Starting /dee2/code/volunteer_pipeline.sh SRR12917543 current disk space = 3090747920384 free memory = 1579398504 SRR12917543 SRAfilesize d96ae8d9f9cc947bb1d2dc2df2861ffc SRR12917543.sra SRR12917543.sra file validated SRR12917543 is paired end SRR12917543 is conventional basespace SRR12917543 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917543_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6435 37.0 37.0 37.0 37.0 37.0 2 36.4135 37.0 37.0 37.0 37.0 37.0 3 36.5815 37.0 37.0 37.0 37.0 37.0 4 36.618 37.0 37.0 37.0 37.0 37.0 5 36.651 37.0 37.0 37.0 37.0 37.0 6 36.652 37.0 37.0 37.0 37.0 37.0 7 36.5585 37.0 37.0 37.0 37.0 37.0 8 36.568 37.0 37.0 37.0 37.0 37.0 9 36.5845 37.0 37.0 37.0 37.0 37.0 10-14 36.6366 37.0 37.0 37.0 37.0 37.0 15-19 36.626599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5724 37.0 37.0 37.0 37.0 37.0 25-29 36.569900000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.581 37.0 37.0 37.0 37.0 37.0 35-39 36.5029 37.0 37.0 37.0 37.0 37.0 40-44 36.5646 37.0 37.0 37.0 37.0 37.0 45-49 36.4618 37.0 37.0 37.0 37.0 37.0 50-54 36.496500000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.4439 37.0 37.0 37.0 37.0 37.0 60-64 36.4161 37.0 37.0 37.0 37.0 37.0 65-69 36.281400000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3856 37.0 37.0 37.0 37.0 37.0 75-79 36.3442 37.0 37.0 37.0 37.0 37.0 80-84 36.3874 37.0 37.0 37.0 37.0 37.0 85-89 36.2947 37.0 37.0 37.0 37.0 37.0 90-94 36.3597 37.0 37.0 37.0 37.0 37.0 95-99 36.227199999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1937 37.0 37.0 37.0 37.0 37.0 105-109 36.21319999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.235499999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1742 37.0 37.0 37.0 37.0 37.0 120-124 36.113699999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.9756 37.0 37.0 37.0 37.0 37.0 130-134 35.8562 37.0 37.0 37.0 37.0 37.0 135-139 35.717 37.0 37.0 37.0 37.0 37.0 140-144 35.458999999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.213699999999996 37.0 37.0 37.0 34.6 37.0 150-151 34.8055 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 0.0 24 0.0 25 4.0 26 0.0 27 6.0 28 11.0 29 17.0 30 11.0 31 37.0 32 53.0 33 81.0 34 136.0 35 329.0 36 2987.0 37 327.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.125 12.85 6.175 39.85 2 18.725 12.375 38.25 30.65 3 16.375 16.1 28.000000000000004 39.525 4 22.675 21.099999999999998 24.349999999999998 31.874999999999996 5 23.75 28.425 24.875 22.95 6 21.099999999999998 31.775 23.674999999999997 23.45 7 16.900000000000002 27.125 39.800000000000004 16.175 8 16.55 25.924999999999997 33.125 24.4 9 16.775000000000002 23.925 34.475 24.825 10-14 19.67 30.09 26.974999999999998 23.265 15-19 20.265 27.589999999999996 27.894999999999996 24.25 20-24 20.369999999999997 28.15 27.334999999999997 24.145 25-29 19.695 28.33 27.639999999999997 24.335 30-34 20.080000000000002 28.599999999999998 26.755000000000003 24.565 35-39 20.525 27.47 27.735 24.27 40-44 20.515 28.235 27.46 23.79 45-49 20.005 28.675 27.57 23.75 50-54 19.785 28.199999999999996 27.345000000000002 24.67 55-59 20.265 27.87 27.075 24.79 60-64 20.375 27.47 27.79 24.365000000000002 65-69 20.765 27.83 27.544999999999998 23.86 70-74 20.86 27.83 27.534999999999997 23.775 75-79 21.0 27.815 27.24 23.945 80-84 20.810000000000002 27.500000000000004 27.779999999999998 23.91 85-89 20.405 27.915 27.04 24.64 90-94 20.31 27.334999999999997 28.115000000000002 24.240000000000002 95-99 20.845 27.865000000000002 27.315 23.974999999999998 100-104 21.34 28.225 26.565 23.87 105-109 21.165 27.900000000000002 27.029999999999998 23.905 110-114 21.224999999999998 27.93 26.584999999999997 24.26 115-119 21.52 27.705000000000002 26.165 24.610000000000003 120-124 21.65 27.834999999999997 26.495 24.02 125-129 21.095 27.889999999999997 26.700000000000003 24.315 130-134 21.805 27.834999999999997 25.86 24.5 135-139 22.264999999999997 27.334999999999997 26.69 23.71 140-144 22.23 27.57 26.11 24.09 145-149 22.495 26.82 25.8 24.884999999999998 150-151 23.6625 26.8 26.6625 22.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 1.0 23 3.0 24 3.5 25 3.5 26 7.0 27 7.0 28 6.0 29 14.0 30 21.0 31 19.5 32 23.5 33 38.5 34 49.0 35 59.0 36 86.0 37 103.5 38 113.5 39 126.5 40 158.0 41 189.0 42 207.5 43 237.0 44 232.0 45 249.5 46 269.0 47 261.0 48 252.5 49 210.0 50 170.0 51 162.5 52 156.0 53 129.5 54 103.5 55 91.0 56 67.0 57 39.0 58 30.0 59 30.5 60 25.0 61 13.0 62 7.5 63 4.5 64 3.0 65 2.0 66 2.0 67 2.5 68 2.0 69 0.5 70 0.5 71 0.0 72 0.5 73 2.0 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.425 #Duplication Level Percentage of deduplicated Percentage of total 1 90.95935858446225 82.25 2 7.90710533591374 14.299999999999999 3 0.8294166436273155 2.25 4 0.24882499308819464 0.8999999999999999 5 0.02764722145424385 0.125 6 0.0 0.0 7 0.02764722145424385 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCT 7 0.17500000000000002 No Hit GTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.8500000000000001 0.0 0.0 0.0 0.0 88-89 1.1124999999999998 0.0 0.0 0.0 0.0 90-91 1.3125 0.0 0.0 0.0 0.0 92-93 1.5625 0.0 0.0 0.0 0.0 94-95 1.9 0.0 0.0 0.0 0.0 96-97 2.25 0.0 0.0 0.0 0.0 98-99 2.5999999999999996 0.0 0.0 0.0 0.0 100-101 2.975 0.0 0.0 0.0 0.0 102-103 3.4625000000000004 0.0 0.0 0.0 0.0 104-105 3.9124999999999996 0.0 0.0 0.0 0.0 106-107 4.375 0.0 0.0 0.0 0.0 108-109 4.8875 0.0 0.0 0.0 0.0 110-111 5.4125 0.0 0.0 0.0 0.0 112-113 5.875 0.0 0.0 0.0 0.0 114-115 6.35 0.0 0.0 0.0 0.0 116-117 6.862500000000001 0.0 0.0 0.0 0.0 118-119 7.3875 0.0 0.0 0.0 0.0 120-121 8.025 0.0 0.0 0.0 0.0 122-123 8.5 0.0 0.0 0.0 0.0 124-125 8.95 0.0 0.0 0.0 0.0 126-127 9.6375 0.0 0.0 0.0 0.0 128-129 10.2625 0.0 0.0 0.0 0.0 130-131 11.1625 0.0 0.0 0.0 0.0 132-133 11.875 0.0 0.0 0.0 0.0 134-135 12.625 0.0 0.0 0.0 0.0 136-137 13.037500000000001 0.0 0.0 0.0 0.0 138-139 13.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCGACG 10 0.006830828 145.0 1 TCGACGA 10 0.006830828 145.0 2 CCTGCAA 10 0.006830828 145.0 1 GTCCTTA 10 0.006830828 145.0 1 TGCCAGC 10 0.006830828 145.0 9 ATGCCAG 10 0.006830828 145.0 8 GACGATG 10 0.006830828 145.0 4 ACGATGC 10 0.006830828 145.0 5 CGATGCC 10 0.006830828 145.0 6 GGGGGGG 20 0.00593511 29.0 135-139 >>END_MODULE SRR12917543 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917543_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4005 37.0 37.0 37.0 37.0 37.0 2 36.193 37.0 37.0 37.0 37.0 37.0 3 36.1605 37.0 37.0 37.0 37.0 37.0 4 36.24 37.0 37.0 37.0 37.0 37.0 5 36.355 37.0 37.0 37.0 37.0 37.0 6 36.2275 37.0 37.0 37.0 37.0 37.0 7 36.3035 37.0 37.0 37.0 37.0 37.0 8 36.4155 37.0 37.0 37.0 37.0 37.0 9 36.288 37.0 37.0 37.0 37.0 37.0 10-14 36.319900000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.351800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.23 37.0 37.0 37.0 37.0 37.0 25-29 36.2001 37.0 37.0 37.0 37.0 37.0 30-34 36.1815 37.0 37.0 37.0 37.0 37.0 35-39 36.121 37.0 37.0 37.0 37.0 37.0 40-44 36.0646 37.0 37.0 37.0 37.0 37.0 45-49 36.0284 37.0 37.0 37.0 37.0 37.0 50-54 36.0195 37.0 37.0 37.0 37.0 37.0 55-59 35.9974 37.0 37.0 37.0 37.0 37.0 60-64 36.0215 37.0 37.0 37.0 37.0 37.0 65-69 36.0017 37.0 37.0 37.0 37.0 37.0 70-74 35.9734 37.0 37.0 37.0 37.0 37.0 75-79 35.882600000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.9168 37.0 37.0 37.0 37.0 37.0 85-89 35.9237 37.0 37.0 37.0 37.0 37.0 90-94 35.93429999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.861599999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.7872 37.0 37.0 37.0 37.0 37.0 105-109 35.7332 37.0 37.0 37.0 37.0 37.0 110-114 35.7095 37.0 37.0 37.0 37.0 37.0 115-119 35.658100000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.484700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.3618 37.0 37.0 37.0 37.0 37.0 130-134 35.1927 37.0 37.0 37.0 32.2 37.0 135-139 35.1062 37.0 37.0 37.0 29.8 37.0 140-144 34.7938 37.0 37.0 37.0 25.0 37.0 145-149 34.5204 37.0 37.0 37.0 25.0 37.0 150-151 34.050250000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 2.0 18 0.0 19 1.0 20 1.0 21 3.0 22 3.0 23 2.0 24 5.0 25 3.0 26 5.0 27 7.0 28 15.0 29 16.0 30 22.0 31 42.0 32 76.0 33 148.0 34 270.0 35 721.0 36 2498.0 37 157.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.625 28.050000000000004 8.4 26.924999999999997 2 27.400000000000002 26.950000000000003 30.175 15.475 3 20.150000000000002 26.1 34.35 19.400000000000002 4 22.1 32.975 24.25 20.674999999999997 5 26.125 37.3 20.424999999999997 16.150000000000002 6 20.724999999999998 40.275 21.275 17.724999999999998 7 21.375 23.200000000000003 37.0 18.425 8 19.2 28.575 29.325000000000003 22.900000000000002 9 22.45 24.4 29.875 23.275000000000002 10-14 23.315 28.884999999999998 26.035000000000004 21.765 15-19 23.48 28.78 26.169999999999998 21.57 20-24 23.61 28.544999999999998 27.18 20.665 25-29 22.955000000000002 27.515 27.595 21.935 30-34 22.8 27.655 28.015 21.529999999999998 35-39 23.26 27.88 27.41 21.45 40-44 23.165 27.810000000000002 27.24 21.785 45-49 22.925 28.225 27.839999999999996 21.01 50-54 23.655 27.21 27.400000000000002 21.735 55-59 23.255 28.105000000000004 27.185 21.455 60-64 23.31 27.205000000000002 27.595 21.89 65-69 23.345 27.500000000000004 27.515 21.64 70-74 23.580000000000002 27.615000000000002 26.82 21.985 75-79 24.055 27.6 26.82 21.525 80-84 23.955000000000002 27.805000000000003 26.284999999999997 21.955 85-89 23.715 27.589999999999996 26.58 22.115000000000002 90-94 25.15 27.875 25.669999999999998 21.305 95-99 24.33 28.1 26.200000000000003 21.37 100-104 24.88 27.255000000000003 26.445 21.42 105-109 24.425 27.185 27.175 21.215 110-114 25.655 27.865000000000002 26.435 20.044999999999998 115-119 25.515 27.175 26.979999999999997 20.330000000000002 120-124 25.924999999999997 27.83 26.215 20.03 125-129 26.255 27.49 25.785000000000004 20.47 130-134 26.265 27.034999999999997 26.85 19.85 135-139 26.290000000000003 27.450000000000003 26.340000000000003 19.919999999999998 140-144 27.305 27.189999999999998 25.805 19.7 145-149 27.965 26.369999999999997 26.169999999999998 19.495 150-151 28.999999999999996 27.187499999999996 24.5125 19.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.5 11 1.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.5 24 0.5 25 0.0 26 0.5 27 2.5 28 4.0 29 7.5 30 11.0 31 12.0 32 18.0 33 35.0 34 51.5 35 53.0 36 63.0 37 105.0 38 128.0 39 144.5 40 173.0 41 205.0 42 235.0 43 235.5 44 248.5 45 275.0 46 285.0 47 248.0 48 234.0 49 232.0 50 180.0 51 155.5 52 137.5 53 109.5 54 102.5 55 79.5 56 56.0 57 49.5 58 32.5 59 19.0 60 17.0 61 11.5 62 5.5 63 8.5 64 6.0 65 1.0 66 1.0 67 2.0 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.275 #Duplication Level Percentage of deduplicated Percentage of total 1 91.02741622819164 82.175 2 7.726391581279424 13.950000000000001 3 0.8031016338964275 2.175 4 0.33231791747438383 1.2 5 0.11077263915812793 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit CAAACACTTCCTCCTTTTTTGGAGTCCTGAAACTCCCAAATATTTGAAAA 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit AGAACGAAAATCACAAGCTTTTGGTGTACAAATACATGCCAAATAGGGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.8500000000000001 0.0 0.0 0.0 0.0 88-89 1.1124999999999998 0.0 0.0 0.0 0.0 90-91 1.3125 0.0 0.0 0.0 0.0 92-93 1.5375 0.0 0.0 0.0 0.0 94-95 1.9249999999999998 0.0 0.0 0.0 0.0 96-97 2.2750000000000004 0.0 0.0 0.0 0.0 98-99 2.625 0.0 0.0 0.0 0.0 100-101 3.0 0.0 0.0 0.0 0.0 102-103 3.4875 0.0 0.0 0.0 0.0 104-105 3.9375 0.0 0.0 0.0 0.0 106-107 4.4 0.0 0.0 0.0 0.0 108-109 4.8875 0.0 0.0 0.0 0.0 110-111 5.4125 0.0 0.0 0.0 0.0 112-113 5.875 0.0 0.0 0.0 0.0 114-115 6.35 0.0 0.0 0.0 0.0 116-117 6.85 0.0 0.0 0.0 0.0 118-119 7.3875 0.0 0.0 0.0 0.0 120-121 8.025 0.0 0.0 0.0 0.0 122-123 8.5 0.0 0.0 0.0 0.0 124-125 8.925 0.0 0.0 0.0 0.0 126-127 9.6125 0.0 0.0 0.0 0.0 128-129 10.2375 0.0 0.0 0.0 0.0 130-131 11.15 0.0 0.0 0.0 0.0 132-133 11.85 0.0 0.0 0.0 0.0 134-135 12.6 0.0 0.0 0.0 0.0 136-137 13.025 0.0 0.0 0.0 0.0 138-139 13.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476378 spots for SRR12917543.sra Written 476378 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra Read 476359 spots for SRR12917543.sra Written 476359 spots for SRR12917543.sra SRR ids: ['SRR12917543.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lz1w7z9q SRR12917543.sra spots: 9527199 blocks: [[1, 476359], [476360, 952718], [952719, 1429077], [1429078, 1905436], [1905437, 2381795], [2381796, 2858154], [2858155, 3334513], [3334514, 3810872], [3810873, 4287231], [4287232, 4763590], [4763591, 5239949], [5239950, 5716308], [5716309, 6192667], [6192668, 6669026], [6669027, 7145385], [7145386, 7621744], [7621745, 8098103], [8098104, 8574462], [8574463, 9050821], [9050822, 9527199]] SRR12917543 file size 3216982 SRR12917543 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917543 SRR12917543_1.fastq SRR12917543_2.fastq Input file: SRR12917543_1.fastq Paired file: SRR12917543_2.fastq trimmed: SRR12917543-trimmed-pair1.fastq, SRR12917543-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:33:33 2025 >> started Thu Feb 13 13:33:43 2025 >> done (9.924s) 9527199 read pairs processed; of these: 42 ( 0.00%) short read pairs filtered out after trimming by size control 4026 ( 0.04%) empty read pairs filtered out after trimming by size control 9523131 (99.96%) read pairs available; of these: 1833682 (19.26%) trimmed read pairs available after processing 7689449 (80.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 7 0.00% 21 3 0.00% 22 10 0.00% 23 10 0.00% 24 6 0.00% 25 10 0.00% 26 18 0.00% 27 20 0.00% 28 18 0.00% 29 18 0.00% 30 24 0.00% 31 18 0.00% 32 19 0.00% 33 26 0.00% 34 24 0.00% 35 27 0.00% 36 31 0.00% 37 29 0.00% 38 19 0.00% 39 29 0.00% 40 16 0.00% 41 30 0.00% 42 55 0.00% 43 45 0.00% 44 42 0.00% 45 48 0.00% 46 59 0.00% 47 61 0.00% 48 74 0.00% 49 100 0.00% 50 89 0.00% 51 128 0.00% 52 146 0.00% 53 156 0.00% 54 178 0.00% 55 197 0.00% 56 206 0.00% 57 246 0.00% 58 369 0.00% 59 388 0.00% 60 447 0.00% 61 563 0.01% 62 653 0.01% 63 741 0.01% 64 894 0.01% 65 999 0.01% 66 1128 0.01% 67 1174 0.01% 68 1458 0.02% 69 1605 0.02% 70 1934 0.02% 71 2176 0.02% 72 2471 0.03% 73 2947 0.03% 74 3234 0.03% 75 3586 0.04% 76 4003 0.04% 77 4167 0.04% 78 4552 0.05% 79 5007 0.05% 80 5294 0.06% 81 6021 0.06% 82 6493 0.07% 83 6943 0.07% 84 8147 0.09% 85 8637 0.09% 86 9044 0.09% 87 9756 0.10% 88 10303 0.11% 89 10345 0.11% 90 10948 0.11% 91 11555 0.12% 92 11950 0.13% 93 13237 0.14% 94 14105 0.15% 95 14655 0.15% 96 15539 0.16% 97 16402 0.17% 98 16539 0.17% 99 17183 0.18% 100 17167 0.18% 101 17584 0.18% 102 18449 0.19% 103 19175 0.20% 104 19730 0.21% 105 20798 0.22% 106 21782 0.23% 107 22306 0.23% 108 22340 0.23% 109 23521 0.25% 110 23154 0.24% 111 23987 0.25% 112 24173 0.25% 113 24566 0.26% 114 25057 0.26% 115 26124 0.27% 116 26820 0.28% 117 28004 0.29% 118 28848 0.30% 119 29168 0.31% 120 29991 0.31% 121 29827 0.31% 122 30316 0.32% 123 30493 0.32% 124 31094 0.33% 125 31456 0.33% 126 32357 0.34% 127 32721 0.34% 128 33535 0.35% 129 34594 0.36% 130 34267 0.36% 131 34832 0.37% 132 34589 0.36% 133 34534 0.36% 134 34760 0.37% 135 35343 0.37% 136 35999 0.38% 137 36243 0.38% 138 36336 0.38% 139 38591 0.41% 140 37933 0.40% 141 38762 0.41% 142 38320 0.40% 143 37768 0.40% 144 38617 0.41% 145 38442 0.40% 146 38816 0.41% 147 38465 0.40% 148 40525 0.43% 149 40061 0.42% 150 41497 0.44% 151 7689449 80.74% 9523131 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=23 prefix-density=0.73 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=41.56 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.4 sequence=TAAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=1.13 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.25 sequence-density-rank=24 fanout-score=9.75 fanout-score-rank=1 prefix-density=1.71 prefix-fanout=1.4 sequence=TCAATCAATCACCATGTCTAGCA SRR12917543 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:34:43 Started mapping on | Feb 13 13:34:43 Finished on | Feb 13 13:35:40 Mapping speed, Million of reads per hour | 601.46 Number of input reads | 9523131 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 7705148 Uniquely mapped reads % | 80.91% Average mapped length | 285.62 Number of splices: Total | 7630860 Number of splices: Annotated (sjdb) | 7489084 Number of splices: GT/AG | 7462769 Number of splices: GC/AG | 135060 Number of splices: AT/AC | 5150 Number of splices: Non-canonical | 27881 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 202752 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 102958 % of reads mapped to too many loci | 1.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.71% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1615232 1615232 1615232 N_multimapping 202752 202752 202752 N_noFeature 251987 7555951 287191 N_ambiguous 217639 1028 102978 UnstrandedReadsAssigned:7235522 PositiveStrandReadsAssigned:148169 NegativeStrandReadsAssigned:7314979 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917543 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917543-trimmed-pair1.fastq SRR12917543-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,523,131 reads, 8,598,796 reads pseudoaligned [quant] estimated average fragment length: 222.86 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 997 rounds 52401 SRR12917543.ke.tsv 34699 SRR12917543.se.tsv 87100 total ==> SRR12917543.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.14 250 12.0693 Potri.005G024800.1.v4.1 1035 813.14 271 28.8993 Potri.004G059700.1.v4.1 961 739.208 34 3.98837 Potri.007G009000.2.v4.1 1416 1194.14 0 0 Potri.003G141000.2.v4.1 2943 2721.14 320 10.1972 Potri.016G087400.1.v4.1 270 104.231 471.273 392.067 Potri.015G069301.1.v4.1 564 352.407 0 0 Potri.010G195200.1.v4.1 1773 1551.14 43 2.40381 Potri.012G127500.1.v4.1 977 755.17 240 27.5582 ==> SRR12917543.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 79 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12917543 completed mapping pipeline successfully