Starting /dee2/code/volunteer_pipeline.sh SRR12917545 current disk space = 3090688008192 free memory = 1580836640 SRR12917545 SRAfilesize edf0a4b52a079e9b2614a3774722abd0 SRR12917545.sra SRR12917545.sra file validated SRR12917545 is paired end SRR12917545 is conventional basespace SRR12917545 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917545_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6205 37.0 37.0 37.0 37.0 37.0 2 36.43 37.0 37.0 37.0 37.0 37.0 3 36.5765 37.0 37.0 37.0 37.0 37.0 4 36.701 37.0 37.0 37.0 37.0 37.0 5 36.692 37.0 37.0 37.0 37.0 37.0 6 36.6055 37.0 37.0 37.0 37.0 37.0 7 36.5045 37.0 37.0 37.0 37.0 37.0 8 36.5245 37.0 37.0 37.0 37.0 37.0 9 36.5935 37.0 37.0 37.0 37.0 37.0 10-14 36.6203 37.0 37.0 37.0 37.0 37.0 15-19 36.5991 37.0 37.0 37.0 37.0 37.0 20-24 36.5582 37.0 37.0 37.0 37.0 37.0 25-29 36.5553 37.0 37.0 37.0 37.0 37.0 30-34 36.5326 37.0 37.0 37.0 37.0 37.0 35-39 36.500699999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.4981 37.0 37.0 37.0 37.0 37.0 45-49 36.480399999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4413 37.0 37.0 37.0 37.0 37.0 55-59 36.4005 37.0 37.0 37.0 37.0 37.0 60-64 36.3913 37.0 37.0 37.0 37.0 37.0 65-69 36.340700000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3335 37.0 37.0 37.0 37.0 37.0 75-79 36.3561 37.0 37.0 37.0 37.0 37.0 80-84 36.2913 37.0 37.0 37.0 37.0 37.0 85-89 36.269999999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.3325 37.0 37.0 37.0 37.0 37.0 95-99 36.252500000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.1933 37.0 37.0 37.0 37.0 37.0 105-109 36.1592 37.0 37.0 37.0 37.0 37.0 110-114 36.1083 37.0 37.0 37.0 37.0 37.0 115-119 36.085499999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.043400000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.9593 37.0 37.0 37.0 37.0 37.0 130-134 35.903000000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.8104 37.0 37.0 37.0 37.0 37.0 140-144 35.7676 37.0 37.0 37.0 37.0 37.0 145-149 35.5787 37.0 37.0 37.0 37.0 37.0 150-151 35.3835 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 2.0 26 2.0 27 4.0 28 8.0 29 20.0 30 26.0 31 24.0 32 50.0 33 66.0 34 116.0 35 348.0 36 3009.0 37 322.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.675000000000004 12.075 6.625 38.625 2 19.8 11.625 37.15 31.424999999999997 3 16.75 16.3 28.825 38.125 4 21.8 22.7 24.825 30.675 5 24.85 29.15 24.3 21.7 6 20.0 34.050000000000004 23.525 22.425 7 15.875 26.674999999999997 40.65 16.8 8 16.175 26.0 33.900000000000006 23.925 9 16.8 24.425 35.75 23.025000000000002 10-14 19.62 30.585 26.939999999999998 22.855 15-19 20.325 27.615000000000002 27.935 24.125 20-24 19.55 28.93 27.33 24.19 25-29 20.72 29.134999999999998 27.47 22.675 30-34 19.7 28.375 27.685 24.240000000000002 35-39 19.75 29.025000000000002 27.74 23.485 40-44 19.75 28.044999999999998 28.095 24.11 45-49 20.0 28.555000000000003 27.76 23.685000000000002 50-54 20.215 28.765 27.560000000000002 23.46 55-59 20.095 28.88 27.41 23.615 60-64 20.01 28.689999999999998 27.389999999999997 23.91 65-69 20.244999999999997 27.875 28.16 23.72 70-74 20.69 28.055000000000003 27.455000000000002 23.799999999999997 75-79 20.34 28.095 27.825 23.74 80-84 19.86 28.470000000000002 27.915 23.755000000000003 85-89 19.98 28.075 28.13 23.815 90-94 20.5 27.584999999999997 27.755000000000003 24.16 95-99 20.405 27.955000000000002 27.48 24.16 100-104 21.154999999999998 28.804999999999996 27.025 23.015 105-109 20.915 27.6 27.985 23.5 110-114 20.549999999999997 28.735 27.800000000000004 22.915 115-119 20.735 27.875 27.525 23.865 120-124 21.255 28.305000000000003 27.145000000000003 23.294999999999998 125-129 21.135 28.199999999999996 27.195000000000004 23.47 130-134 21.19 28.12 27.355 23.335 135-139 21.025 28.345 27.034999999999997 23.595 140-144 20.945 27.68 26.87 24.505 145-149 20.72 27.595 27.169999999999998 24.515 150-151 20.45 29.312500000000004 26.1 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.0 22 1.5 23 2.0 24 3.0 25 4.5 26 6.0 27 9.5 28 12.0 29 19.5 30 24.0 31 27.5 32 35.0 33 36.5 34 49.0 35 61.0 36 76.5 37 105.0 38 126.5 39 151.0 40 175.5 41 211.5 42 228.5 43 239.0 44 266.5 45 262.5 46 253.0 47 256.5 48 237.5 49 216.5 50 188.5 51 151.0 52 126.5 53 98.0 54 77.5 55 63.0 56 50.0 57 37.0 58 24.5 59 24.5 60 21.5 61 9.5 62 4.5 63 3.0 64 4.0 65 2.5 66 0.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 1.5 73 2.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 91.091558977179 82.825 2 8.001099807533683 14.549999999999999 3 0.769865273577124 2.1 4 0.10998075336816059 0.4 5 0.027495188342040146 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCACATCCCATGGGCCTCCATATCCGGTTTCGTAAAACAAATCAATCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6000000000000001 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.2625 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.7625000000000002 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.6625 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.2249999999999996 0.0 0.0 0.0 0.0 118-119 3.6625 0.0 0.0 0.0 0.0 120-121 4.0625 0.0 0.0 0.0 0.0 122-123 4.4875 0.0 0.0 0.0 0.0 124-125 4.85 0.0 0.0 0.0 0.0 126-127 5.425 0.0 0.0 0.0 0.0 128-129 5.925 0.0 0.0 0.0 0.0 130-131 6.362500000000001 0.0 0.0 0.0 0.0 132-133 6.9375 0.0 0.0 0.0 0.0 134-135 7.5375 0.0 0.0 0.0 0.0 136-137 8.162500000000001 0.0 0.0 0.0 0.0 138-139 8.712499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917545 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917545_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.387 37.0 37.0 37.0 37.0 37.0 2 36.3 37.0 37.0 37.0 37.0 37.0 3 36.297 37.0 37.0 37.0 37.0 37.0 4 36.4375 37.0 37.0 37.0 37.0 37.0 5 36.3755 37.0 37.0 37.0 37.0 37.0 6 36.1825 37.0 37.0 37.0 37.0 37.0 7 36.3045 37.0 37.0 37.0 37.0 37.0 8 36.351 37.0 37.0 37.0 37.0 37.0 9 36.4005 37.0 37.0 37.0 37.0 37.0 10-14 36.3453 37.0 37.0 37.0 37.0 37.0 15-19 36.340700000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.326800000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.2505 37.0 37.0 37.0 37.0 37.0 30-34 36.1562 37.0 37.0 37.0 37.0 37.0 35-39 36.0918 37.0 37.0 37.0 37.0 37.0 40-44 36.126099999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.0022 37.0 37.0 37.0 37.0 37.0 50-54 35.9974 37.0 37.0 37.0 37.0 37.0 55-59 36.025400000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.9966 37.0 37.0 37.0 37.0 37.0 65-69 35.997 37.0 37.0 37.0 37.0 37.0 70-74 35.924699999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.8644 37.0 37.0 37.0 37.0 37.0 80-84 35.9098 37.0 37.0 37.0 37.0 37.0 85-89 35.881899999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.9328 37.0 37.0 37.0 37.0 37.0 95-99 35.867399999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.791999999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.7634 37.0 37.0 37.0 37.0 37.0 110-114 35.7333 37.0 37.0 37.0 37.0 37.0 115-119 35.6881 37.0 37.0 37.0 37.0 37.0 120-124 35.5453 37.0 37.0 37.0 37.0 37.0 125-129 35.5539 37.0 37.0 37.0 37.0 37.0 130-134 35.4535 37.0 37.0 37.0 37.0 37.0 135-139 35.2955 37.0 37.0 37.0 37.0 37.0 140-144 35.269099999999995 37.0 37.0 37.0 34.6 37.0 145-149 35.0267 37.0 37.0 37.0 25.0 37.0 150-151 34.57575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 1.0 17 2.0 18 5.0 19 2.0 20 2.0 21 3.0 22 5.0 23 3.0 24 4.0 25 6.0 26 7.0 27 7.0 28 11.0 29 22.0 30 27.0 31 42.0 32 62.0 33 103.0 34 227.0 35 558.0 36 2684.0 37 214.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.824999999999996 25.174999999999997 9.75 26.25 2 28.475 23.95 30.55 17.025000000000002 3 19.925 28.449999999999996 34.025 17.599999999999998 4 25.124999999999996 32.675 24.099999999999998 18.099999999999998 5 25.85 36.449999999999996 21.05 16.650000000000002 6 20.599999999999998 38.65 22.7 18.05 7 20.525 22.125 38.125 19.225 8 21.025 26.85 28.825 23.3 9 22.125 24.25 30.099999999999998 23.525 10-14 23.075000000000003 28.965000000000003 27.12 20.84 15-19 23.3 27.839999999999996 27.63 21.23 20-24 22.869999999999997 28.804999999999996 27.21 21.115000000000002 25-29 22.814999999999998 28.895 27.735 20.555 30-34 22.905 27.71 27.97 21.415 35-39 22.99 27.99 27.845 21.175 40-44 23.21 28.425 27.025 21.34 45-49 22.305 28.470000000000002 28.299999999999997 20.925 50-54 22.865 27.779999999999998 28.1 21.255 55-59 23.435 27.91 27.13 21.525 60-64 23.150000000000002 28.110000000000003 27.35 21.39 65-69 23.215 28.37 27.534999999999997 20.880000000000003 70-74 23.080000000000002 27.810000000000002 27.655 21.455 75-79 23.585 27.965 27.400000000000002 21.05 80-84 22.884999999999998 28.189999999999998 27.58 21.345 85-89 23.855 28.29 27.139999999999997 20.715 90-94 24.02 28.02 27.07 20.89 95-99 23.395 27.775 27.650000000000002 21.18 100-104 23.535 27.900000000000002 27.235 21.33 105-109 24.375 27.71 27.400000000000002 20.515 110-114 24.36 29.125 26.700000000000003 19.814999999999998 115-119 24.265 27.305 27.415 21.015 120-124 24.68 27.700000000000003 27.375 20.244999999999997 125-129 25.119999999999997 27.675 26.97 20.235 130-134 24.65 28.38 26.93 20.04 135-139 25.2 27.595 26.895000000000003 20.31 140-144 25.240000000000002 28.444999999999997 26.105 20.21 145-149 26.240000000000002 27.884999999999998 26.045 19.830000000000002 150-151 26.137500000000003 27.725 26.8 19.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.5 15 1.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 1.5 23 1.5 24 2.0 25 2.5 26 3.0 27 5.5 28 10.0 29 13.0 30 17.0 31 23.0 32 27.0 33 38.5 34 47.5 35 56.0 36 84.5 37 120.5 38 146.0 39 161.5 40 189.0 41 225.0 42 245.0 43 244.5 44 258.5 45 274.5 46 267.5 47 241.0 48 218.5 49 199.5 50 167.5 51 150.0 52 127.5 53 99.0 54 87.5 55 64.5 56 38.0 57 27.5 58 23.0 59 19.5 60 12.0 61 11.5 62 10.0 63 7.0 64 5.0 65 1.5 66 1.0 67 0.5 68 1.5 69 2.0 70 1.0 71 1.0 72 1.5 73 1.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.36276391554703 83.3 2 7.759802577460927 14.149999999999999 3 0.7403345215245407 2.025 4 0.10967918837400603 0.4 5 0.027419797093501508 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6000000000000001 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.225 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 4.0125 0.0 0.0 0.0 0.0 122-123 4.4375 0.0 0.0 0.0 0.0 124-125 4.775 0.0 0.0 0.0 0.0 126-127 5.375 0.0 0.0 0.0 0.0 128-129 5.9 0.0 0.0 0.0 0.0 130-131 6.35 0.0 0.0 0.0 0.0 132-133 6.9375 0.0 0.0 0.0 0.0 134-135 7.5875 0.0 0.0 0.0 0.0 136-137 8.1875 0.0 0.0 0.0 0.0 138-139 8.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 25 4.977651E-4 29.0 60-64 >>END_MODULE Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra Read 456279 spots for SRR12917545.sra Written 456279 spots for SRR12917545.sra Read 456260 spots for SRR12917545.sra Written 456260 spots for SRR12917545.sra SRR ids: ['SRR12917545.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9oulbb4x SRR12917545.sra spots: 9125219 blocks: [[1, 456260], [456261, 912520], [912521, 1368780], [1368781, 1825040], [1825041, 2281300], [2281301, 2737560], [2737561, 3193820], [3193821, 3650080], [3650081, 4106340], [4106341, 4562600], [4562601, 5018860], [5018861, 5475120], [5475121, 5931380], [5931381, 6387640], [6387641, 6843900], [6843901, 7300160], [7300161, 7756420], [7756421, 8212680], [8212681, 8668940], [8668941, 9125219]] SRR12917545 file size 3081156 SRR12917545 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917545 SRR12917545_1.fastq SRR12917545_2.fastq Input file: SRR12917545_1.fastq Paired file: SRR12917545_2.fastq trimmed: SRR12917545-trimmed-pair1.fastq, SRR12917545-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:35:53 2025 >> started Thu Feb 13 13:36:03 2025 >> done (9.637s) 9125219 read pairs processed; of these: 56 ( 0.00%) short read pairs filtered out after trimming by size control 1710 ( 0.02%) empty read pairs filtered out after trimming by size control 9123453 (99.98%) read pairs available; of these: 1184597 (12.98%) trimmed read pairs available after processing 7938856 (87.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 5 0.00% 21 7 0.00% 22 3 0.00% 23 1 0.00% 24 6 0.00% 25 3 0.00% 26 5 0.00% 27 6 0.00% 28 12 0.00% 29 4 0.00% 30 11 0.00% 31 5 0.00% 32 8 0.00% 33 13 0.00% 34 6 0.00% 35 15 0.00% 36 9 0.00% 37 11 0.00% 38 15 0.00% 39 20 0.00% 40 24 0.00% 41 18 0.00% 42 16 0.00% 43 23 0.00% 44 13 0.00% 45 21 0.00% 46 26 0.00% 47 28 0.00% 48 25 0.00% 49 31 0.00% 50 43 0.00% 51 52 0.00% 52 70 0.00% 53 76 0.00% 54 76 0.00% 55 92 0.00% 56 88 0.00% 57 105 0.00% 58 140 0.00% 59 163 0.00% 60 201 0.00% 61 260 0.00% 62 285 0.00% 63 288 0.00% 64 380 0.00% 65 368 0.00% 66 460 0.01% 67 488 0.01% 68 575 0.01% 69 649 0.01% 70 760 0.01% 71 785 0.01% 72 1000 0.01% 73 1087 0.01% 74 1294 0.01% 75 1389 0.02% 76 1516 0.02% 77 1673 0.02% 78 1796 0.02% 79 2039 0.02% 80 2167 0.02% 81 2395 0.03% 82 2859 0.03% 83 3140 0.03% 84 3531 0.04% 85 3734 0.04% 86 4036 0.04% 87 4262 0.05% 88 4594 0.05% 89 4851 0.05% 90 5025 0.06% 91 5579 0.06% 92 5785 0.06% 93 6199 0.07% 94 6881 0.08% 95 7382 0.08% 96 7748 0.08% 97 8088 0.09% 98 8447 0.09% 99 8773 0.10% 100 8891 0.10% 101 9071 0.10% 102 9730 0.11% 103 10171 0.11% 104 10716 0.12% 105 11338 0.12% 106 12054 0.13% 107 12442 0.14% 108 12769 0.14% 109 13141 0.14% 110 13301 0.15% 111 13959 0.15% 112 14234 0.16% 113 14410 0.16% 114 15053 0.16% 115 15792 0.17% 116 16529 0.18% 117 17552 0.19% 118 17731 0.19% 119 18238 0.20% 120 18459 0.20% 121 18933 0.21% 122 18866 0.21% 123 19775 0.22% 124 20173 0.22% 125 20544 0.23% 126 21755 0.24% 127 22430 0.25% 128 23026 0.25% 129 23343 0.26% 130 23855 0.26% 131 23624 0.26% 132 24104 0.26% 133 24812 0.27% 134 24477 0.27% 135 25674 0.28% 136 26542 0.29% 137 26431 0.29% 138 27312 0.30% 139 28553 0.31% 140 28421 0.31% 141 28802 0.32% 142 28825 0.32% 143 29093 0.32% 144 29429 0.32% 145 29976 0.33% 146 29919 0.33% 147 30713 0.34% 148 31410 0.34% 149 31295 0.34% 150 32833 0.36% 151 7938856 87.02% 9123453 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.62 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=14.36 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=4.3 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=23 prefix-density=0.75 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=58.60 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.4 sequence=ACACAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA SRR12917545 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:36:42 Started mapping on | Feb 13 13:36:42 Finished on | Feb 13 13:37:32 Mapping speed, Million of reads per hour | 656.89 Number of input reads | 9123453 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 8662030 Uniquely mapped reads % | 94.94% Average mapped length | 294.16 Number of splices: Total | 8466145 Number of splices: Annotated (sjdb) | 8293049 Number of splices: GT/AG | 8287678 Number of splices: GC/AG | 147676 Number of splices: AT/AC | 5344 Number of splices: Non-canonical | 25447 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 215772 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 23780 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.34% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 245651 245651 245651 N_multimapping 215772 215772 215772 N_noFeature 284513 8541163 333234 N_ambiguous 132023 536 59582 UnstrandedReadsAssigned:8245494 PositiveStrandReadsAssigned:120331 NegativeStrandReadsAssigned:8269214 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917545 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917545-trimmed-pair1.fastq SRR12917545-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,123,453 reads, 8,307,913 reads pseudoaligned [quant] estimated average fragment length: 250.177 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 953 rounds 52401 SRR12917545.ke.tsv 34699 SRR12917545.se.tsv 87100 total ==> SRR12917545.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.82 216 14.2058 Potri.005G024800.1.v4.1 1035 785.823 108 15.988 Potri.004G059700.1.v4.1 961 712.048 36 5.8815 Potri.007G009000.2.v4.1 1416 1166.82 0 0 Potri.003G141000.2.v4.1 2943 2693.82 348 15.0281 Potri.016G087400.1.v4.1 270 89.1329 566.734 739.667 Potri.015G069301.1.v4.1 564 328.822 0 0 Potri.010G195200.1.v4.1 1773 1523.82 7 0.53439 Potri.012G127500.1.v4.1 977 727.918 94 15.0224 ==> SRR12917545.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 239 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 117 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12917545 completed mapping pipeline successfully