Starting /dee2/code/volunteer_pipeline.sh SRR12917541 current disk space = 3091834851328 free memory = 1383553336 SRR12917541 SRAfilesize 2a2a213e5a283598bcda5723aebb5dfa SRR12917541.sra SRR12917541.sra file validated SRR12917541 is paired end SRR12917541 is conventional basespace SRR12917541 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917541_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.556 37.0 37.0 37.0 37.0 37.0 2 36.4175 37.0 37.0 37.0 37.0 37.0 3 36.589 37.0 37.0 37.0 37.0 37.0 4 36.655 37.0 37.0 37.0 37.0 37.0 5 36.7215 37.0 37.0 37.0 37.0 37.0 6 36.67 37.0 37.0 37.0 37.0 37.0 7 36.553 37.0 37.0 37.0 37.0 37.0 8 36.566 37.0 37.0 37.0 37.0 37.0 9 36.614 37.0 37.0 37.0 37.0 37.0 10-14 36.59929999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5861 37.0 37.0 37.0 37.0 37.0 20-24 36.5832 37.0 37.0 37.0 37.0 37.0 25-29 36.532300000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.454899999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.41330000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.469500000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3851 37.0 37.0 37.0 37.0 37.0 50-54 36.4156 37.0 37.0 37.0 37.0 37.0 55-59 36.3292 37.0 37.0 37.0 37.0 37.0 60-64 36.30800000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2829 37.0 37.0 37.0 37.0 37.0 70-74 36.285799999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.2661 37.0 37.0 37.0 37.0 37.0 80-84 36.309999999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2929 37.0 37.0 37.0 37.0 37.0 90-94 36.24829999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.1954 37.0 37.0 37.0 37.0 37.0 100-104 36.108799999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.1303 37.0 37.0 37.0 37.0 37.0 110-114 36.0385 37.0 37.0 37.0 37.0 37.0 115-119 35.968199999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.9748 37.0 37.0 37.0 37.0 37.0 125-129 35.8366 37.0 37.0 37.0 37.0 37.0 130-134 35.8769 37.0 37.0 37.0 37.0 37.0 135-139 35.8184 37.0 37.0 37.0 37.0 37.0 140-144 35.6169 37.0 37.0 37.0 37.0 37.0 145-149 35.647 37.0 37.0 37.0 37.0 37.0 150-151 35.378 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 2.0 23 2.0 24 1.0 25 3.0 26 3.0 27 4.0 28 13.0 29 22.0 30 22.0 31 30.0 32 49.0 33 67.0 34 122.0 35 335.0 36 3008.0 37 314.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.65 14.05 5.375 38.925 2 18.825 10.525 38.275 32.375 3 16.150000000000002 15.0 28.299999999999997 40.550000000000004 4 21.5 21.25 24.375 32.875 5 23.150000000000002 27.125 25.650000000000002 24.075 6 20.674999999999997 30.7 24.375 24.25 7 15.325 27.900000000000002 40.475 16.3 8 16.950000000000003 26.400000000000002 32.9 23.75 9 15.85 24.075 35.9 24.175 10-14 19.645000000000003 29.544999999999998 28.105000000000004 22.705000000000002 15-19 19.8 27.445000000000004 27.994999999999997 24.759999999999998 20-24 19.075 28.005000000000003 28.68 24.240000000000002 25-29 19.365 28.28 27.92 24.435000000000002 30-34 19.66 27.894999999999996 27.82 24.625 35-39 19.765 27.529999999999998 27.43 25.275 40-44 19.869999999999997 27.639999999999997 27.544999999999998 24.945 45-49 20.07 28.095 27.505000000000003 24.33 50-54 20.365 27.575 27.845 24.215 55-59 19.634999999999998 28.16 27.665 24.54 60-64 20.11 27.800000000000004 27.715 24.375 65-69 20.23 28.065 27.485 24.22 70-74 19.755 27.950000000000003 27.575 24.72 75-79 19.865 27.445000000000004 27.955000000000002 24.735 80-84 20.34 27.794999999999998 27.034999999999997 24.83 85-89 20.53 27.589999999999996 26.974999999999998 24.905 90-94 20.27 27.985 26.99 24.755 95-99 20.51 27.279999999999998 27.625 24.585 100-104 20.285 27.815 27.38 24.52 105-109 20.575 27.485 27.450000000000003 24.490000000000002 110-114 21.125 27.694999999999997 27.250000000000004 23.93 115-119 20.794999999999998 26.575 27.755000000000003 24.875 120-124 20.990000000000002 27.875 26.645000000000003 24.490000000000002 125-129 20.73 27.134999999999998 27.925 24.21 130-134 21.060000000000002 26.945000000000004 27.884999999999998 24.11 135-139 21.095 27.834999999999997 26.674999999999997 24.395 140-144 21.02 26.895000000000003 27.395000000000003 24.69 145-149 20.84 27.310000000000002 27.384999999999998 24.465 150-151 20.8125 27.1375 27.400000000000002 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.5 24 1.0 25 1.5 26 3.0 27 5.0 28 6.0 29 7.5 30 12.5 31 17.0 32 24.5 33 31.5 34 37.0 35 55.5 36 74.0 37 81.0 38 99.5 39 133.0 40 160.0 41 198.5 42 244.0 43 262.0 44 271.5 45 280.0 46 282.5 47 278.5 48 257.5 49 224.5 50 186.5 51 149.0 52 121.5 53 114.5 54 100.0 55 62.0 56 44.0 57 42.5 58 30.0 59 19.5 60 19.0 61 14.5 62 6.5 63 6.5 64 7.0 65 5.0 66 3.0 67 1.5 68 1.5 69 1.5 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.95 #Duplication Level Percentage of deduplicated Percentage of total 1 90.27237354085604 81.2 2 8.67148415786548 15.6 3 0.8337965536409117 2.25 4 0.13896609227348528 0.5 5 0.055586436909394105 0.25 6 0.0 0.0 7 0.0 0.0 8 0.027793218454697052 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCTCAGGCAATCTGAACCTCCTCAAGAACTTACCACTCGATCTCTCAAC 8 0.2 No Hit GTCCCCAACAAGTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATAC 5 0.125 No Hit CCTCACATTCGTACTCCCCATTTCAATAGCTTGCTCAAAGTCATTAGACA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9249999999999998 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.525 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 2.9875 0.0 0.0 0.0 0.0 126-127 3.3375 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 4.125 0.0 0.0 0.0 0.0 132-133 4.525 0.0 0.0 0.0 0.0 134-135 4.8625 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTAGCA 10 0.006830828 145.0 7 TCTGACC 10 0.006830828 145.0 7 TTAGCAT 10 0.006830828 145.0 8 >>END_MODULE SRR12917541 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917541_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.303 37.0 37.0 37.0 37.0 37.0 2 36.303 37.0 37.0 37.0 37.0 37.0 3 36.2715 37.0 37.0 37.0 37.0 37.0 4 36.3125 37.0 37.0 37.0 37.0 37.0 5 36.4055 37.0 37.0 37.0 37.0 37.0 6 36.226 37.0 37.0 37.0 37.0 37.0 7 36.306 37.0 37.0 37.0 37.0 37.0 8 36.3745 37.0 37.0 37.0 37.0 37.0 9 36.355 37.0 37.0 37.0 37.0 37.0 10-14 36.3089 37.0 37.0 37.0 37.0 37.0 15-19 36.2915 37.0 37.0 37.0 37.0 37.0 20-24 36.20739999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.1623 37.0 37.0 37.0 37.0 37.0 30-34 36.074 37.0 37.0 37.0 37.0 37.0 35-39 36.0537 37.0 37.0 37.0 37.0 37.0 40-44 36.0667 37.0 37.0 37.0 37.0 37.0 45-49 36.0251 37.0 37.0 37.0 37.0 37.0 50-54 35.9433 37.0 37.0 37.0 37.0 37.0 55-59 35.9262 37.0 37.0 37.0 37.0 37.0 60-64 35.914 37.0 37.0 37.0 37.0 37.0 65-69 35.8866 37.0 37.0 37.0 37.0 37.0 70-74 35.9079 37.0 37.0 37.0 37.0 37.0 75-79 35.736599999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.884299999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.8606 37.0 37.0 37.0 37.0 37.0 90-94 35.854200000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.7925 37.0 37.0 37.0 37.0 37.0 100-104 35.7716 37.0 37.0 37.0 37.0 37.0 105-109 35.7311 37.0 37.0 37.0 37.0 37.0 110-114 35.6725 37.0 37.0 37.0 37.0 37.0 115-119 35.6381 37.0 37.0 37.0 37.0 37.0 120-124 35.5024 37.0 37.0 37.0 34.6 37.0 125-129 35.51180000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.4141 37.0 37.0 37.0 37.0 37.0 135-139 35.3091 37.0 37.0 37.0 32.2 37.0 140-144 35.146300000000004 37.0 37.0 37.0 27.4 37.0 145-149 35.030699999999996 37.0 37.0 37.0 27.4 37.0 150-151 34.54975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 5.0 15 4.0 16 2.0 17 0.0 18 0.0 19 0.0 20 2.0 21 4.0 22 2.0 23 5.0 24 4.0 25 4.0 26 6.0 27 13.0 28 14.0 29 19.0 30 39.0 31 40.0 32 62.0 33 119.0 34 184.0 35 632.0 36 2656.0 37 181.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.7 27.125 9.1 25.074999999999996 2 28.349999999999998 26.5 29.45 15.7 3 19.525000000000002 28.000000000000004 33.324999999999996 19.15 4 23.125 32.275 24.6 20.0 5 25.525 36.95 19.475 18.05 6 20.575 40.150000000000006 21.8 17.474999999999998 7 21.075 24.5 35.225 19.2 8 20.8 26.575 27.224999999999998 25.4 9 22.675 25.374999999999996 27.900000000000002 24.05 10-14 23.189999999999998 29.985 26.029999999999998 20.794999999999998 15-19 23.365 28.749999999999996 26.755000000000003 21.13 20-24 23.49 28.68 27.325 20.505000000000003 25-29 23.345 27.965 27.33 21.36 30-34 23.244999999999997 28.4 27.05 21.305 35-39 23.11 27.765 27.32 21.805 40-44 23.474999999999998 28.42 27.01 21.095 45-49 24.404999999999998 27.634999999999998 27.224999999999998 20.735 50-54 23.53 28.63 26.88 20.96 55-59 24.05 27.455000000000002 27.575 20.919999999999998 60-64 23.810000000000002 27.73 27.750000000000004 20.71 65-69 23.915 28.18 26.75 21.154999999999998 70-74 24.845 27.450000000000003 26.66 21.044999999999998 75-79 24.38 28.025 27.205000000000002 20.39 80-84 24.46 28.4 26.32 20.82 85-89 23.849999999999998 27.029999999999998 28.1 21.02 90-94 24.52 27.625 26.655 21.2 95-99 24.025 28.715000000000003 26.705000000000002 20.555 100-104 23.89 27.49 26.865 21.755 105-109 24.325 28.050000000000004 27.275 20.349999999999998 110-114 25.185000000000002 27.855 26.435 20.525 115-119 25.130000000000003 28.4 26.884999999999998 19.585 120-124 25.115 27.41 27.32 20.155 125-129 24.895 27.905 26.465 20.735 130-134 25.71 27.889999999999997 26.555 19.845 135-139 25.224999999999998 27.644999999999996 26.755000000000003 20.375 140-144 25.55 27.22 26.735 20.495 145-149 26.125 27.860000000000003 26.43 19.585 150-151 26.1125 27.85 26.125 19.9125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.5 24 1.0 25 2.5 26 3.5 27 5.5 28 6.5 29 4.0 30 8.5 31 12.0 32 16.5 33 34.5 34 43.0 35 58.5 36 71.0 37 80.5 38 118.5 39 168.5 40 205.5 41 234.0 42 237.5 43 255.5 44 284.5 45 284.5 46 274.5 47 248.0 48 241.5 49 220.0 50 180.0 51 146.5 52 104.0 53 86.5 54 82.0 55 66.5 56 50.5 57 34.0 58 29.5 59 21.5 60 9.0 61 8.0 62 7.0 63 6.5 64 6.0 65 4.0 66 3.0 67 1.5 68 2.5 69 3.0 70 1.5 71 0.0 72 0.5 73 1.5 74 1.5 75 0.5 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 1.0 85 1.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.5 91 1.5 92 1.0 93 1.0 94 1.0 95 0.0 96 0.0 97 0.0 98 1.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.75 #Duplication Level Percentage of deduplicated Percentage of total 1 90.80779944289694 81.5 2 7.88300835654596 14.149999999999999 3 0.8356545961002786 2.25 4 0.25069637883008355 0.8999999999999999 5 0.08356545961002786 0.375 6 0.08356545961002786 0.44999999999999996 7 0.02785515320334262 0.17500000000000002 8 0.02785515320334262 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATTCTACAATAAGCTAGCTTTTACGTTGCAAACCTTGTTTTCCCTTTCG 8 0.2 No Hit GTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTACATA 7 0.17500000000000002 No Hit AGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGA 6 0.15 No Hit GAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGA 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GGCTGTTAGTAAGACCAAACCAGTCTCTCTAATCAAACAAGTATACGATG 5 0.125 No Hit CAGCAATTCACAACGATTATTCTTCAGCAGACGACCAACCAGCAAAGCAA 5 0.125 No Hit CAAACATCTAATTCTACAATAAGCTAGCTTTTACGTTGCAAACCTTGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.025 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.3499999999999996 0.0 0.0 0.0 0.0 120-121 2.525 0.0 0.0 0.0 0.0 122-123 2.7750000000000004 0.0 0.0 0.0 0.0 124-125 3.0375 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 4.199999999999999 0.0 0.0 0.0 0.0 132-133 4.6 0.0 0.0 0.0 0.0 134-135 4.9375 0.0 0.0 0.0 0.0 136-137 5.324999999999999 0.0 0.0 0.0 0.0 138-139 5.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTCCA 10 0.006830828 145.0 7 ATGTGGA 10 0.006830828 145.0 8 >>END_MODULE Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra Read 614021 spots for SRR12917541.sra Written 614021 spots for SRR12917541.sra Read 614005 spots for SRR12917541.sra Written 614005 spots for SRR12917541.sra SRR ids: ['SRR12917541.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xbxejijn SRR12917541.sra spots: 12280116 blocks: [[1, 614005], [614006, 1228010], [1228011, 1842015], [1842016, 2456020], [2456021, 3070025], [3070026, 3684030], [3684031, 4298035], [4298036, 4912040], [4912041, 5526045], [5526046, 6140050], [6140051, 6754055], [6754056, 7368060], [7368061, 7982065], [7982066, 8596070], [8596071, 9210075], [9210076, 9824080], [9824081, 10438085], [10438086, 11052090], [11052091, 11666095], [11666096, 12280116]] SRR12917541 file size 4151620 SRR12917541 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917541 SRR12917541_1.fastq SRR12917541_2.fastq Input file: SRR12917541_1.fastq Paired file: SRR12917541_2.fastq trimmed: SRR12917541-trimmed-pair1.fastq, SRR12917541-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:37:59 2025 >> started Thu Feb 13 12:38:13 2025 >> done (13.568s) 12280116 read pairs processed; of these: 108 ( 0.00%) short read pairs filtered out after trimming by size control 6458 ( 0.05%) empty read pairs filtered out after trimming by size control 12273550 (99.95%) read pairs available; of these: 1029792 ( 8.39%) trimmed read pairs available after processing 11243758 (91.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 7 0.00% 21 6 0.00% 22 10 0.00% 23 9 0.00% 24 13 0.00% 25 10 0.00% 26 11 0.00% 27 13 0.00% 28 11 0.00% 29 15 0.00% 30 14 0.00% 31 19 0.00% 32 20 0.00% 33 19 0.00% 34 13 0.00% 35 20 0.00% 36 22 0.00% 37 13 0.00% 38 17 0.00% 39 28 0.00% 40 25 0.00% 41 31 0.00% 42 24 0.00% 43 44 0.00% 44 41 0.00% 45 36 0.00% 46 44 0.00% 47 63 0.00% 48 48 0.00% 49 39 0.00% 50 86 0.00% 51 97 0.00% 52 80 0.00% 53 94 0.00% 54 124 0.00% 55 134 0.00% 56 165 0.00% 57 183 0.00% 58 191 0.00% 59 239 0.00% 60 302 0.00% 61 318 0.00% 62 341 0.00% 63 392 0.00% 64 486 0.00% 65 517 0.00% 66 638 0.01% 67 688 0.01% 68 764 0.01% 69 888 0.01% 70 910 0.01% 71 1074 0.01% 72 1325 0.01% 73 1412 0.01% 74 1569 0.01% 75 1744 0.01% 76 1915 0.02% 77 2028 0.02% 78 2113 0.02% 79 2325 0.02% 80 2435 0.02% 81 2522 0.02% 82 3040 0.02% 83 3174 0.03% 84 3517 0.03% 85 3708 0.03% 86 3929 0.03% 87 4047 0.03% 88 4152 0.03% 89 4325 0.04% 90 4495 0.04% 91 4870 0.04% 92 4937 0.04% 93 5380 0.04% 94 5776 0.05% 95 6229 0.05% 96 6491 0.05% 97 6804 0.06% 98 6993 0.06% 99 7198 0.06% 100 7319 0.06% 101 7752 0.06% 102 7847 0.06% 103 8231 0.07% 104 8642 0.07% 105 9161 0.07% 106 9711 0.08% 107 10119 0.08% 108 10683 0.09% 109 10647 0.09% 110 10636 0.09% 111 11124 0.09% 112 11313 0.09% 113 11586 0.09% 114 12157 0.10% 115 12760 0.10% 116 13236 0.11% 117 13790 0.11% 118 14321 0.12% 119 14591 0.12% 120 15350 0.13% 121 15384 0.13% 122 15429 0.13% 123 16050 0.13% 124 16064 0.13% 125 17380 0.14% 126 17530 0.14% 127 18599 0.15% 128 19207 0.16% 129 19327 0.16% 130 20266 0.17% 131 20309 0.17% 132 20690 0.17% 133 21020 0.17% 134 21716 0.18% 135 22274 0.18% 136 23027 0.19% 137 23275 0.19% 138 23692 0.19% 139 24942 0.20% 140 25213 0.21% 141 26095 0.21% 142 26460 0.22% 143 26240 0.21% 144 26940 0.22% 145 27541 0.22% 146 27925 0.23% 147 28745 0.23% 148 29186 0.24% 149 29653 0.24% 150 30777 0.25% 151 11243758 91.61% 12273550 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=26 prefix-density=0.56 prefix-fanout=2.0 sequence=GCTTTATTTCGAACGTAAAAATCAGAAGTAGAACTCTTCGATCCAAAGACAACTTTGGGTTTTCCGGGCAGGCATT criterion=fanout-score sequence-density=0.26 sequence-density-rank=17 fanout-score=26.12 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=7.4 sequence=TCATCTTCAATCT criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=29 prefix-density=0.69 prefix-fanout=2.5 sequence=AGTATGAGAAAATTAACATGTTCTCTCCAAGTGAAGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=308.23 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=14.0 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12917541 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:38:53 Started mapping on | Feb 13 12:38:54 Finished on | Feb 13 12:40:32 Mapping speed, Million of reads per hour | 450.87 Number of input reads | 12273550 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11269711 Uniquely mapped reads % | 91.82% Average mapped length | 296.52 Number of splices: Total | 9839316 Number of splices: Annotated (sjdb) | 9630597 Number of splices: GT/AG | 9657418 Number of splices: GC/AG | 137800 Number of splices: AT/AC | 13421 Number of splices: Non-canonical | 30677 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 3.06 Insertion rate per base | 0.03% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 402616 % of reads mapped to multiple loci | 3.28% Number of reads mapped to too many loci | 213002 % of reads mapped to too many loci | 1.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 601223 601223 601223 N_multimapping 402616 402616 402616 N_noFeature 240358 11159479 292258 N_ambiguous 136252 638 77497 UnstrandedReadsAssigned:10893101 PositiveStrandReadsAssigned:109594 NegativeStrandReadsAssigned:10899956 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917541 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917541-trimmed-pair1.fastq SRR12917541-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,273,550 reads, 11,026,023 reads pseudoaligned [quant] estimated average fragment length: 273.039 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 993 rounds 52401 SRR12917541.ke.tsv 34699 SRR12917541.se.tsv 87100 total ==> SRR12917541.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.96 514 22.1664 Potri.005G024800.1.v4.1 1035 762.961 207 20.4284 Potri.004G059700.1.v4.1 961 689.191 23 2.51278 Potri.007G009000.2.v4.1 1416 1143.96 0 0 Potri.003G141000.2.v4.1 2943 2670.96 330 9.30277 Potri.016G087400.1.v4.1 270 80.4024 1449.77 1357.68 Potri.015G069301.1.v4.1 564 309.947 0 0 Potri.010G195200.1.v4.1 1773 1500.96 37 1.85609 Potri.012G127500.1.v4.1 977 705.058 7694 821.662 ==> SRR12917541.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 135 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR12917541 completed mapping pipeline successfully