Starting /dee2/code/volunteer_pipeline.sh SRR12917537 current disk space = 3092354719744 free memory = 1450104796 SRR12917537 SRAfilesize a65369b5def4db53022b00d06cc4f1a9 SRR12917537.sra SRR12917537.sra file validated SRR12917537 is paired end SRR12917537 is conventional basespace SRR12917537 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917537_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5445 37.0 37.0 37.0 37.0 37.0 2 36.537 37.0 37.0 37.0 37.0 37.0 3 36.645 37.0 37.0 37.0 37.0 37.0 4 36.6905 37.0 37.0 37.0 37.0 37.0 5 36.5745 37.0 37.0 37.0 37.0 37.0 6 36.598 37.0 37.0 37.0 37.0 37.0 7 36.561 37.0 37.0 37.0 37.0 37.0 8 36.547 37.0 37.0 37.0 37.0 37.0 9 36.5775 37.0 37.0 37.0 37.0 37.0 10-14 36.6104 37.0 37.0 37.0 37.0 37.0 15-19 36.600100000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5458 37.0 37.0 37.0 37.0 37.0 25-29 36.5493 37.0 37.0 37.0 37.0 37.0 30-34 36.5099 37.0 37.0 37.0 37.0 37.0 35-39 36.486200000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4945 37.0 37.0 37.0 37.0 37.0 45-49 36.4174 37.0 37.0 37.0 37.0 37.0 50-54 36.4204 37.0 37.0 37.0 37.0 37.0 55-59 36.369 37.0 37.0 37.0 37.0 37.0 60-64 36.3949 37.0 37.0 37.0 37.0 37.0 65-69 36.27140000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.333000000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.349599999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.3204 37.0 37.0 37.0 37.0 37.0 85-89 36.321099999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.314800000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.22260000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.17530000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.162600000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1134 37.0 37.0 37.0 37.0 37.0 115-119 36.01649999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.0409 37.0 37.0 37.0 37.0 37.0 125-129 35.9523 37.0 37.0 37.0 37.0 37.0 130-134 35.914199999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.7265 37.0 37.0 37.0 37.0 37.0 140-144 35.670100000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.607899999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.24875 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 3.0 26 2.0 27 5.0 28 15.0 29 16.0 30 23.0 31 27.0 32 48.0 33 75.0 34 130.0 35 317.0 36 3019.0 37 319.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.225 13.65 5.625 40.5 2 19.025 12.225 37.2 31.55 3 16.5 15.875 26.5 41.125 4 20.95 22.650000000000002 23.3 33.1 5 22.55 29.75 25.25 22.45 6 22.35 31.1 24.025 22.525000000000002 7 16.3 29.799999999999997 37.724999999999994 16.175 8 15.375 27.525 34.150000000000006 22.95 9 17.375 24.725 36.175000000000004 21.725 10-14 19.695 30.735 26.88 22.689999999999998 15-19 19.495 27.91 28.294999999999998 24.3 20-24 19.305 28.665000000000003 27.965 24.065 25-29 19.6 28.65 27.389999999999997 24.36 30-34 19.425 28.415000000000003 28.16 24.0 35-39 19.715 28.715000000000003 26.86 24.709999999999997 40-44 19.925 28.285 27.71 24.08 45-49 19.91 28.625 27.63 23.835 50-54 20.055 29.080000000000002 26.979999999999997 23.885 55-59 19.25 28.299999999999997 27.99 24.46 60-64 20.03 28.660000000000004 27.139999999999997 24.169999999999998 65-69 20.095 28.244999999999997 27.515 24.145 70-74 20.135 28.57 27.339999999999996 23.955000000000002 75-79 19.509999999999998 28.310000000000002 27.575 24.605 80-84 19.925 28.57 27.47 24.035 85-89 19.825 28.28 27.97 23.925 90-94 20.0 28.505000000000003 27.334999999999997 24.16 95-99 20.405 28.48 27.265 23.849999999999998 100-104 20.810000000000002 27.79 27.889999999999997 23.51 105-109 20.74 28.375 27.58 23.305 110-114 20.849999999999998 28.08 26.965 24.104999999999997 115-119 20.5 27.810000000000002 27.474999999999998 24.215 120-124 20.485 27.665 27.115000000000002 24.735 125-129 20.775 28.475 27.005000000000003 23.745 130-134 20.96 27.235 27.98 23.825 135-139 21.05 27.62 27.775 23.555 140-144 21.205 27.389999999999997 26.915 24.490000000000002 145-149 21.12 27.97 27.115000000000002 23.794999999999998 150-151 20.3125 28.525 26.125 25.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 0.5 22 1.5 23 1.5 24 4.0 25 4.5 26 2.0 27 3.0 28 6.0 29 11.0 30 11.5 31 17.5 32 31.5 33 37.5 34 45.5 35 69.5 36 84.0 37 97.0 38 128.5 39 160.0 40 186.0 41 215.5 42 243.0 43 272.5 44 285.0 45 281.0 46 264.5 47 255.5 48 238.0 49 193.5 50 169.5 51 148.5 52 125.5 53 98.5 54 71.5 55 56.5 56 39.0 57 27.0 58 24.0 59 21.0 60 16.0 61 10.5 62 6.5 63 5.0 64 5.0 65 3.5 66 6.0 67 5.5 68 3.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.10454669207732 84.575 2 7.051456575006807 12.950000000000001 3 0.7350939286686632 2.025 4 0.054451402123604685 0.2 5 0.054451402123604685 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACCACAATCAGCTTCTGAGTCCCTTTTCCCTTCTCGAATTGCTCTTTCC 5 0.125 No Hit CTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.2000000000000002 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.6375000000000002 0.0 0.0 0.0 0.0 114-115 1.7374999999999998 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 2.8375 0.0 0.0 0.0 0.0 126-127 3.125 0.0 0.0 0.0 0.0 128-129 3.375 0.0 0.0 0.0 0.0 130-131 3.7125000000000004 0.0 0.0 0.0 0.0 132-133 4.05 0.0 0.0 0.0 0.0 134-135 4.275 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138-139 5.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACAA 10 0.006830828 145.0 2 TTAATTG 10 0.006830828 145.0 9 >>END_MODULE SRR12917537 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917537_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3715 37.0 37.0 37.0 37.0 37.0 2 36.077 37.0 37.0 37.0 37.0 37.0 3 36.1155 37.0 37.0 37.0 37.0 37.0 4 36.3785 37.0 37.0 37.0 37.0 37.0 5 36.283 37.0 37.0 37.0 37.0 37.0 6 36.2185 37.0 37.0 37.0 37.0 37.0 7 36.191 37.0 37.0 37.0 37.0 37.0 8 36.3145 37.0 37.0 37.0 37.0 37.0 9 36.248 37.0 37.0 37.0 37.0 37.0 10-14 36.262100000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.2713 37.0 37.0 37.0 37.0 37.0 20-24 36.22109999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.09009999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.0734 37.0 37.0 37.0 37.0 37.0 35-39 35.991 37.0 37.0 37.0 37.0 37.0 40-44 36.0043 37.0 37.0 37.0 37.0 37.0 45-49 35.9584 37.0 37.0 37.0 37.0 37.0 50-54 35.9209 37.0 37.0 37.0 37.0 37.0 55-59 35.979400000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.014 37.0 37.0 37.0 37.0 37.0 65-69 35.9477 37.0 37.0 37.0 37.0 37.0 70-74 35.89209999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.7869 37.0 37.0 37.0 37.0 37.0 80-84 35.820499999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.8493 37.0 37.0 37.0 37.0 37.0 90-94 35.8605 37.0 37.0 37.0 37.0 37.0 95-99 35.830600000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.7598 37.0 37.0 37.0 37.0 37.0 105-109 35.7896 37.0 37.0 37.0 37.0 37.0 110-114 35.7219 37.0 37.0 37.0 37.0 37.0 115-119 35.6768 37.0 37.0 37.0 37.0 37.0 120-124 35.62929999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.610400000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.5911 37.0 37.0 37.0 37.0 37.0 135-139 35.473 37.0 37.0 37.0 37.0 37.0 140-144 35.3591 37.0 37.0 37.0 34.6 37.0 145-149 35.238200000000006 37.0 37.0 37.0 29.8 37.0 150-151 34.836 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 0.0 15 2.0 16 3.0 17 1.0 18 3.0 19 0.0 20 2.0 21 3.0 22 3.0 23 8.0 24 7.0 25 8.0 26 1.0 27 11.0 28 12.0 29 15.0 30 26.0 31 41.0 32 61.0 33 119.0 34 200.0 35 616.0 36 2660.0 37 195.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.724999999999994 25.95 9.5 26.825 2 27.125 25.55 30.025000000000002 17.299999999999997 3 18.65 27.3 34.475 19.575 4 23.325000000000003 32.5 24.875 19.3 5 26.924999999999997 34.325 22.275 16.475 6 21.05 39.95 20.724999999999998 18.275 7 21.4 23.5 37.05 18.05 8 21.45 25.924999999999997 29.549999999999997 23.075000000000003 9 21.75 24.575 29.799999999999997 23.875 10-14 23.48 28.76 26.31 21.45 15-19 23.669999999999998 28.615000000000002 26.889999999999997 20.825 20-24 23.105 28.93 27.169999999999998 20.794999999999998 25-29 23.369999999999997 28.405 27.46 20.765 30-34 22.939999999999998 28.134999999999998 27.755000000000003 21.17 35-39 23.505000000000003 28.199999999999996 27.515 20.78 40-44 23.25 28.425 27.284999999999997 21.04 45-49 23.465 28.915000000000003 27.12 20.5 50-54 23.855 28.275 27.41 20.46 55-59 23.965 27.900000000000002 27.584999999999997 20.549999999999997 60-64 23.985 27.935 27.279999999999998 20.8 65-69 23.044999999999998 27.644999999999996 27.985 21.325 70-74 24.685000000000002 27.87 26.77 20.674999999999997 75-79 23.64 28.315 27.74 20.305 80-84 24.135 27.615000000000002 27.235 21.015 85-89 24.44 27.800000000000004 26.889999999999997 20.87 90-94 24.93 27.445000000000004 27.57 20.055 95-99 23.575 28.655 27.310000000000002 20.46 100-104 23.580000000000002 28.439999999999998 27.275 20.705000000000002 105-109 24.625 27.889999999999997 27.33 20.155 110-114 24.490000000000002 28.16 27.089999999999996 20.26 115-119 24.425 28.37 26.845000000000002 20.36 120-124 25.014999999999997 27.325 27.18 20.48 125-129 24.165 28.23 27.42 20.185 130-134 25.165 27.33 27.284999999999997 20.22 135-139 24.965 27.560000000000002 27.139999999999997 20.335 140-144 25.045 28.555000000000003 26.625 19.775000000000002 145-149 25.369999999999997 28.470000000000002 26.715 19.445 150-151 25.687500000000004 27.462500000000002 26.2125 20.6375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.5 10 2.0 11 0.5 12 1.0 13 2.5 14 1.5 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.5 22 0.5 23 1.5 24 2.0 25 1.0 26 4.0 27 6.0 28 4.5 29 6.0 30 9.0 31 14.0 32 21.0 33 26.0 34 32.0 35 53.0 36 89.5 37 117.0 38 129.5 39 141.5 40 183.0 41 250.0 42 263.5 43 285.0 44 295.5 45 268.0 46 260.0 47 242.5 48 239.5 49 217.5 50 167.5 51 138.5 52 111.5 53 83.0 54 69.5 55 53.5 56 38.5 57 35.0 58 30.0 59 20.5 60 13.5 61 8.5 62 7.0 63 9.0 64 10.5 65 5.5 66 2.0 67 1.0 68 1.0 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.7027027027027 85.75 2 6.648648648648649 12.3 3 0.5675675675675675 1.575 4 0.05405405405405406 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02702702702702703 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.2000000000000002 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.7625000000000002 0.0 0.0 0.0 0.0 116-117 1.95 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.8875 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.4125 0.0 0.0 0.0 0.0 130-131 3.7375 0.0 0.0 0.0 0.0 132-133 4.075 0.0 0.0 0.0 0.0 134-135 4.300000000000001 0.0 0.0 0.0 0.0 136-137 4.7 0.0 0.0 0.0 0.0 138-139 5.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787511 spots for SRR12917537.sra Written 787511 spots for SRR12917537.sra Read 787516 spots for SRR12917537.sra Written 787516 spots for SRR12917537.sra SRR ids: ['SRR12917537.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pfhbbl36 SRR12917537.sra spots: 15750225 blocks: [[1, 787511], [787512, 1575022], [1575023, 2362533], [2362534, 3150044], [3150045, 3937555], [3937556, 4725066], [4725067, 5512577], [5512578, 6300088], [6300089, 7087599], [7087600, 7875110], [7875111, 8662621], [8662622, 9450132], [9450133, 10237643], [10237644, 11025154], [11025155, 11812665], [11812666, 12600176], [12600177, 13387687], [13387688, 14175198], [14175199, 14962709], [14962710, 15750225]] SRR12917537 file size 5330915 SRR12917537 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917537 SRR12917537_1.fastq SRR12917537_2.fastq Input file: SRR12917537_1.fastq Paired file: SRR12917537_2.fastq trimmed: SRR12917537-trimmed-pair1.fastq, SRR12917537-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:21:53 2025 >> started Thu Feb 13 12:22:10 2025 >> done (17.161s) 15750225 read pairs processed; of these: 50 ( 0.00%) short read pairs filtered out after trimming by size control 12773 ( 0.08%) empty read pairs filtered out after trimming by size control 15737402 (99.92%) read pairs available; of these: 1439947 ( 9.15%) trimmed read pairs available after processing 14297455 (90.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 4 0.00% 21 6 0.00% 22 5 0.00% 23 9 0.00% 24 12 0.00% 25 16 0.00% 26 11 0.00% 27 15 0.00% 28 13 0.00% 29 18 0.00% 30 13 0.00% 31 23 0.00% 32 21 0.00% 33 17 0.00% 34 22 0.00% 35 14 0.00% 36 21 0.00% 37 30 0.00% 38 30 0.00% 39 19 0.00% 40 30 0.00% 41 29 0.00% 42 30 0.00% 43 34 0.00% 44 30 0.00% 45 32 0.00% 46 38 0.00% 47 46 0.00% 48 51 0.00% 49 68 0.00% 50 62 0.00% 51 63 0.00% 52 95 0.00% 53 99 0.00% 54 101 0.00% 55 127 0.00% 56 117 0.00% 57 133 0.00% 58 187 0.00% 59 164 0.00% 60 238 0.00% 61 280 0.00% 62 329 0.00% 63 422 0.00% 64 430 0.00% 65 429 0.00% 66 554 0.00% 67 553 0.00% 68 629 0.00% 69 683 0.00% 70 889 0.01% 71 924 0.01% 72 1189 0.01% 73 1341 0.01% 74 1528 0.01% 75 1689 0.01% 76 1832 0.01% 77 1990 0.01% 78 2156 0.01% 79 2189 0.01% 80 2564 0.02% 81 2799 0.02% 82 3200 0.02% 83 3587 0.02% 84 3842 0.02% 85 4312 0.03% 86 4686 0.03% 87 4748 0.03% 88 5249 0.03% 89 5186 0.03% 90 5687 0.04% 91 5924 0.04% 92 6334 0.04% 93 6991 0.04% 94 7392 0.05% 95 8160 0.05% 96 8559 0.05% 97 8978 0.06% 98 9254 0.06% 99 9400 0.06% 100 9789 0.06% 101 10250 0.07% 102 10735 0.07% 103 11233 0.07% 104 12107 0.08% 105 12838 0.08% 106 13375 0.08% 107 14085 0.09% 108 14452 0.09% 109 14695 0.09% 110 14836 0.09% 111 15371 0.10% 112 15707 0.10% 113 16679 0.11% 114 17155 0.11% 115 18157 0.12% 116 18950 0.12% 117 19946 0.13% 118 20483 0.13% 119 20899 0.13% 120 21323 0.14% 121 21932 0.14% 122 22311 0.14% 123 22801 0.14% 124 23906 0.15% 125 24636 0.16% 126 25782 0.16% 127 26896 0.17% 128 27524 0.17% 129 28347 0.18% 130 28833 0.18% 131 29475 0.19% 132 30052 0.19% 133 30592 0.19% 134 31001 0.20% 135 31647 0.20% 136 32956 0.21% 137 33874 0.22% 138 34764 0.22% 139 35636 0.23% 140 36519 0.23% 141 37134 0.24% 142 37427 0.24% 143 37549 0.24% 144 38776 0.25% 145 39295 0.25% 146 39693 0.25% 147 40606 0.26% 148 42033 0.27% 149 42355 0.27% 150 43543 0.28% 151 14297455 90.85% 15737402 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=26 prefix-density=0.33 prefix-fanout=2.2 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=187.55 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=13.4 sequence=CAACAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTGGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCAC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=31 prefix-density=0.31 prefix-fanout=2.1 sequence=CACAGCAGTCCATGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=343.67 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=14.3 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12917537 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:22:55 Started mapping on | Feb 13 12:22:56 Finished on | Feb 13 12:24:46 Mapping speed, Million of reads per hour | 515.04 Number of input reads | 15737402 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14713759 Uniquely mapped reads % | 93.50% Average mapped length | 296.36 Number of splices: Total | 13790853 Number of splices: Annotated (sjdb) | 13528862 Number of splices: GT/AG | 13539235 Number of splices: GC/AG | 196389 Number of splices: AT/AC | 15589 Number of splices: Non-canonical | 39640 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 3.16 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 399975 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 158889 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 623668 623668 623668 N_multimapping 399975 399975 399975 N_noFeature 352849 14528743 417763 N_ambiguous 206895 956 86236 UnstrandedReadsAssigned:14154015 PositiveStrandReadsAssigned:184060 NegativeStrandReadsAssigned:14209760 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917537 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917537-trimmed-pair1.fastq SRR12917537-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,737,402 reads, 14,336,878 reads pseudoaligned [quant] estimated average fragment length: 264.984 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR12917537.ke.tsv 34699 SRR12917537.se.tsv 87100 total ==> SRR12917537.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.02 421 14.0369 Potri.005G024800.1.v4.1 1035 771.016 212 16.0803 Potri.004G059700.1.v4.1 961 697.157 78 6.54312 Potri.007G009000.2.v4.1 1416 1152.02 0 0 Potri.003G141000.2.v4.1 2943 2679.02 442 9.64869 Potri.016G087400.1.v4.1 270 81.7988 1713.93 1225.37 Potri.015G069301.1.v4.1 564 315.598 0 0 Potri.010G195200.1.v4.1 1773 1509.02 66 2.55783 Potri.012G127500.1.v4.1 977 713.097 11181 916.966 ==> SRR12917537.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 195 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 348 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 11 SRR12917537 completed mapping pipeline successfully