Starting /dee2/code/volunteer_pipeline.sh SRR12917540 current disk space = 3091580755968 free memory = 1443231852 SRR12917540 SRAfilesize 4e09a12be28d2546fb84e254e1e5f18e SRR12917540.sra SRR12917540.sra file validated SRR12917540 is paired end SRR12917540 is conventional basespace SRR12917540 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917540_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.58775 37.0 37.0 37.0 37.0 37.0 2 36.5655 37.0 37.0 37.0 37.0 37.0 3 36.653 37.0 37.0 37.0 37.0 37.0 4 36.637 37.0 37.0 37.0 37.0 37.0 5 36.6675 37.0 37.0 37.0 37.0 37.0 6 36.6485 37.0 37.0 37.0 37.0 37.0 7 36.639 37.0 37.0 37.0 37.0 37.0 8 36.6155 37.0 37.0 37.0 37.0 37.0 9 36.652 37.0 37.0 37.0 37.0 37.0 10-14 36.624 37.0 37.0 37.0 37.0 37.0 15-19 36.630700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.589800000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5546 37.0 37.0 37.0 37.0 37.0 30-34 36.5193 37.0 37.0 37.0 37.0 37.0 35-39 36.5182 37.0 37.0 37.0 37.0 37.0 40-44 36.520300000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.433499999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.42960000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.448 37.0 37.0 37.0 37.0 37.0 60-64 36.335 37.0 37.0 37.0 37.0 37.0 65-69 36.3033 37.0 37.0 37.0 37.0 37.0 70-74 36.3626 37.0 37.0 37.0 37.0 37.0 75-79 36.3637 37.0 37.0 37.0 37.0 37.0 80-84 36.3806 37.0 37.0 37.0 37.0 37.0 85-89 36.2516 37.0 37.0 37.0 37.0 37.0 90-94 36.326499999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2802 37.0 37.0 37.0 37.0 37.0 100-104 36.1766 37.0 37.0 37.0 37.0 37.0 105-109 36.1559 37.0 37.0 37.0 37.0 37.0 110-114 36.146699999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.078 37.0 37.0 37.0 37.0 37.0 120-124 36.1006 37.0 37.0 37.0 37.0 37.0 125-129 35.940099999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.863299999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.745799999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.564499999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.4886 37.0 37.0 37.0 37.0 37.0 150-151 35.21625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 2.0 26 9.0 27 3.0 28 13.0 29 13.0 30 23.0 31 39.0 32 51.0 33 64.0 34 109.0 35 316.0 36 3027.0 37 328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.499374217772214 14.543178973717147 7.108886107634543 38.84856070087609 2 20.875 11.975 35.8 31.35 3 17.599999999999998 16.175 26.700000000000003 39.525 4 20.5 23.45 24.3 31.75 5 21.475 30.275000000000002 25.825 22.425 6 20.9 33.025 22.6 23.474999999999998 7 14.399999999999999 30.225 38.75 16.625 8 15.975 28.749999999999996 32.45 22.825 9 18.775 24.95 33.85 22.425 10-14 19.040000000000003 30.45 27.794999999999998 22.715 15-19 19.0 29.035 27.765 24.2 20-24 19.34 28.835 27.68 24.145 25-29 19.650000000000002 28.735 27.815 23.799999999999997 30-34 19.53 28.98 27.825 23.665 35-39 19.564999999999998 29.409999999999997 27.3 23.724999999999998 40-44 20.169999999999998 28.955 26.91 23.965 45-49 19.205 28.84 27.589999999999996 24.365000000000002 50-54 20.145 28.4 27.589999999999996 23.865 55-59 19.595000000000002 28.955 27.615000000000002 23.835 60-64 19.85 28.605000000000004 27.395000000000003 24.15 65-69 19.925 28.84 27.35 23.885 70-74 19.55 28.615000000000002 27.49 24.345 75-79 19.86 28.744999999999997 27.6 23.794999999999998 80-84 19.545 28.84 27.634999999999998 23.98 85-89 20.07 28.68 27.495000000000005 23.755000000000003 90-94 20.23 28.645 26.755000000000003 24.37 95-99 19.955000000000002 28.065 28.435 23.544999999999998 100-104 20.21 28.535 27.694999999999997 23.56 105-109 19.900000000000002 28.384999999999998 27.439999999999998 24.275 110-114 20.615 28.175 27.235 23.974999999999998 115-119 20.41 28.515 27.41 23.665 120-124 20.68 28.634999999999998 27.134999999999998 23.549999999999997 125-129 20.365 28.310000000000002 27.115000000000002 24.21 130-134 21.055 27.975 26.99 23.98 135-139 20.549999999999997 28.544999999999998 27.115000000000002 23.79 140-144 20.895 28.165000000000003 26.35 24.59 145-149 21.105 27.584999999999997 26.640000000000004 24.67 150-151 21.1375 27.537499999999998 26.650000000000002 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 2.0 22 3.0 23 2.0 24 1.0 25 1.5 26 3.0 27 4.5 28 8.0 29 10.5 30 19.0 31 30.5 32 33.5 33 40.0 34 64.5 35 77.0 36 92.0 37 120.0 38 141.0 39 150.0 40 177.5 41 220.5 42 247.0 43 257.0 44 255.5 45 261.5 46 255.0 47 251.0 48 250.5 49 221.0 50 177.5 51 136.0 52 110.0 53 90.5 54 62.5 55 48.5 56 43.0 57 34.0 58 24.5 59 20.5 60 14.5 61 6.5 62 5.5 63 7.0 64 4.5 65 2.5 66 2.5 67 1.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.42671009771986 85.125 2 6.758957654723127 12.45 3 0.6514657980456027 1.7999999999999998 4 0.13572204125950055 0.5 5 0.02714440825190011 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCACTTTTCTCCCCAGGAGTTCTTGATGATCCAGAATGGCTTTTCCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.8374999999999999 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.1125 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.2874999999999996 0.0 0.0 0.0 0.0 108-109 2.5250000000000004 0.0 0.0 0.0 0.0 110-111 2.7125000000000004 0.0 0.0 0.0 0.0 112-113 2.9875 0.0 0.0 0.0 0.0 114-115 3.4 0.0 0.0 0.0 0.0 116-117 3.7875 0.0 0.0 0.0 0.0 118-119 4.225 0.0 0.0 0.0 0.0 120-121 4.65 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.4375 0.0 0.0 0.0 0.0 126-127 5.949999999999999 0.0 0.0 0.0 0.0 128-129 6.425000000000001 0.0 0.0 0.0 0.0 130-131 6.949999999999999 0.0 0.0 0.0 0.0 132-133 7.5 0.0 0.0 0.0 0.0 134-135 8.2 0.0 0.0 0.0 0.0 136-137 8.7125 0.0 0.0 0.0 0.0 138-139 9.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917540 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917540_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.406 37.0 37.0 37.0 37.0 37.0 2 36.3 37.0 37.0 37.0 37.0 37.0 3 36.2975 37.0 37.0 37.0 37.0 37.0 4 36.3895 37.0 37.0 37.0 37.0 37.0 5 36.4345 37.0 37.0 37.0 37.0 37.0 6 36.3035 37.0 37.0 37.0 37.0 37.0 7 36.468 37.0 37.0 37.0 37.0 37.0 8 36.417 37.0 37.0 37.0 37.0 37.0 9 36.53 37.0 37.0 37.0 37.0 37.0 10-14 36.4366 37.0 37.0 37.0 37.0 37.0 15-19 36.4165 37.0 37.0 37.0 37.0 37.0 20-24 36.4207 37.0 37.0 37.0 37.0 37.0 25-29 36.268600000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.263400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.240300000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.24210000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.1821 37.0 37.0 37.0 37.0 37.0 50-54 36.145900000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.174 37.0 37.0 37.0 37.0 37.0 60-64 36.1532 37.0 37.0 37.0 37.0 37.0 65-69 36.1043 37.0 37.0 37.0 37.0 37.0 70-74 36.0976 37.0 37.0 37.0 37.0 37.0 75-79 36.0284 37.0 37.0 37.0 37.0 37.0 80-84 36.0257 37.0 37.0 37.0 37.0 37.0 85-89 36.0341 37.0 37.0 37.0 37.0 37.0 90-94 35.9781 37.0 37.0 37.0 37.0 37.0 95-99 35.9815 37.0 37.0 37.0 37.0 37.0 100-104 35.9464 37.0 37.0 37.0 37.0 37.0 105-109 35.908500000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.8332 37.0 37.0 37.0 37.0 37.0 115-119 35.7836 37.0 37.0 37.0 37.0 37.0 120-124 35.7341 37.0 37.0 37.0 37.0 37.0 125-129 35.6441 37.0 37.0 37.0 37.0 37.0 130-134 35.574799999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5712 37.0 37.0 37.0 37.0 37.0 140-144 35.321799999999996 37.0 37.0 37.0 34.6 37.0 145-149 35.1743 37.0 37.0 37.0 29.8 37.0 150-151 34.7355 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 0.0 16 2.0 17 1.0 18 2.0 19 2.0 20 0.0 21 3.0 22 1.0 23 4.0 24 4.0 25 7.0 26 3.0 27 10.0 28 6.0 29 16.0 30 18.0 31 34.0 32 50.0 33 80.0 34 173.0 35 551.0 36 2808.0 37 219.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.04352176088044 24.58729364682341 10.98049024512256 27.388694347173587 2 28.225 25.825 29.925 16.025 3 20.349999999999998 27.725 33.425 18.5 4 23.175 32.775 24.8 19.25 5 26.325 36.525 21.349999999999998 15.8 6 21.85 39.35 22.325 16.475 7 21.55 24.825 35.4 18.224999999999998 8 21.65 25.900000000000002 28.675 23.775 9 21.425 25.35 30.049999999999997 23.175 10-14 24.09 29.45 25.575 20.885 15-19 23.915 28.294999999999998 27.48 20.31 20-24 24.125 28.599999999999998 27.334999999999997 19.939999999999998 25-29 23.674999999999997 28.735 26.86 20.73 30-34 23.325000000000003 28.46 27.455000000000002 20.76 35-39 23.895 28.694999999999997 26.919999999999998 20.49 40-44 24.455 27.79 27.700000000000003 20.055 45-49 23.405 28.255000000000003 27.595 20.745 50-54 24.015 28.449999999999996 27.16 20.375 55-59 23.91 27.894999999999996 27.794999999999998 20.4 60-64 23.505000000000003 28.02 27.834999999999997 20.64 65-69 24.12 27.650000000000002 28.01 20.22 70-74 24.01 27.46 27.985 20.544999999999998 75-79 23.805 27.91 27.685 20.599999999999998 80-84 23.875 28.449999999999996 26.97 20.705000000000002 85-89 23.425 28.315 27.395000000000003 20.865000000000002 90-94 23.724999999999998 28.139999999999997 27.625 20.51 95-99 24.235 27.634999999999998 27.750000000000004 20.380000000000003 100-104 24.884999999999998 27.785 27.38 19.950000000000003 105-109 23.935000000000002 28.33 27.365000000000002 20.369999999999997 110-114 24.5 28.625 26.700000000000003 20.175 115-119 25.230000000000004 27.950000000000003 27.034999999999997 19.785 120-124 25.385 28.265 26.939999999999998 19.41 125-129 25.595000000000002 28.515 26.384999999999998 19.505 130-134 26.25 28.33 26.43 18.990000000000002 135-139 25.83 28.060000000000002 26.83 19.28 140-144 26.395000000000003 28.694999999999997 25.985000000000003 18.925 145-149 27.525 27.55 25.935000000000002 18.990000000000002 150-151 27.500000000000004 28.375 25.0125 19.112499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 2.0 17 1.5 18 1.0 19 1.0 20 1.5 21 0.5 22 0.5 23 1.5 24 3.5 25 4.0 26 3.5 27 3.5 28 2.5 29 5.0 30 10.5 31 17.0 32 23.5 33 36.5 34 44.5 35 59.5 36 77.5 37 92.0 38 130.5 39 168.0 40 203.5 41 246.0 42 267.5 43 263.5 44 267.0 45 264.0 46 266.5 47 264.5 48 233.5 49 204.0 50 180.5 51 157.5 52 115.5 53 83.0 54 74.5 55 56.0 56 33.5 57 25.0 58 21.5 59 15.0 60 15.0 61 10.5 62 4.0 63 5.5 64 6.0 65 4.5 66 1.0 67 1.5 68 1.5 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 1.5 83 1.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.125 #Duplication Level Percentage of deduplicated Percentage of total 1 92.48303934871099 85.2 2 6.675712347354139 12.3 3 0.6784260515603799 1.875 4 0.13568521031207598 0.5 5 0.027137042062415198 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGCAAATTTGACAAGAACAAGGTTGCAGCAAGAGTGGCCAACTTTAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.0499999999999998 0.0 0.0 0.0 0.0 96-97 1.2374999999999998 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.6875 0.0 0.0 0.0 0.0 112-113 2.9625000000000004 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 3.7625 0.0 0.0 0.0 0.0 118-119 4.225 0.0 0.0 0.0 0.0 120-121 4.65 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.4625 0.0 0.0 0.0 0.0 126-127 5.9875 0.0 0.0 0.0 0.0 128-129 6.475 0.0 0.0 0.0 0.0 130-131 7.050000000000001 0.0 0.0 0.0 0.0 132-133 7.5875 0.0 0.0 0.0 0.0 134-135 8.25 0.0 0.0 0.0 0.0 136-137 8.7625 0.0 0.0 0.0 0.0 138-139 9.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTCAA 10 0.006830828 145.0 5 GGGGGGG 100 4.4201443E-10 29.0 145 >>END_MODULE Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra Read 830954 spots for SRR12917540.sra Written 830954 spots for SRR12917540.sra Read 830947 spots for SRR12917540.sra Written 830947 spots for SRR12917540.sra SRR ids: ['SRR12917540.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xpmiroy0 SRR12917540.sra spots: 16618947 blocks: [[1, 830947], [830948, 1661894], [1661895, 2492841], [2492842, 3323788], [3323789, 4154735], [4154736, 4985682], [4985683, 5816629], [5816630, 6647576], [6647577, 7478523], [7478524, 8309470], [8309471, 9140417], [9140418, 9971364], [9971365, 10802311], [10802312, 11633258], [11633259, 12464205], [12464206, 13295152], [13295153, 14126099], [14126100, 14957046], [14957047, 15787993], [15787994, 16618947]] SRR12917540 file size 5626144 SRR12917540 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917540 SRR12917540_1.fastq SRR12917540_2.fastq Input file: SRR12917540_1.fastq Paired file: SRR12917540_2.fastq trimmed: SRR12917540-trimmed-pair1.fastq, SRR12917540-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:51:57 2025 >> started Thu Feb 13 12:52:15 2025 >> done (17.898s) 16618947 read pairs processed; of these: 41 ( 0.00%) short read pairs filtered out after trimming by size control 11371 ( 0.07%) empty read pairs filtered out after trimming by size control 16607535 (99.93%) read pairs available; of these: 2409349 (14.51%) trimmed read pairs available after processing 14198186 (85.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 1 0.00% 21 6 0.00% 22 8 0.00% 23 8 0.00% 24 6 0.00% 25 7 0.00% 26 12 0.00% 27 14 0.00% 28 13 0.00% 29 16 0.00% 30 11 0.00% 31 19 0.00% 32 25 0.00% 33 20 0.00% 34 16 0.00% 35 22 0.00% 36 20 0.00% 37 29 0.00% 38 28 0.00% 39 34 0.00% 40 23 0.00% 41 36 0.00% 42 38 0.00% 43 31 0.00% 44 44 0.00% 45 50 0.00% 46 48 0.00% 47 56 0.00% 48 68 0.00% 49 138 0.00% 50 106 0.00% 51 145 0.00% 52 160 0.00% 53 180 0.00% 54 224 0.00% 55 221 0.00% 56 223 0.00% 57 316 0.00% 58 333 0.00% 59 415 0.00% 60 466 0.00% 61 597 0.00% 62 680 0.00% 63 754 0.00% 64 864 0.01% 65 1000 0.01% 66 1065 0.01% 67 1228 0.01% 68 1436 0.01% 69 1607 0.01% 70 1921 0.01% 71 2099 0.01% 72 2550 0.02% 73 2775 0.02% 74 3169 0.02% 75 3528 0.02% 76 3992 0.02% 77 4111 0.02% 78 4415 0.03% 79 4764 0.03% 80 5310 0.03% 81 5955 0.04% 82 6518 0.04% 83 7227 0.04% 84 8137 0.05% 85 8575 0.05% 86 9016 0.05% 87 9556 0.06% 88 9789 0.06% 89 10432 0.06% 90 10748 0.06% 91 11355 0.07% 92 12107 0.07% 93 13191 0.08% 94 14483 0.09% 95 15442 0.09% 96 16265 0.10% 97 16736 0.10% 98 16981 0.10% 99 17474 0.11% 100 17960 0.11% 101 18523 0.11% 102 19326 0.12% 103 20601 0.12% 104 21684 0.13% 105 23042 0.14% 106 24254 0.15% 107 25369 0.15% 108 26011 0.16% 109 26735 0.16% 110 26474 0.16% 111 27775 0.17% 112 28353 0.17% 113 29188 0.18% 114 30677 0.18% 115 31596 0.19% 116 33237 0.20% 117 34671 0.21% 118 36030 0.22% 119 36654 0.22% 120 37519 0.23% 121 37563 0.23% 122 38626 0.23% 123 39334 0.24% 124 40661 0.24% 125 41626 0.25% 126 43767 0.26% 127 45085 0.27% 128 46390 0.28% 129 47678 0.29% 130 47909 0.29% 131 48166 0.29% 132 48953 0.29% 133 49994 0.30% 134 49826 0.30% 135 51407 0.31% 136 52765 0.32% 137 54118 0.33% 138 55638 0.34% 139 56610 0.34% 140 57109 0.34% 141 58054 0.35% 142 58678 0.35% 143 58707 0.35% 144 59763 0.36% 145 60096 0.36% 146 61058 0.37% 147 61739 0.37% 148 62718 0.38% 149 63383 0.38% 150 64756 0.39% 151 14198186 85.49% 16607535 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.76 fanout-score-rank=18 prefix-density=0.33 prefix-fanout=3.4 sequence=TCTCATCACTCACAAGCAAGTCGTGGCGTAGGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=89.20 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=14.1 sequence=TCCTTCTTCTCAACACTCTTAATGACACCAACCGCCACGGTCTGACGCATGTCCCTCACTGCAAAACGACCAAGAGGAGGATAGGCAGAAAAGGTCTCAACAACCATAGGCTTGGTGGGAATCATCTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.96 fanout-score-rank=14 prefix-density=0.29 prefix-fanout=3.1 sequence=AAGTTTTCTGGCTTCCCATCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=71.69 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=4.8 sequence=CTCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTT SRR12917540 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:53:05 Started mapping on | Feb 13 12:53:06 Finished on | Feb 13 12:55:33 Mapping speed, Million of reads per hour | 406.72 Number of input reads | 16607535 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15342612 Uniquely mapped reads % | 92.38% Average mapped length | 293.43 Number of splices: Total | 14436685 Number of splices: Annotated (sjdb) | 14167573 Number of splices: GT/AG | 14182918 Number of splices: GC/AG | 195950 Number of splices: AT/AC | 15104 Number of splices: Non-canonical | 42713 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 419135 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 56248 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.63% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 845788 845788 845788 N_multimapping 419135 419135 419135 N_noFeature 370542 15137650 453430 N_ambiguous 201181 1035 78516 UnstrandedReadsAssigned:14770889 PositiveStrandReadsAssigned:203927 NegativeStrandReadsAssigned:14810666 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917540 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917540-trimmed-pair1.fastq SRR12917540-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,607,535 reads, 14,852,030 reads pseudoaligned [quant] estimated average fragment length: 238.575 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR12917540.ke.tsv 34699 SRR12917540.se.tsv 87100 total ==> SRR12917540.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.42 453 14.9862 Potri.005G024800.1.v4.1 1035 797.425 432 31.9089 Potri.004G059700.1.v4.1 961 723.521 110 8.95488 Potri.007G009000.2.v4.1 1416 1178.42 0 0 Potri.003G141000.2.v4.1 2943 2705.42 548 11.9306 Potri.016G087400.1.v4.1 270 91.6117 1674 1076.27 Potri.015G069301.1.v4.1 564 337.531 0 0 Potri.010G195200.1.v4.1 1773 1535.42 140 5.37053 Potri.012G127500.1.v4.1 977 739.437 6951 553.686 ==> SRR12917540.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 294 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 15 SRR12917540 completed mapping pipeline successfully