Starting /dee2/code/volunteer_pipeline.sh SRR12917544 current disk space = 3090681847808 free memory = 1572464300 SRR12917544 SRAfilesize 35159272595cfa0520c61245f0ce726e SRR12917544.sra SRR12917544.sra file validated SRR12917544 is paired end SRR12917544 is conventional basespace SRR12917544 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917544_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6235 37.0 37.0 37.0 37.0 37.0 2 36.586 37.0 37.0 37.0 37.0 37.0 3 36.68 37.0 37.0 37.0 37.0 37.0 4 36.684 37.0 37.0 37.0 37.0 37.0 5 36.688 37.0 37.0 37.0 37.0 37.0 6 36.731 37.0 37.0 37.0 37.0 37.0 7 36.58 37.0 37.0 37.0 37.0 37.0 8 36.6575 37.0 37.0 37.0 37.0 37.0 9 36.664 37.0 37.0 37.0 37.0 37.0 10-14 36.66030000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.6343 37.0 37.0 37.0 37.0 37.0 20-24 36.5702 37.0 37.0 37.0 37.0 37.0 25-29 36.5487 37.0 37.0 37.0 37.0 37.0 30-34 36.4794 37.0 37.0 37.0 37.0 37.0 35-39 36.4745 37.0 37.0 37.0 37.0 37.0 40-44 36.4721 37.0 37.0 37.0 37.0 37.0 45-49 36.4246 37.0 37.0 37.0 37.0 37.0 50-54 36.394999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3772 37.0 37.0 37.0 37.0 37.0 60-64 36.3234 37.0 37.0 37.0 37.0 37.0 65-69 36.1973 37.0 37.0 37.0 37.0 37.0 70-74 36.283100000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.315 37.0 37.0 37.0 37.0 37.0 80-84 36.3147 37.0 37.0 37.0 37.0 37.0 85-89 36.259299999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2161 37.0 37.0 37.0 37.0 37.0 95-99 36.2 37.0 37.0 37.0 37.0 37.0 100-104 36.2029 37.0 37.0 37.0 37.0 37.0 105-109 36.1363 37.0 37.0 37.0 37.0 37.0 110-114 36.1139 37.0 37.0 37.0 37.0 37.0 115-119 36.0476 37.0 37.0 37.0 37.0 37.0 120-124 36.080400000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9934 37.0 37.0 37.0 37.0 37.0 130-134 35.9348 37.0 37.0 37.0 37.0 37.0 135-139 35.8476 37.0 37.0 37.0 37.0 37.0 140-144 35.6549 37.0 37.0 37.0 37.0 37.0 145-149 35.5488 37.0 37.0 37.0 37.0 37.0 150-151 35.269000000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 5.0 23 1.0 24 1.0 25 5.0 26 6.0 27 10.0 28 13.0 29 17.0 30 31.0 31 33.0 32 39.0 33 56.0 34 83.0 35 301.0 36 3039.0 37 358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.17158579289645 14.007003501750875 6.353176588294147 36.46823411705853 2 19.775000000000002 13.375 35.65 31.2 3 18.099999999999998 17.025000000000002 27.800000000000004 37.075 4 20.65 22.525000000000002 25.0 31.825 5 24.55 28.349999999999998 24.275 22.825 6 20.775 33.800000000000004 24.2 21.224999999999998 7 15.675 30.8 38.05 15.475 8 16.3 28.599999999999998 32.225 22.875 9 17.275 23.95 34.949999999999996 23.825 10-14 19.42 31.125000000000004 28.1 21.355 15-19 19.67 29.235 27.275 23.82 20-24 19.48 29.909999999999997 27.325 23.285 25-29 19.75 29.904999999999998 27.534999999999997 22.81 30-34 19.09 30.0 27.05 23.86 35-39 20.14 29.75 26.619999999999997 23.49 40-44 20.21 29.099999999999998 27.265 23.425 45-49 20.145 28.96 26.46 24.435000000000002 50-54 20.265 29.270000000000003 27.12 23.345 55-59 20.26 29.29 27.105 23.345 60-64 20.46 28.444999999999997 26.93 24.165 65-69 19.689999999999998 29.415000000000003 27.215 23.68 70-74 20.315 29.64 27.310000000000002 22.735 75-79 20.25 28.89 27.139999999999997 23.72 80-84 20.830000000000002 28.675 27.495000000000005 23.0 85-89 20.76 29.315 26.805 23.119999999999997 90-94 20.990000000000002 28.199999999999996 26.645000000000003 24.165 95-99 21.07 28.860000000000003 26.740000000000002 23.330000000000002 100-104 20.41 28.515 27.229999999999997 23.845 105-109 20.71 28.499999999999996 27.22 23.57 110-114 21.404999999999998 28.544999999999998 26.365 23.685000000000002 115-119 21.25 28.449999999999996 26.205000000000002 24.095 120-124 21.205 28.335 26.205000000000002 24.255 125-129 21.3 28.194999999999997 26.33 24.175 130-134 21.57 28.355000000000004 26.045 24.03 135-139 21.18 28.494999999999997 26.265 24.060000000000002 140-144 21.265 27.474999999999998 26.484999999999996 24.775 145-149 21.615000000000002 27.83 26.51 24.044999999999998 150-151 21.2625 27.625 26.0375 25.074999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 1.0 16 1.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 1.5 23 1.0 24 1.0 25 4.0 26 6.5 27 6.5 28 6.0 29 7.5 30 19.5 31 37.5 32 50.0 33 57.5 34 74.5 35 89.5 36 104.0 37 112.5 38 137.0 39 168.5 40 196.5 41 213.0 42 219.0 43 243.0 44 234.5 45 227.0 46 236.0 47 238.5 48 224.5 49 191.5 50 165.5 51 152.5 52 127.5 53 97.0 54 78.5 55 57.5 56 38.5 57 29.0 58 24.5 59 20.5 60 17.5 61 13.5 62 11.5 63 8.0 64 5.5 65 11.0 66 9.0 67 4.5 68 4.0 69 1.0 70 1.5 71 1.5 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.0 #Duplication Level Percentage of deduplicated Percentage of total 1 91.13888888888889 82.025 2 7.277777777777778 13.100000000000001 3 1.1944444444444444 3.225 4 0.2777777777777778 1.0 5 0.08333333333333334 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027777777777777776 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAAGGTCTATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 2 (97% over 36bp) CACATGTGAGTTCTGTTCCATAAACCCCACTGTACAAAACCTCCACGCCG 5 0.125 No Hit GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 5 0.125 No Hit CCCCTCAAACACTCTCCTTTTTACAATGTTTAAGCACACCCATTACATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.36250000000000004 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.7749999999999999 0.0 0.0 0.0 0.0 86-87 1.1625 0.0 0.0 0.0 0.0 88-89 1.3375 0.0 0.0 0.0 0.0 90-91 1.4375 0.0 0.0 0.0 0.0 92-93 1.7625 0.0 0.0 0.0 0.0 94-95 1.9625 0.0 0.0 0.0 0.0 96-97 2.3125 0.0 0.0 0.0 0.0 98-99 2.6125 0.0 0.0 0.0 0.0 100-101 3.025 0.0 0.0 0.0 0.0 102-103 3.3375 0.0 0.0 0.0 0.0 104-105 3.875 0.0 0.0 0.0 0.0 106-107 4.362500000000001 0.0 0.0 0.0 0.0 108-109 5.025 0.0 0.0 0.0 0.0 110-111 5.5625 0.0 0.0 0.0 0.0 112-113 5.925 0.0 0.0 0.0 0.0 114-115 6.4 0.0 0.0 0.0 0.0 116-117 7.0125 0.0 0.0 0.0 0.0 118-119 7.725 0.0 0.0 0.0 0.0 120-121 8.4625 0.0 0.0 0.0 0.0 122-123 9.212499999999999 0.0 0.0 0.0 0.0 124-125 10.0625 0.0 0.0 0.0 0.0 126-127 10.8625 0.0 0.0 0.0 0.0 128-129 11.675 0.0 0.0 0.0 0.0 130-131 12.7125 0.0 0.0 0.0 0.0 132-133 13.325 0.0 0.0 0.0 0.0 134-135 14.0625 0.0 0.0 0.0 0.0 136-137 14.9625 0.0 0.0 0.0 0.0 138-139 15.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 320 4.0017767E-11 9.515625 10-14 >>END_MODULE SRR12917544 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917544_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41425 37.0 37.0 37.0 37.0 37.0 2 36.281 37.0 37.0 37.0 37.0 37.0 3 36.3475 37.0 37.0 37.0 37.0 37.0 4 36.4025 37.0 37.0 37.0 37.0 37.0 5 36.5035 37.0 37.0 37.0 37.0 37.0 6 36.472 37.0 37.0 37.0 37.0 37.0 7 36.513 37.0 37.0 37.0 37.0 37.0 8 36.5185 37.0 37.0 37.0 37.0 37.0 9 36.472 37.0 37.0 37.0 37.0 37.0 10-14 36.484399999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.416900000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.4551 37.0 37.0 37.0 37.0 37.0 25-29 36.287099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.2125 37.0 37.0 37.0 37.0 37.0 35-39 36.213 37.0 37.0 37.0 37.0 37.0 40-44 36.2195 37.0 37.0 37.0 37.0 37.0 45-49 36.136 37.0 37.0 37.0 37.0 37.0 50-54 36.126599999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.09609999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.1343 37.0 37.0 37.0 37.0 37.0 65-69 36.081 37.0 37.0 37.0 37.0 37.0 70-74 36.0553 37.0 37.0 37.0 37.0 37.0 75-79 35.981899999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.0644 37.0 37.0 37.0 37.0 37.0 85-89 36.0794 37.0 37.0 37.0 37.0 37.0 90-94 36.0854 37.0 37.0 37.0 37.0 37.0 95-99 36.0861 37.0 37.0 37.0 37.0 37.0 100-104 35.962 37.0 37.0 37.0 37.0 37.0 105-109 35.992200000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.9448 37.0 37.0 37.0 37.0 37.0 115-119 35.8394 37.0 37.0 37.0 37.0 37.0 120-124 35.750099999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.625299999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.523399999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.3549 37.0 37.0 37.0 37.0 37.0 140-144 35.1209 37.0 37.0 37.0 27.4 37.0 145-149 34.9104 37.0 37.0 37.0 25.0 37.0 150-151 34.31575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 4.0 16 0.0 17 1.0 18 0.0 19 4.0 20 0.0 21 5.0 22 0.0 23 3.0 24 6.0 25 6.0 26 8.0 27 6.0 28 4.0 29 19.0 30 19.0 31 40.0 32 49.0 33 76.0 34 177.0 35 532.0 36 2841.0 37 195.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.610152538134535 25.456364091022753 9.627406851712928 24.306076519129782 2 28.000000000000004 25.474999999999998 30.55 15.975 3 21.525 27.35 33.2 17.925 4 25.05 32.7 22.975 19.275000000000002 5 27.3 35.225 20.549999999999997 16.925 6 21.6 40.25 21.575 16.575 7 22.925 22.0 36.4 18.675 8 20.549999999999997 26.325 28.475 24.65 9 21.55 26.474999999999998 29.175 22.8 10-14 24.705 28.89 25.75 20.655 15-19 24.560000000000002 27.555000000000003 27.894999999999996 19.99 20-24 24.39 28.515 27.125 19.97 25-29 23.990000000000002 28.044999999999998 27.250000000000004 20.715 30-34 24.415 27.605 27.01 20.97 35-39 23.74 28.99 26.71 20.560000000000002 40-44 24.065 28.48 27.01 20.445 45-49 24.215 27.63 27.855 20.3 50-54 23.86 27.389999999999997 27.775 20.974999999999998 55-59 24.884999999999998 27.855 27.015 20.244999999999997 60-64 24.43 27.72 27.33 20.52 65-69 23.595 27.765 28.21 20.43 70-74 24.595 26.889999999999997 27.79 20.724999999999998 75-79 25.430000000000003 27.515 26.775 20.28 80-84 24.44 27.089999999999996 27.515 20.955 85-89 24.59 27.295 27.51 20.605 90-94 24.45 27.529999999999998 27.810000000000002 20.21 95-99 24.345 28.044999999999998 27.3 20.31 100-104 24.43 28.225 27.375 19.97 105-109 24.88 27.26 27.49 20.369999999999997 110-114 25.005 27.88 27.16 19.955000000000002 115-119 24.88 28.035 27.22 19.865 120-124 25.119999999999997 27.675 26.6 20.605 125-129 25.795 28.065 26.075 20.064999999999998 130-134 26.19 27.694999999999997 26.5 19.615 135-139 26.939999999999998 27.305 26.96 18.795 140-144 27.43 27.29 26.555 18.725 145-149 27.73 27.339999999999996 26.495 18.435000000000002 150-151 28.825 26.387500000000003 26.3125 18.475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 2.0 25 2.0 26 1.0 27 0.5 28 2.5 29 5.0 30 10.5 31 15.5 32 15.5 33 26.0 34 41.0 35 58.5 36 78.5 37 96.0 38 138.0 39 184.0 40 209.0 41 233.5 42 238.0 43 254.0 44 268.0 45 286.0 46 296.0 47 251.5 48 217.0 49 207.5 50 163.0 51 117.0 52 113.0 53 93.5 54 67.5 55 50.5 56 46.0 57 40.0 58 28.0 59 24.0 60 22.0 61 17.0 62 6.5 63 6.0 64 11.0 65 7.0 66 4.5 67 4.0 68 1.5 69 1.0 70 0.5 71 1.5 72 3.0 73 3.0 74 1.5 75 0.0 76 0.0 77 1.0 78 1.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 1.5 88 1.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.5 97 0.5 98 0.0 99 2.5 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.58620689655173 83.0 2 7.03448275862069 12.75 3 1.0758620689655174 2.9250000000000003 4 0.19310344827586207 0.7000000000000001 5 0.05517241379310345 0.25 6 0.027586206896551724 0.15 7 0.0 0.0 8 0.0 0.0 9 0.027586206896551724 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit CAGCAAGTGCTTCTGTAGCTTTGACATCTTTGTCAAATGAAAAGCTCTTC 6 0.15 No Hit AGTTTAGCAGTAGGCATGGACAGAAGGGTGTTTGCTCCCAGTTATGGCCA 5 0.125 No Hit GTTAAGAAAATGCTATTCTGATGAATGCCTGCCCGGAAAACCCAAAGTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.7250000000000001 0.0 0.0 0.0 0.0 86-87 1.1124999999999998 0.0 0.0 0.0 0.0 88-89 1.2875 0.0 0.0 0.0 0.0 90-91 1.3875000000000002 0.0 0.0 0.0 0.0 92-93 1.7 0.0 0.0 0.0 0.0 94-95 1.8875 0.0 0.0 0.0 0.0 96-97 2.225 0.0 0.0 0.0 0.0 98-99 2.5125 0.0 0.0 0.0 0.0 100-101 2.925 0.0 0.0 0.0 0.0 102-103 3.2625 0.0 0.0 0.0 0.0 104-105 3.825 0.0 0.0 0.0 0.0 106-107 4.3125 0.0 0.0 0.0 0.0 108-109 4.975 0.0 0.0 0.0 0.0 110-111 5.5375 0.0 0.0 0.0 0.0 112-113 5.8875 0.0 0.0 0.0 0.0 114-115 6.35 0.0 0.0 0.0 0.0 116-117 6.9625 0.0 0.0 0.0 0.0 118-119 7.6625 0.0 0.0 0.0 0.0 120-121 8.3875 0.0 0.0 0.0 0.0 122-123 9.125 0.0 0.0 0.0 0.0 124-125 9.962499999999999 0.0 0.0 0.0 0.0 126-127 10.7625 0.0 0.0 0.0 0.0 128-129 11.575 0.0 0.0 0.0 0.0 130-131 12.6375 0.0 0.0 0.0 0.0 132-133 13.25 0.0 0.0 0.0 0.0 134-135 13.962499999999999 0.0 0.0 0.0 0.0 136-137 14.8625 0.0 0.0 0.0 0.0 138-139 15.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544876 spots for SRR12917544.sra Written 544876 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra Read 544867 spots for SRR12917544.sra Written 544867 spots for SRR12917544.sra SRR ids: ['SRR12917544.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xbojzj_5 SRR12917544.sra spots: 10897349 blocks: [[1, 544867], [544868, 1089734], [1089735, 1634601], [1634602, 2179468], [2179469, 2724335], [2724336, 3269202], [3269203, 3814069], [3814070, 4358936], [4358937, 4903803], [4903804, 5448670], [5448671, 5993537], [5993538, 6538404], [6538405, 7083271], [7083272, 7628138], [7628139, 8173005], [8173006, 8717872], [8717873, 9262739], [9262740, 9807606], [9807607, 10352473], [10352474, 10897349]] SRR12917544 file size 3681695 SRR12917544 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917544 SRR12917544_1.fastq SRR12917544_2.fastq Input file: SRR12917544_1.fastq Paired file: SRR12917544_2.fastq trimmed: SRR12917544-trimmed-pair1.fastq, SRR12917544-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:36:47 2025 >> started Thu Feb 13 13:36:58 2025 >> done (11.802s) 10897349 read pairs processed; of these: 82 ( 0.00%) short read pairs filtered out after trimming by size control 30302 ( 0.28%) empty read pairs filtered out after trimming by size control 10866965 (99.72%) read pairs available; of these: 2264808 (20.84%) trimmed read pairs available after processing 8602157 (79.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 6 0.00% 21 8 0.00% 22 11 0.00% 23 11 0.00% 24 17 0.00% 25 16 0.00% 26 17 0.00% 27 16 0.00% 28 23 0.00% 29 18 0.00% 30 29 0.00% 31 24 0.00% 32 17 0.00% 33 18 0.00% 34 25 0.00% 35 28 0.00% 36 28 0.00% 37 34 0.00% 38 27 0.00% 39 36 0.00% 40 42 0.00% 41 42 0.00% 42 46 0.00% 43 34 0.00% 44 65 0.00% 45 62 0.00% 46 74 0.00% 47 99 0.00% 48 87 0.00% 49 127 0.00% 50 153 0.00% 51 159 0.00% 52 205 0.00% 53 249 0.00% 54 247 0.00% 55 264 0.00% 56 339 0.00% 57 324 0.00% 58 415 0.00% 59 524 0.00% 60 666 0.01% 61 758 0.01% 62 904 0.01% 63 1071 0.01% 64 1249 0.01% 65 1327 0.01% 66 1585 0.01% 67 1554 0.01% 68 1836 0.02% 69 2007 0.02% 70 2419 0.02% 71 2811 0.03% 72 3262 0.03% 73 3706 0.03% 74 4160 0.04% 75 4590 0.04% 76 5027 0.05% 77 5224 0.05% 78 5825 0.05% 79 6343 0.06% 80 6682 0.06% 81 7291 0.07% 82 8269 0.08% 83 8769 0.08% 84 10011 0.09% 85 10789 0.10% 86 11077 0.10% 87 11559 0.11% 88 11877 0.11% 89 12466 0.11% 90 12596 0.12% 91 13578 0.12% 92 14401 0.13% 93 15277 0.14% 94 16381 0.15% 95 17507 0.16% 96 18656 0.17% 97 19065 0.18% 98 19470 0.18% 99 20265 0.19% 100 20396 0.19% 101 20915 0.19% 102 22278 0.21% 103 22858 0.21% 104 24171 0.22% 105 25524 0.23% 106 26288 0.24% 107 27270 0.25% 108 28209 0.26% 109 28796 0.26% 110 28366 0.26% 111 28942 0.27% 112 29562 0.27% 113 30297 0.28% 114 31956 0.29% 115 32605 0.30% 116 33960 0.31% 117 34500 0.32% 118 35484 0.33% 119 36260 0.33% 120 36021 0.33% 121 36721 0.34% 122 36292 0.33% 123 37450 0.34% 124 38040 0.35% 125 38812 0.36% 126 39816 0.37% 127 40978 0.38% 128 41938 0.39% 129 42298 0.39% 130 42413 0.39% 131 42590 0.39% 132 43467 0.40% 133 43511 0.40% 134 43238 0.40% 135 44419 0.41% 136 44623 0.41% 137 45899 0.42% 138 46577 0.43% 139 47253 0.43% 140 47379 0.44% 141 48252 0.44% 142 48716 0.45% 143 48255 0.44% 144 48613 0.45% 145 49230 0.45% 146 49173 0.45% 147 49175 0.45% 148 49426 0.45% 149 49088 0.45% 150 50223 0.46% 151 8602157 79.16% 10866965 reads passed initial QC criterion=sequence-density sequence-density=1.65 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=23 prefix-density=2.09 prefix-fanout=2.2 sequence=TGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACAAAGATGTCAAAGCTACAGAAGCACTTGCTGTATCGGCAGTTTTTGCATCAAAATTATCGTTAAGGAAGTCTCCGTA criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=23.77 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=5.0 sequence=TTATTTATTTAAGCAAAGTACCCAGCAACGCCACACATATGAAAAACAAGTAAGAGACTGGCCATGACATGGTTGCTGCATTTTTCTTTTGCGCGAGTTGCATTATTTCACTAACAAGGCTTGGCGCAAAAACAGCGGCGGCGGAACCCTTTGCATTCACCACCGGGAAAACCTTCAGTCTTGCACACACTAGCACAGTTGTGGCCTCTTACACATGGTCCTTTAAAACTATGGCTCTGTGACAAACAAACCCTAGCCTCAGCAGGTACCATCATTTCCTGGGAAGCCAGGGCAATGAGCAGCAACAAGAAAAGACCATAGCATTTCTTCTCCATCTCTCTGTCTAACAAGAACCTGTCTAACACTAGCTCTCTGTCTGCAACTACTACTAGTATCTAGC criterion=sequence-density sequence-density=1.38 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=34 prefix-density=1.38 prefix-fanout=2.0 sequence=TACGGAGACTTCCTTAACGATAATTTTGATGCAAAAACTGCCGATACAGCAAGTGCTTCTGTAGCTTTGACATCTTTGTCAAATGAAAAGCTCTTCGTGGTGTTCCAAGGTGTTTCAAATGTAGCTGGTGAAACAAGTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=59.76 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.0 sequence=CTCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTT SRR12917544 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:37:43 Started mapping on | Feb 13 13:37:58 Finished on | Feb 13 13:39:45 Mapping speed, Million of reads per hour | 365.62 Number of input reads | 10866965 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 9728195 Uniquely mapped reads % | 89.52% Average mapped length | 289.18 Number of splices: Total | 7886449 Number of splices: Annotated (sjdb) | 7724578 Number of splices: GT/AG | 7745252 Number of splices: GC/AG | 108752 Number of splices: AT/AC | 9310 Number of splices: Non-canonical | 23135 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.03% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265015 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 149008 % of reads mapped to too many loci | 1.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.40% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 873755 873755 873755 N_multimapping 265015 265015 265015 N_noFeature 235754 9592798 286693 N_ambiguous 136164 566 51389 UnstrandedReadsAssigned:9356277 PositiveStrandReadsAssigned:134831 NegativeStrandReadsAssigned:9390113 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR12917544 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917544-trimmed-pair1.fastq SRR12917544-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,866,965 reads, 9,503,054 reads pseudoaligned [quant] estimated average fragment length: 218.053 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR12917544.ke.tsv 34699 SRR12917544.se.tsv 87100 total ==> SRR12917544.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.95 271 13.1512 Potri.005G024800.1.v4.1 1035 817.947 215 22.9726 Potri.004G059700.1.v4.1 961 743.997 67 7.87046 Potri.007G009000.2.v4.1 1416 1198.95 1 0.0728948 Potri.003G141000.2.v4.1 2943 2725.95 260 8.3359 Potri.016G087400.1.v4.1 270 99.6262 1177 1032.52 Potri.015G069301.1.v4.1 564 353.63 0 0 Potri.010G195200.1.v4.1 1773 1555.95 39 2.19062 Potri.012G127500.1.v4.1 977 759.969 5070 583.053 ==> SRR12917544.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 97 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 207 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 52 SRR12917544 completed mapping pipeline successfully