Starting /dee2/code/volunteer_pipeline.sh SRR12917539 current disk space = 3091549319168 free memory = 1438465752 SRR12917539 SRAfilesize d73a730e6c63e819664af704c7c39444 SRR12917539.sra SRR12917539.sra file validated SRR12917539 is paired end SRR12917539 is conventional basespace SRR12917539 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917539_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5715 37.0 37.0 37.0 37.0 37.0 2 36.497 37.0 37.0 37.0 37.0 37.0 3 36.5815 37.0 37.0 37.0 37.0 37.0 4 36.677 37.0 37.0 37.0 37.0 37.0 5 36.6975 37.0 37.0 37.0 37.0 37.0 6 36.7715 37.0 37.0 37.0 37.0 37.0 7 36.6785 37.0 37.0 37.0 37.0 37.0 8 36.5855 37.0 37.0 37.0 37.0 37.0 9 36.666 37.0 37.0 37.0 37.0 37.0 10-14 36.65220000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.640499999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.636300000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.5604 37.0 37.0 37.0 37.0 37.0 30-34 36.5631 37.0 37.0 37.0 37.0 37.0 35-39 36.505199999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.5009 37.0 37.0 37.0 37.0 37.0 45-49 36.4713 37.0 37.0 37.0 37.0 37.0 50-54 36.467499999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.426899999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3727 37.0 37.0 37.0 37.0 37.0 65-69 36.3408 37.0 37.0 37.0 37.0 37.0 70-74 36.352999999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.3755 37.0 37.0 37.0 37.0 37.0 80-84 36.356700000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.3211 37.0 37.0 37.0 37.0 37.0 90-94 36.3386 37.0 37.0 37.0 37.0 37.0 95-99 36.2127 37.0 37.0 37.0 37.0 37.0 100-104 36.2089 37.0 37.0 37.0 37.0 37.0 105-109 36.158699999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.141299999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.093599999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.046099999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9477 37.0 37.0 37.0 37.0 37.0 130-134 35.8451 37.0 37.0 37.0 37.0 37.0 135-139 35.7949 37.0 37.0 37.0 37.0 37.0 140-144 35.6154 37.0 37.0 37.0 37.0 37.0 145-149 35.519600000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.29 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 1.0 23 1.0 24 0.0 25 4.0 26 5.0 27 3.0 28 5.0 29 16.0 30 17.0 31 31.0 32 47.0 33 71.0 34 113.0 35 327.0 36 3038.0 37 319.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.675 13.850000000000001 6.05 42.425000000000004 2 18.4 11.4 36.449999999999996 33.75 3 16.85 14.000000000000002 27.900000000000002 41.25 4 21.575 20.525 25.45 32.45 5 24.65 27.200000000000003 24.275 23.875 6 20.5 32.675 22.875 23.95 7 15.775 30.8 37.325 16.1 8 16.1 27.700000000000003 32.775 23.425 9 17.525 23.9 34.300000000000004 24.275 10-14 20.13 29.625 27.58 22.665 15-19 19.8 28.255000000000003 27.71 24.235 20-24 19.939999999999998 28.455000000000002 27.565 24.04 25-29 19.905 28.425 28.015 23.655 30-34 19.39 28.42 27.955000000000002 24.235 35-39 19.78 28.875 27.07 24.275 40-44 19.8 28.46 27.305 24.435000000000002 45-49 20.21 27.555000000000003 28.21 24.025 50-54 20.25 28.4 27.12 24.23 55-59 19.495 28.689999999999998 27.505000000000003 24.310000000000002 60-64 20.26 28.110000000000003 27.694999999999997 23.935000000000002 65-69 20.544999999999998 27.735 28.084999999999997 23.635 70-74 20.335 27.92 27.525 24.22 75-79 20.14 28.325 27.37 24.165 80-84 20.585 27.815 27.295 24.305 85-89 20.155 28.485 27.42 23.94 90-94 20.65 28.03 27.325 23.995 95-99 20.815 27.755000000000003 27.325 24.104999999999997 100-104 19.965 29.110000000000003 26.834999999999997 24.09 105-109 20.455000000000002 27.589999999999996 27.715 24.240000000000002 110-114 20.544999999999998 28.92 26.729999999999997 23.805 115-119 20.875 27.825 27.345000000000002 23.955000000000002 120-124 21.025 27.98 27.095000000000002 23.9 125-129 20.465 28.43 27.42 23.685000000000002 130-134 20.849999999999998 27.525 27.38 24.245 135-139 21.525 27.845 26.634999999999998 23.995 140-144 21.085 27.884999999999998 26.69 24.34 145-149 21.17 28.255000000000003 26.875 23.7 150-151 21.75 27.875 25.6 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.0 26 2.0 27 3.0 28 7.5 29 10.5 30 12.0 31 22.0 32 36.0 33 41.0 34 46.5 35 56.5 36 75.0 37 97.5 38 105.0 39 136.0 40 189.5 41 223.5 42 230.5 43 247.5 44 276.5 45 289.0 46 282.5 47 251.5 48 230.5 49 221.0 50 184.5 51 143.0 52 122.0 53 100.0 54 72.5 55 67.5 56 62.0 57 33.0 58 20.0 59 17.0 60 16.5 61 17.0 62 10.5 63 7.0 64 7.0 65 7.5 66 4.5 67 2.5 68 3.0 69 1.5 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.125 #Duplication Level Percentage of deduplicated Percentage of total 1 92.26594301221166 85.0 2 7.00135685210312 12.9 3 0.6784260515603799 1.875 4 0.027137042062415198 0.1 5 0.027137042062415198 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCCATTCGAAGGCACTGCAACTGTATTCCTCATTGGTGGATCAACAAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.7250000000000001 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.8875000000000002 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.2 0.0 0.0 0.0 0.0 110-111 2.525 0.0 0.0 0.0 0.0 112-113 2.9124999999999996 0.0 0.0 0.0 0.0 114-115 3.25 0.0 0.0 0.0 0.0 116-117 3.575 0.0 0.0 0.0 0.0 118-119 4.0 0.0 0.0 0.0 0.0 120-121 4.387499999999999 0.0 0.0 0.0 0.0 122-123 4.7 0.0 0.0 0.0 0.0 124-125 5.0 0.0 0.0 0.0 0.0 126-127 5.5375 0.0 0.0 0.0 0.0 128-129 6.0625 0.0 0.0 0.0 0.0 130-131 6.7375 0.0 0.0 0.0 0.0 132-133 7.1125 0.0 0.0 0.0 0.0 134-135 7.55 0.0 0.0 0.0 0.0 136-137 8.162500000000001 0.0 0.0 0.0 0.0 138-139 8.725000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGTT 10 0.006830828 145.0 3 CCAACGA 10 0.006830828 145.0 4 GATGTTG 10 0.006830828 145.0 4 GAACTCC 20 0.00593511 29.0 135-139 >>END_MODULE SRR12917539 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917539_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.549 37.0 37.0 37.0 37.0 37.0 2 36.3175 37.0 37.0 37.0 37.0 37.0 3 36.381 37.0 37.0 37.0 37.0 37.0 4 36.395 37.0 37.0 37.0 37.0 37.0 5 36.4895 37.0 37.0 37.0 37.0 37.0 6 36.4095 37.0 37.0 37.0 37.0 37.0 7 36.4975 37.0 37.0 37.0 37.0 37.0 8 36.4695 37.0 37.0 37.0 37.0 37.0 9 36.428 37.0 37.0 37.0 37.0 37.0 10-14 36.431 37.0 37.0 37.0 37.0 37.0 15-19 36.4103 37.0 37.0 37.0 37.0 37.0 20-24 36.37089999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.2597 37.0 37.0 37.0 37.0 37.0 30-34 36.2256 37.0 37.0 37.0 37.0 37.0 35-39 36.2019 37.0 37.0 37.0 37.0 37.0 40-44 36.183800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.1241 37.0 37.0 37.0 37.0 37.0 50-54 36.108000000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.1068 37.0 37.0 37.0 37.0 37.0 60-64 36.062799999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.095 37.0 37.0 37.0 37.0 37.0 70-74 36.029399999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.988099999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.0218 37.0 37.0 37.0 37.0 37.0 85-89 36.0099 37.0 37.0 37.0 37.0 37.0 90-94 35.9539 37.0 37.0 37.0 37.0 37.0 95-99 36.0165 37.0 37.0 37.0 37.0 37.0 100-104 35.9486 37.0 37.0 37.0 37.0 37.0 105-109 35.8782 37.0 37.0 37.0 37.0 37.0 110-114 35.8566 37.0 37.0 37.0 37.0 37.0 115-119 35.843599999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.7068 37.0 37.0 37.0 37.0 37.0 125-129 35.6472 37.0 37.0 37.0 37.0 37.0 130-134 35.6463 37.0 37.0 37.0 37.0 37.0 135-139 35.5864 37.0 37.0 37.0 37.0 37.0 140-144 35.4057 37.0 37.0 37.0 37.0 37.0 145-149 35.2564 37.0 37.0 37.0 29.8 37.0 150-151 34.6875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 5.0 15 1.0 16 2.0 17 1.0 18 4.0 19 1.0 20 5.0 21 5.0 22 2.0 23 2.0 24 2.0 25 2.0 26 6.0 27 6.0 28 8.0 29 16.0 30 19.0 31 34.0 32 45.0 33 100.0 34 149.0 35 532.0 36 2819.0 37 233.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.0 26.125 10.100000000000001 28.775000000000002 2 28.15 26.275 29.575000000000003 16.0 3 19.975 29.349999999999998 32.175 18.5 4 22.625 34.225 23.575 19.575 5 26.825 35.199999999999996 21.15 16.825000000000003 6 20.825 39.2 22.0 17.974999999999998 7 20.7 22.25 37.824999999999996 19.225 8 21.375 26.375 28.95 23.3 9 21.975 24.625 31.075000000000003 22.325 10-14 23.71 29.225 25.759999999999998 21.305 15-19 23.54 27.79 27.18 21.490000000000002 20-24 23.775 28.105000000000004 27.084999999999997 21.035 25-29 23.82 27.965 27.29 20.925 30-34 23.549999999999997 28.32 26.995 21.135 35-39 23.815 28.815 26.505000000000003 20.865000000000002 40-44 23.47 28.384999999999998 27.32 20.825 45-49 23.745 28.449999999999996 27.255000000000003 20.549999999999997 50-54 23.79 28.189999999999998 27.005000000000003 21.015 55-59 23.62 28.345 26.965 21.07 60-64 24.224999999999998 28.28 26.900000000000002 20.595 65-69 24.15 28.299999999999997 26.735 20.815 70-74 24.435000000000002 27.634999999999998 26.905 21.025 75-79 23.849999999999998 28.449999999999996 26.939999999999998 20.76 80-84 24.36 28.075 26.47 21.095 85-89 24.235 27.73 27.595 20.44 90-94 24.005000000000003 28.035 26.91 21.05 95-99 24.255 27.855 27.71 20.18 100-104 24.044999999999998 28.325 26.775 20.855 105-109 24.58 27.595 27.1 20.724999999999998 110-114 23.855 28.265 27.185 20.695 115-119 25.019999999999996 28.050000000000004 26.25 20.68 120-124 25.235000000000003 27.839999999999996 26.700000000000003 20.225 125-129 25.44 27.694999999999997 27.075 19.79 130-134 25.650000000000002 27.98 26.565 19.805 135-139 25.169999999999998 28.744999999999997 25.97 20.115 140-144 25.955000000000002 28.044999999999998 26.025 19.975 145-149 26.32 28.244999999999997 26.055 19.38 150-151 26.8125 26.950000000000003 26.924999999999997 19.3125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 1.5 20 1.5 21 0.5 22 0.5 23 1.5 24 2.5 25 2.0 26 1.5 27 3.5 28 5.0 29 6.0 30 8.0 31 11.0 32 19.0 33 26.5 34 37.0 35 46.0 36 65.0 37 93.0 38 126.5 39 154.0 40 190.0 41 237.5 42 277.0 43 294.5 44 272.5 45 283.5 46 290.5 47 257.0 48 237.0 49 210.5 50 173.0 51 144.0 52 108.5 53 80.0 54 66.0 55 48.0 56 42.5 57 38.5 58 31.0 59 24.5 60 13.5 61 9.0 62 7.5 63 7.5 64 5.5 65 3.5 66 2.0 67 1.5 68 1.5 69 1.0 70 2.0 71 3.5 72 2.5 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 1.0 90 2.0 91 1.5 92 0.0 93 0.5 94 0.5 95 0.5 96 1.5 97 1.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.05 #Duplication Level Percentage of deduplicated Percentage of total 1 92.36827810972298 85.02499999999999 2 6.7897881586094515 12.5 3 0.7604562737642585 2.1 4 0.05431830526887561 0.2 5 0.0 0.0 6 0.0 0.0 7 0.027159152634437803 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.3875000000000002 0.0 0.0 0.0 0.0 102-103 1.5750000000000002 0.0 0.0 0.0 0.0 104-105 1.8624999999999998 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.2750000000000004 0.0 0.0 0.0 0.0 116-117 3.625 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.4375 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.05 0.0 0.0 0.0 0.0 126-127 5.5875 0.0 0.0 0.0 0.0 128-129 6.112500000000001 0.0 0.0 0.0 0.0 130-131 6.7875 0.0 0.0 0.0 0.0 132-133 7.1375 0.0 0.0 0.0 0.0 134-135 7.5375 0.0 0.0 0.0 0.0 136-137 8.125 0.0 0.0 0.0 0.0 138-139 8.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGAGG 10 0.006830828 145.0 4 AGTGTAT 10 0.006830828 145.0 145 >>END_MODULE Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499973 spots for SRR12917539.sra Written 499973 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra Read 499959 spots for SRR12917539.sra Written 499959 spots for SRR12917539.sra SRR ids: ['SRR12917539.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t5x78opz SRR12917539.sra spots: 9999194 blocks: [[1, 499959], [499960, 999918], [999919, 1499877], [1499878, 1999836], [1999837, 2499795], [2499796, 2999754], [2999755, 3499713], [3499714, 3999672], [3999673, 4499631], [4499632, 4999590], [4999591, 5499549], [5499550, 5999508], [5999509, 6499467], [6499468, 6999426], [6999427, 7499385], [7499386, 7999344], [7999345, 8499303], [8499304, 8999262], [8999263, 9499221], [9499222, 9999194]] SRR12917539 file size 3376464 SRR12917539 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917539 SRR12917539_1.fastq SRR12917539_2.fastq Input file: SRR12917539_1.fastq Paired file: SRR12917539_2.fastq trimmed: SRR12917539-trimmed-pair1.fastq, SRR12917539-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:52:31 2025 >> started Thu Feb 13 12:52:41 2025 >> done (10.519s) 9999194 read pairs processed; of these: 44 ( 0.00%) short read pairs filtered out after trimming by size control 4270 ( 0.04%) empty read pairs filtered out after trimming by size control 9994880 (99.96%) read pairs available; of these: 1295183 (12.96%) trimmed read pairs available after processing 8699697 (87.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 5 0.00% 21 6 0.00% 22 3 0.00% 23 9 0.00% 24 7 0.00% 25 11 0.00% 26 10 0.00% 27 7 0.00% 28 6 0.00% 29 12 0.00% 30 15 0.00% 31 12 0.00% 32 13 0.00% 33 16 0.00% 34 19 0.00% 35 19 0.00% 36 21 0.00% 37 25 0.00% 38 18 0.00% 39 20 0.00% 40 15 0.00% 41 27 0.00% 42 26 0.00% 43 27 0.00% 44 26 0.00% 45 29 0.00% 46 41 0.00% 47 38 0.00% 48 44 0.00% 49 56 0.00% 50 63 0.00% 51 67 0.00% 52 98 0.00% 53 83 0.00% 54 83 0.00% 55 108 0.00% 56 116 0.00% 57 133 0.00% 58 160 0.00% 59 175 0.00% 60 209 0.00% 61 242 0.00% 62 322 0.00% 63 389 0.00% 64 395 0.00% 65 450 0.00% 66 502 0.01% 67 537 0.01% 68 706 0.01% 69 744 0.01% 70 829 0.01% 71 997 0.01% 72 1116 0.01% 73 1278 0.01% 74 1456 0.01% 75 1602 0.02% 76 1748 0.02% 77 1951 0.02% 78 2211 0.02% 79 2269 0.02% 80 2543 0.03% 81 2846 0.03% 82 3155 0.03% 83 3566 0.04% 84 3934 0.04% 85 4200 0.04% 86 4645 0.05% 87 4759 0.05% 88 4978 0.05% 89 5535 0.06% 90 5556 0.06% 91 5987 0.06% 92 6407 0.06% 93 6668 0.07% 94 7314 0.07% 95 7985 0.08% 96 8347 0.08% 97 8896 0.09% 98 9493 0.09% 99 9471 0.09% 100 9741 0.10% 101 10128 0.10% 102 10643 0.11% 103 10948 0.11% 104 11663 0.12% 105 12338 0.12% 106 13122 0.13% 107 13328 0.13% 108 14149 0.14% 109 14435 0.14% 110 14757 0.15% 111 15156 0.15% 112 15598 0.16% 113 15930 0.16% 114 16584 0.17% 115 17413 0.17% 116 17887 0.18% 117 18670 0.19% 118 19593 0.20% 119 19835 0.20% 120 20275 0.20% 121 20783 0.21% 122 21138 0.21% 123 21890 0.22% 124 22336 0.22% 125 22564 0.23% 126 23945 0.24% 127 23992 0.24% 128 24904 0.25% 129 25434 0.25% 130 26111 0.26% 131 26371 0.26% 132 26667 0.27% 133 27027 0.27% 134 27331 0.27% 135 27295 0.27% 136 28454 0.28% 137 29377 0.29% 138 29559 0.30% 139 30297 0.30% 140 30713 0.31% 141 31648 0.32% 142 32032 0.32% 143 31678 0.32% 144 32138 0.32% 145 32840 0.33% 146 33019 0.33% 147 33261 0.33% 148 33816 0.34% 149 34009 0.34% 150 34444 0.34% 151 8699697 87.04% 9994880 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=28 prefix-density=0.48 prefix-fanout=2.3 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=97.73 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=5.0 sequence=CAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACTTG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=37 prefix-density=0.46 prefix-fanout=2.1 sequence=CATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTACCTCTGATGTCAACGAAAGGGCTCTGCAAGACTCTGGACTCTATAGCCCTGACAGTGAAGACTCTTCTGTTGACATTGCGGGCAGAAGGTTCCATAGCGGGACACTAAACGGTTCTTCTATTGTATATGTCAAGACAGGGAGTCCTTCAGTAAATATGGCAACAACTTTGCAAATCCTTTTAGCTAGATTCAGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=279.37 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.0 sequence=AGAGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGG SRR12917539 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:53:24 Started mapping on | Feb 13 12:53:24 Finished on | Feb 13 12:54:45 Mapping speed, Million of reads per hour | 444.22 Number of input reads | 9994880 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 9271503 Uniquely mapped reads % | 92.76% Average mapped length | 294.29 Number of splices: Total | 8782148 Number of splices: Annotated (sjdb) | 8599578 Number of splices: GT/AG | 8616817 Number of splices: GC/AG | 128363 Number of splices: AT/AC | 9188 Number of splices: Non-canonical | 27780 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.19 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 296055 % of reads mapped to multiple loci | 2.96% Number of reads mapped to too many loci | 77534 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 427322 427322 427322 N_multimapping 296055 296055 296055 N_noFeature 199836 9177571 238103 N_ambiguous 109529 470 53597 UnstrandedReadsAssigned:8962138 PositiveStrandReadsAssigned:93462 NegativeStrandReadsAssigned:8979803 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917539 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917539-trimmed-pair1.fastq SRR12917539-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,994,880 reads, 9,033,033 reads pseudoaligned [quant] estimated average fragment length: 253.726 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 988 rounds 52401 SRR12917539.ke.tsv 34699 SRR12917539.se.tsv 87100 total ==> SRR12917539.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.27 373 20.6811 Potri.005G024800.1.v4.1 1035 782.274 146 18.2671 Potri.004G059700.1.v4.1 961 708.429 29 4.00662 Potri.007G009000.2.v4.1 1416 1163.27 0 0 Potri.003G141000.2.v4.1 2943 2690.27 415 15.0983 Potri.016G087400.1.v4.1 270 90.2081 1045.32 1134.18 Potri.015G069301.1.v4.1 564 326.966 0 0 Potri.010G195200.1.v4.1 1773 1520.27 40 2.57522 Potri.012G127500.1.v4.1 977 724.33 5153 696.306 ==> SRR12917539.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 59 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 164 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 140 SRR12917539 completed mapping pipeline successfully