04% 94 4588 0.04% 95 4940 0.05% 96 5200 0.05% 97 5363 0.05% 98 5656 0.05% 99 5771 0.06% 100 6059 0.06% 101 6146 0.06% 102 6433 0.06% 103 6848 0.07% 104 7149 0.07% 105 7489 0.07% 106 7853 0.08% 107 8293 0.08% 108 8576 0.08% 109 8642 0.08% 110 8881 0.09% 111 9203 0.09% 112 9392 0.09% 113 9514 0.09% 114 10069 0.10% 115 10454 0.10% 116 10938 0.11% 117 11553 0.11% 118 11775 0.11% 119 12082 0.12% 120 12386 0.12% 121 12707 0.12% 122 12810 0.12% 123 13179 0.13% 124 13578 0.13% 125 13931 0.13% 126 14497 0.14% 127 14958 0.14% 128 15730 0.15% 129 15951 0.15% 130 16675 0.16% 131 16745 0.16% 132 17008 0.16% 133 17053 0.16% 134 17494 0.17% 135 18086 0.17% 136 18593 0.18% 137 18763 0.18% 138 19732 0.19% 139 20550 0.20% 140 20537 0.20% 141 21073 0.20% 142 21274 0.20% 143 21525 0.21% 144 22210 0.21% 145 22625 0.22% 146 22560 0.22% 147 23408 0.23% 148 24035 0.23% 149 24255 0.23% 150 25150 0.24% 151 9549822 91.99% 10381767 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=34 prefix-density=0.48 prefix-fanout=2.1 sequence=AAAATTATCGTTAAGGAAGTCTCCGTATGCTTTATTTCGAACGTAAAAATCAGAAGTAGAACTCTTCGATCCAAAGACAACTTTGGGTTTTCCGGGCAGGCATTCATCAGAATAGCATTTTCTTAACTTCATATCCTTGAGCGCTTTAGTGGCAGCATCATACCAGGATGTGGTGATGGGAAGCCAGAAAACTTCCTTGGGTGCTTCACTTGGAGAGAACATGTTAATTTTCTCATACT criterion=fanout-score sequence-density=0.04 sequence-density-rank=37 fanout-score=31.63 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=5.1 sequence=TTATTTATTTAAGCAAAGTACCCAGCAACGCCACACATATGAATAGCAAGTAAGAGACTGGCCATGACATGGTTGCTGCATTTTTCTTTTGCGCGAGTTGCATTATTTCACTAACAAGGCTTGGCGCAAAAACAGCGGCGGCGGAACCCTTTGCATTCACCACCGGGAAAACCTTCAGTCTTGCACACACTAGCACAGTTGTGGCCTCTTACACATGGTCCTTTAAAACTATGGCTCTGTGACAAACAAACCCTAGCCTCAGCAGGTACCATCATTTCCTGGGAAGCCAGGGCAATGAGCAGCAACAAGAAAAGACCATAGCATTTCTTCTCCATCTCTCTGTCTAACAAGAACC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=29 prefix-density=0.66 prefix-fanout=2.5 sequence=AGTATGAGAAAATTAACATGTTCTCTCCAAGTGAAGCACCCAAGGAAGTTTTCTGGCTTCCCATCACCACATCCTGGTAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=244.51 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=12.7 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCG SRR12917536 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:17:22 Started mapping on | Feb 13 12:17:22 Finished on | Feb 13 12:18:43 Mapping speed, Million of reads per hour | 461.41 Number of input reads | 10381767 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 9646937 Uniquely mapped reads % | 92.92% Average mapped length | 296.85 Number of splices: Total | 8804778 Number of splices: Annotated (sjdb) | 8633273 Number of splices: GT/AG | 8643943 Number of splices: GC/AG | 124755 Number of splices: AT/AC | 10861 Number of splices: Non-canonical | 25219 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.01 Insertion rate per base | 0.03% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284100 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 104788 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 450730 450730 450730 N_multimapping 284100 284100 284100 N_noFeature 206771 9534137 253349 N_ambiguous 128221 518 61763 UnstrandedReadsAssigned:9311945 PositiveStrandReadsAssigned:112282 NegativeStrandReadsAssigned:9331825 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917536 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917536-trimmed-pair1.fastq SRR12917536-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,381,767 reads, 9,349,196 reads pseudoaligned [quant] estimated average fragment length: 271.054 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,030 rounds 52401 SRR12917536.ke.tsv 34699 SRR12917536.se.tsv 87100 total ==> SRR12917536.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.95 351 18.1445 Potri.005G024800.1.v4.1 1035 764.946 112 13.2298 Potri.004G059700.1.v4.1 961 691.069 54 7.06053 Potri.007G009000.2.v4.1 1416 1145.95 0 0 Potri.003G141000.2.v4.1 2943 2672.95 301.226 10.1828 Potri.016G087400.1.v4.1 270 78.5121 809.741 931.911 Potri.015G069301.1.v4.1 564 308.85 0 0 Potri.010G195200.1.v4.1 1773 1502.95 43 2.58518 Potri.012G127500.1.v4.1 977 706.989 10808 1381.33 ==> SRR12917536.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 104 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 166 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12917536 completed mapping pipeline successfully