Starting /dee2/code/volunteer_pipeline.sh SRR12917538 current disk space = 3091102420992 free memory = 1574857892 SRR12917538 SRAfilesize 064bdb9d95a6e04275dab9acf125ee64 SRR12917538.sra SRR12917538.sra file validated SRR12917538 is paired end SRR12917538 is conventional basespace SRR12917538 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917538_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7315 37.0 37.0 37.0 37.0 37.0 2 36.5105 37.0 37.0 37.0 37.0 37.0 3 36.6055 37.0 37.0 37.0 37.0 37.0 4 36.622 37.0 37.0 37.0 37.0 37.0 5 36.732 37.0 37.0 37.0 37.0 37.0 6 36.675 37.0 37.0 37.0 37.0 37.0 7 36.5535 37.0 37.0 37.0 37.0 37.0 8 36.6175 37.0 37.0 37.0 37.0 37.0 9 36.644 37.0 37.0 37.0 37.0 37.0 10-14 36.6736 37.0 37.0 37.0 37.0 37.0 15-19 36.6188 37.0 37.0 37.0 37.0 37.0 20-24 36.55929999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.599000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4961 37.0 37.0 37.0 37.0 37.0 35-39 36.525999999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.493399999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.4394 37.0 37.0 37.0 37.0 37.0 50-54 36.415200000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.381800000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3574 37.0 37.0 37.0 37.0 37.0 65-69 36.2772 37.0 37.0 37.0 37.0 37.0 70-74 36.3883 37.0 37.0 37.0 37.0 37.0 75-79 36.3815 37.0 37.0 37.0 37.0 37.0 80-84 36.3639 37.0 37.0 37.0 37.0 37.0 85-89 36.309999999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.3295 37.0 37.0 37.0 37.0 37.0 95-99 36.2764 37.0 37.0 37.0 37.0 37.0 100-104 36.1982 37.0 37.0 37.0 37.0 37.0 105-109 36.2053 37.0 37.0 37.0 37.0 37.0 110-114 36.2096 37.0 37.0 37.0 37.0 37.0 115-119 36.1919 37.0 37.0 37.0 37.0 37.0 120-124 36.1169 37.0 37.0 37.0 37.0 37.0 125-129 36.060500000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.02720000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.925399999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8608 37.0 37.0 37.0 37.0 37.0 145-149 35.7311 37.0 37.0 37.0 37.0 37.0 150-151 35.530249999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 3.0 23 2.0 24 2.0 25 1.0 26 7.0 27 5.0 28 8.0 29 9.0 30 18.0 31 20.0 32 45.0 33 69.0 34 114.0 35 282.0 36 3083.0 37 330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.548774387193596 13.556778389194598 5.652826413206603 33.2416208104052 2 20.925 11.05 36.775000000000006 31.25 3 17.125 15.55 28.199999999999996 39.125 4 20.625 21.6 24.675 33.1 5 23.200000000000003 28.65 24.525 23.625 6 24.05 29.95 22.6 23.400000000000002 7 16.950000000000003 27.875 39.175 16.0 8 16.725 27.35 32.800000000000004 23.125 9 18.5 24.25 33.300000000000004 23.95 10-14 19.84 30.135 27.35 22.675 15-19 20.36 27.644999999999996 27.33 24.665 20-24 20.674999999999997 27.99 27.61 23.724999999999998 25-29 20.369999999999997 28.22 26.755000000000003 24.654999999999998 30-34 20.18 28.13 27.415 24.275 35-39 20.225 28.27 27.565 23.94 40-44 20.849999999999998 28.389999999999997 27.105 23.655 45-49 20.855 28.32 26.575 24.25 50-54 20.325 28.275 27.515 23.885 55-59 20.93 27.875 26.790000000000003 24.404999999999998 60-64 20.185 28.24 26.979999999999997 24.595 65-69 20.925 27.66 27.48 23.935000000000002 70-74 20.549999999999997 27.675 27.51 24.265 75-79 21.310000000000002 27.43 27.43 23.830000000000002 80-84 21.375 27.82 26.619999999999997 24.185000000000002 85-89 20.485 28.244999999999997 27.105 24.165 90-94 21.18 27.139999999999997 26.93 24.75 95-99 20.91 27.685 27.33 24.075 100-104 20.59 28.33 26.810000000000002 24.27 105-109 21.5 27.32 27.275 23.905 110-114 21.0 27.195000000000004 27.67 24.135 115-119 21.275 27.045 27.305 24.375 120-124 21.985 27.250000000000004 27.034999999999997 23.73 125-129 20.849999999999998 27.284999999999997 27.200000000000003 24.665 130-134 21.560000000000002 27.165 27.05 24.224999999999998 135-139 22.045 27.21 26.884999999999998 23.86 140-144 21.47 27.185 26.705000000000002 24.64 145-149 21.88 27.485 26.784999999999997 23.849999999999998 150-151 23.05 27.6625 25.2375 24.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 2.0 21 2.0 22 2.5 23 3.5 24 2.5 25 3.5 26 2.5 27 2.0 28 6.5 29 13.5 30 17.0 31 20.0 32 26.5 33 37.0 34 49.5 35 57.0 36 79.0 37 96.0 38 111.5 39 138.5 40 155.0 41 173.0 42 193.0 43 222.0 44 235.5 45 245.0 46 248.0 47 231.5 48 221.5 49 215.0 50 210.5 51 204.5 52 163.5 53 126.0 54 116.5 55 91.0 56 69.0 57 44.0 58 30.5 59 34.0 60 28.5 61 18.0 62 9.5 63 6.0 64 5.0 65 6.5 66 6.0 67 2.5 68 2.0 69 1.5 70 0.5 71 0.0 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.075 #Duplication Level Percentage of deduplicated Percentage of total 1 90.6744379683597 81.675 2 7.993338884263114 14.399999999999999 3 1.1101859561476548 3.0 4 0.11101859561476549 0.4 5 0.08326394671107411 0.375 6 0.02775464890369137 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGAGTTGAGCAAGCTTGTGGAGGATGTCAATGTGAGTTGTAATGATTTG 6 0.15 No Hit CCCAGATTAGCAAGCCAGTCTTACCCCCAGCATAGACATCGCCAGTTGGG 5 0.125 No Hit CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTGCAGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 14 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.5375 0.0 0.0 0.0 0.0 126-127 3.7750000000000004 0.0 0.0 0.0 0.0 128-129 4.15 0.0 0.0 0.0 0.0 130-131 4.375 0.0 0.0 0.0 0.0 132-133 4.825 0.0 0.0 0.0 0.0 134-135 5.0375 0.0 0.0 0.0 0.0 136-137 5.2875 0.0 0.0 0.0 0.0 138-139 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917538 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917538_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2595 37.0 37.0 37.0 37.0 37.0 2 36.0525 37.0 37.0 37.0 37.0 37.0 3 36.0815 37.0 37.0 37.0 37.0 37.0 4 36.1125 37.0 37.0 37.0 37.0 37.0 5 36.3595 37.0 37.0 37.0 37.0 37.0 6 36.1795 37.0 37.0 37.0 37.0 37.0 7 36.187 37.0 37.0 37.0 37.0 37.0 8 36.288 37.0 37.0 37.0 37.0 37.0 9 36.1985 37.0 37.0 37.0 37.0 37.0 10-14 36.1875 37.0 37.0 37.0 37.0 37.0 15-19 36.2395 37.0 37.0 37.0 37.0 37.0 20-24 36.1571 37.0 37.0 37.0 37.0 37.0 25-29 36.048199999999994 37.0 37.0 37.0 37.0 37.0 30-34 35.9864 37.0 37.0 37.0 37.0 37.0 35-39 35.988800000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.92100000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.8192 37.0 37.0 37.0 37.0 37.0 50-54 35.90079999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.9174 37.0 37.0 37.0 37.0 37.0 60-64 35.9152 37.0 37.0 37.0 37.0 37.0 65-69 35.8393 37.0 37.0 37.0 37.0 37.0 70-74 35.837199999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.7692 37.0 37.0 37.0 37.0 37.0 80-84 35.7984 37.0 37.0 37.0 37.0 37.0 85-89 35.7316 37.0 37.0 37.0 37.0 37.0 90-94 35.7447 37.0 37.0 37.0 37.0 37.0 95-99 35.7758 37.0 37.0 37.0 37.0 37.0 100-104 35.7522 37.0 37.0 37.0 37.0 37.0 105-109 35.656000000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.648 37.0 37.0 37.0 37.0 37.0 115-119 35.5825 37.0 37.0 37.0 37.0 37.0 120-124 35.51030000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.4809 37.0 37.0 37.0 37.0 37.0 130-134 35.422900000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.3572 37.0 37.0 37.0 37.0 37.0 140-144 35.1871 37.0 37.0 37.0 29.8 37.0 145-149 35.1543 37.0 37.0 37.0 27.4 37.0 150-151 34.747749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 2.0 15 3.0 16 6.0 17 2.0 18 2.0 19 1.0 20 4.0 21 4.0 22 3.0 23 1.0 24 6.0 25 7.0 26 6.0 27 7.0 28 9.0 29 20.0 30 25.0 31 41.0 32 57.0 33 121.0 34 211.0 35 697.0 36 2620.0 37 140.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.11955977988995 28.214107053526767 9.82991495747874 22.836418209104554 2 30.075000000000003 25.900000000000002 26.375 17.65 3 20.674999999999997 29.125 31.574999999999996 18.625 4 24.2 34.25 22.625 18.925 5 25.074999999999996 36.125 21.325 17.474999999999998 6 22.375 39.5 20.599999999999998 17.525 7 21.9 24.325 34.599999999999994 19.175 8 22.725 25.45 27.750000000000004 24.075 9 22.400000000000002 25.650000000000002 28.749999999999996 23.200000000000003 10-14 23.955000000000002 29.54 25.740000000000002 20.765 15-19 24.035 27.839999999999996 26.47 21.654999999999998 20-24 23.77 28.754999999999995 26.090000000000003 21.385 25-29 23.905 28.299999999999997 26.290000000000003 21.505 30-34 23.79 27.315 26.924999999999997 21.97 35-39 23.78 26.935 27.3 21.985 40-44 23.799999999999997 27.639999999999997 26.834999999999997 21.725 45-49 23.57 27.985 26.740000000000002 21.705 50-54 23.45 27.775 26.66 22.115000000000002 55-59 23.74 27.27 27.04 21.95 60-64 23.810000000000002 27.61 26.534999999999997 22.045 65-69 24.015 26.965 26.939999999999998 22.08 70-74 24.09 26.924999999999997 26.515 22.470000000000002 75-79 24.2 27.515 26.055 22.23 80-84 24.27 27.395000000000003 25.740000000000002 22.595000000000002 85-89 23.799999999999997 27.634999999999998 26.195 22.37 90-94 24.154999999999998 27.26 26.41 22.175 95-99 24.41 27.435 26.145000000000003 22.009999999999998 100-104 24.59 27.26 26.424999999999997 21.725 105-109 24.385 26.88 26.575 22.16 110-114 24.25 27.07 26.99 21.69 115-119 24.395 27.625 26.224999999999998 21.755 120-124 24.765 27.089999999999996 26.55 21.595 125-129 25.345000000000002 27.46 26.245 20.95 130-134 24.725 27.815 26.105 21.355 135-139 25.014999999999997 26.845000000000002 26.645000000000003 21.495 140-144 25.81 26.845000000000002 26.474999999999998 20.87 145-149 26.41 26.66 26.174999999999997 20.755000000000003 150-151 27.325 27.325 24.837500000000002 20.5125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 2.0 24 1.5 25 0.0 26 0.5 27 3.0 28 5.0 29 5.0 30 5.0 31 6.5 32 14.5 33 20.5 34 32.5 35 53.0 36 66.5 37 86.0 38 109.0 39 139.5 40 165.0 41 193.5 42 237.0 43 241.0 44 241.0 45 260.5 46 277.5 47 278.5 48 247.5 49 210.0 50 181.5 51 162.0 52 135.0 53 117.5 54 108.5 55 88.0 56 72.5 57 60.5 58 44.5 59 29.0 60 16.5 61 11.0 62 11.0 63 8.5 64 4.5 65 3.0 66 2.0 67 2.0 68 3.5 69 3.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 1.0 81 1.0 82 0.5 83 1.0 84 1.5 85 1.0 86 0.0 87 0.5 88 0.5 89 0.5 90 0.5 91 1.0 92 1.0 93 0.0 94 1.0 95 1.5 96 1.5 97 2.0 98 1.0 99 1.0 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.45 #Duplication Level Percentage of deduplicated Percentage of total 1 90.52543320290664 80.975 2 8.244829513694802 14.75 3 0.8943543879262158 2.4 4 0.11179429849077697 0.4 5 0.1397428731134712 0.625 6 0.027948574622694244 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05589714924538849 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 16 0.4 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 12 0.3 No Hit GATTTGGGTTCAGCAAAAAGATTGGTCAGGTTGCCATTGGTGGACCTGGT 6 0.15 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit GGAACTGGTGGTGGCATGAACCTCAGGGATGGGTTAGATGCATCTGGAAG 5 0.125 No Hit AGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCC 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.5375 0.0 0.0 0.0 0.0 126-127 3.7750000000000004 0.0 0.0 0.0 0.0 128-129 4.15 0.0 0.0 0.0 0.0 130-131 4.375 0.0 0.0 0.0 0.0 132-133 4.825 0.0 0.0 0.0 0.0 134-135 5.0375 0.0 0.0 0.0 0.0 136-137 5.2875 0.0 0.0 0.0 0.0 138-139 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTTC 10 0.006830828 145.0 5 AAAAAAA 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813132 spots for SRR12917538.sra Written 813132 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra Read 813119 spots for SRR12917538.sra Written 813119 spots for SRR12917538.sra SRR ids: ['SRR12917538.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fnpyzog7 SRR12917538.sra spots: 16262393 blocks: [[1, 813119], [813120, 1626238], [1626239, 2439357], [2439358, 3252476], [3252477, 4065595], [4065596, 4878714], [4878715, 5691833], [5691834, 6504952], [6504953, 7318071], [7318072, 8131190], [8131191, 8944309], [8944310, 9757428], [9757429, 10570547], [10570548, 11383666], [11383667, 12196785], [12196786, 13009904], [13009905, 13823023], [13823024, 14636142], [14636143, 15449261], [15449262, 16262393]] SRR12917538 file size 5504972 SRR12917538 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917538 SRR12917538_1.fastq SRR12917538_2.fastq Input file: SRR12917538_1.fastq Paired file: SRR12917538_2.fastq trimmed: SRR12917538-trimmed-pair1.fastq, SRR12917538-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:18:55 2025 >> started Thu Feb 13 13:19:14 2025 >> done (18.518s) 16262393 read pairs processed; of these: 78 ( 0.00%) short read pairs filtered out after trimming by size control 22993 ( 0.14%) empty read pairs filtered out after trimming by size control 16239322 (99.86%) read pairs available; of these: 1285676 ( 7.92%) trimmed read pairs available after processing 14953646 (92.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 10 0.00% 21 15 0.00% 22 14 0.00% 23 17 0.00% 24 21 0.00% 25 22 0.00% 26 41 0.00% 27 19 0.00% 28 33 0.00% 29 36 0.00% 30 29 0.00% 31 40 0.00% 32 45 0.00% 33 33 0.00% 34 43 0.00% 35 25 0.00% 36 32 0.00% 37 43 0.00% 38 48 0.00% 39 49 0.00% 40 40 0.00% 41 56 0.00% 42 39 0.00% 43 48 0.00% 44 47 0.00% 45 47 0.00% 46 67 0.00% 47 51 0.00% 48 61 0.00% 49 93 0.00% 50 83 0.00% 51 105 0.00% 52 121 0.00% 53 142 0.00% 54 141 0.00% 55 128 0.00% 56 127 0.00% 57 164 0.00% 58 219 0.00% 59 249 0.00% 60 271 0.00% 61 317 0.00% 62 316 0.00% 63 397 0.00% 64 436 0.00% 65 461 0.00% 66 462 0.00% 67 546 0.00% 68 637 0.00% 69 688 0.00% 70 848 0.01% 71 954 0.01% 72 1023 0.01% 73 1219 0.01% 74 1360 0.01% 75 1582 0.01% 76 1755 0.01% 77 1867 0.01% 78 1975 0.01% 79 2186 0.01% 80 2369 0.01% 81 2683 0.02% 82 3074 0.02% 83 3177 0.02% 84 3647 0.02% 85 3977 0.02% 86 4230 0.03% 87 4543 0.03% 88 4841 0.03% 89 4970 0.03% 90 5461 0.03% 91 5714 0.04% 92 5984 0.04% 93 6674 0.04% 94 7087 0.04% 95 7613 0.05% 96 8002 0.05% 97 8465 0.05% 98 8672 0.05% 99 9163 0.06% 100 9226 0.06% 101 9304 0.06% 102 9966 0.06% 103 10536 0.06% 104 11058 0.07% 105 11709 0.07% 106 12044 0.07% 107 12841 0.08% 108 12931 0.08% 109 13380 0.08% 110 13622 0.08% 111 13919 0.09% 112 14347 0.09% 113 14785 0.09% 114 15411 0.09% 115 16348 0.10% 116 16687 0.10% 117 17620 0.11% 118 18298 0.11% 119 18460 0.11% 120 19555 0.12% 121 19873 0.12% 122 19599 0.12% 123 20447 0.13% 124 21365 0.13% 125 21254 0.13% 126 23168 0.14% 127 23115 0.14% 128 23858 0.15% 129 24701 0.15% 130 24816 0.15% 131 25522 0.16% 132 26047 0.16% 133 26657 0.16% 134 27056 0.17% 135 28029 0.17% 136 29143 0.18% 137 29377 0.18% 138 30558 0.19% 139 31873 0.20% 140 31643 0.19% 141 32220 0.20% 142 32815 0.20% 143 33280 0.20% 144 34513 0.21% 145 34568 0.21% 146 35172 0.22% 147 35806 0.22% 148 37433 0.23% 149 37913 0.23% 150 39503 0.24% 151 14953646 92.08% 16239322 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=17 prefix-density=1.03 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=236.51 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCGGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.50 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=1.48 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACCGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.33 sequence-density-rank=25 fanout-score=16.00 fanout-score-rank=1 prefix-density=1.19 prefix-fanout=4.4 sequence=AATGGCAGCCTCAGT SRR12917538 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:19:55 Started mapping on | Feb 13 13:19:55 Finished on | Feb 13 13:21:26 Mapping speed, Million of reads per hour | 642.43 Number of input reads | 16239322 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15312730 Uniquely mapped reads % | 94.29% Average mapped length | 296.85 Number of splices: Total | 15113913 Number of splices: Annotated (sjdb) | 14863369 Number of splices: GT/AG | 14804381 Number of splices: GC/AG | 255177 Number of splices: AT/AC | 10988 Number of splices: Non-canonical | 43367 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 335620 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 121287 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.69% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 590972 590972 590972 N_multimapping 335620 335620 335620 N_noFeature 404283 15015111 475647 N_ambiguous 327840 944 101058 UnstrandedReadsAssigned:14580607 PositiveStrandReadsAssigned:296675 NegativeStrandReadsAssigned:14736025 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917538 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917538-trimmed-pair1.fastq SRR12917538-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,239,322 reads, 14,697,312 reads pseudoaligned [quant] estimated average fragment length: 269.084 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52401 SRR12917538.ke.tsv 34699 SRR12917538.se.tsv 87100 total ==> SRR12917538.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.92 303 7.61984 Potri.005G024800.1.v4.1 1035 766.916 281 16.1242 Potri.004G059700.1.v4.1 961 692.999 140 8.89029 Potri.007G009000.2.v4.1 1416 1147.92 0 0 Potri.003G141000.2.v4.1 2943 2674.92 581 9.55843 Potri.016G087400.1.v4.1 270 78.4544 961 539.047 Potri.015G069301.1.v4.1 564 309.486 0 0 Potri.010G195200.1.v4.1 1773 1504.92 18 0.526358 Potri.012G127500.1.v4.1 977 708.958 234 14.525 ==> SRR12917538.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 95 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR12917538 completed mapping pipeline successfully