Starting /dee2/code/volunteer_pipeline.sh SRR12917546 current disk space = 3091637198848 free memory = 1449264016 SRR12917546 SRAfilesize 5ad7d5c77d2fd4691ff6324d9b9cec01 SRR12917546.sra SRR12917546.sra file validated SRR12917546 is paired end SRR12917546 is conventional basespace SRR12917546 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917546_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.547 37.0 37.0 37.0 37.0 37.0 2 36.46 37.0 37.0 37.0 37.0 37.0 3 36.5615 37.0 37.0 37.0 37.0 37.0 4 36.728 37.0 37.0 37.0 37.0 37.0 5 36.647 37.0 37.0 37.0 37.0 37.0 6 36.698 37.0 37.0 37.0 37.0 37.0 7 36.5605 37.0 37.0 37.0 37.0 37.0 8 36.597 37.0 37.0 37.0 37.0 37.0 9 36.722 37.0 37.0 37.0 37.0 37.0 10-14 36.626099999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.6177 37.0 37.0 37.0 37.0 37.0 20-24 36.6215 37.0 37.0 37.0 37.0 37.0 25-29 36.5928 37.0 37.0 37.0 37.0 37.0 30-34 36.5423 37.0 37.0 37.0 37.0 37.0 35-39 36.4995 37.0 37.0 37.0 37.0 37.0 40-44 36.50410000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.456599999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.4815 37.0 37.0 37.0 37.0 37.0 55-59 36.44500000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.3742 37.0 37.0 37.0 37.0 37.0 65-69 36.302800000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.2927 37.0 37.0 37.0 37.0 37.0 75-79 36.345299999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.273399999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2675 37.0 37.0 37.0 37.0 37.0 90-94 36.3144 37.0 37.0 37.0 37.0 37.0 95-99 36.2444 37.0 37.0 37.0 37.0 37.0 100-104 36.1025 37.0 37.0 37.0 37.0 37.0 105-109 36.1294 37.0 37.0 37.0 37.0 37.0 110-114 36.135999999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0422 37.0 37.0 37.0 37.0 37.0 120-124 36.089299999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.9396 37.0 37.0 37.0 37.0 37.0 130-134 35.897400000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.8391 37.0 37.0 37.0 37.0 37.0 140-144 35.7286 37.0 37.0 37.0 37.0 37.0 145-149 35.5803 37.0 37.0 37.0 37.0 37.0 150-151 35.438500000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 3.0 25 0.0 26 4.0 27 3.0 28 5.0 29 26.0 30 18.0 31 31.0 32 34.0 33 73.0 34 108.0 35 327.0 36 3086.0 37 280.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.945972986493246 13.631815907953976 4.627313656828414 39.79489744872436 2 18.45 12.275 39.025 30.25 3 16.25 16.875 27.950000000000003 38.925 4 21.575 22.5 23.599999999999998 32.324999999999996 5 23.150000000000002 31.45 25.074999999999996 20.325 6 19.25 33.1 24.175 23.474999999999998 7 13.950000000000001 28.449999999999996 42.325 15.275 8 16.150000000000002 27.3 33.475 23.075000000000003 9 16.900000000000002 23.025000000000002 34.875 25.2 10-14 19.0 30.29 28.349999999999998 22.36 15-19 19.509999999999998 28.52 28.49 23.48 20-24 19.18 29.095 27.905 23.82 25-29 19.525000000000002 28.555000000000003 28.144999999999996 23.775 30-34 19.189999999999998 29.57 27.42 23.82 35-39 19.035 28.754999999999995 28.095 24.115000000000002 40-44 19.915 28.935 27.750000000000004 23.400000000000002 45-49 19.38 28.585 28.235 23.799999999999997 50-54 19.425 28.685 27.625 24.265 55-59 19.48 29.054999999999996 28.09 23.375 60-64 19.345000000000002 28.975 28.050000000000004 23.630000000000003 65-69 19.59 28.48 28.465 23.465 70-74 20.085 28.255000000000003 28.199999999999996 23.46 75-79 20.355 28.95 27.224999999999998 23.47 80-84 19.3 28.87 28.525 23.305 85-89 20.380000000000003 29.225 27.284999999999997 23.11 90-94 20.19 28.59 27.875 23.345 95-99 20.185 28.715000000000003 27.6 23.5 100-104 20.325 28.560000000000002 27.560000000000002 23.555 105-109 20.06 29.235 27.685 23.02 110-114 20.244999999999997 28.895 27.605 23.255 115-119 20.305 28.54 27.505000000000003 23.65 120-124 20.39 29.115000000000002 27.045 23.45 125-129 20.46 29.455 26.805 23.28 130-134 20.26 29.195 27.384999999999998 23.16 135-139 20.39 28.87 27.339999999999996 23.400000000000002 140-144 20.845 29.044999999999998 26.68 23.43 145-149 21.035 28.395 27.139999999999997 23.43 150-151 21.1125 27.500000000000004 27.6375 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 1.0 23 2.5 24 3.0 25 3.0 26 2.5 27 5.0 28 12.5 29 22.0 30 25.5 31 29.5 32 32.0 33 47.0 34 70.5 35 82.5 36 97.0 37 121.5 38 150.5 39 165.0 40 190.5 41 231.5 42 260.5 43 258.5 44 250.5 45 275.0 46 277.0 47 244.5 48 216.5 49 192.5 50 165.0 51 125.0 52 87.0 53 71.5 54 66.5 55 55.5 56 39.0 57 25.5 58 17.0 59 14.5 60 13.0 61 9.0 62 10.0 63 9.0 64 5.0 65 3.0 66 2.5 67 1.5 68 1.0 69 1.5 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.275 #Duplication Level Percentage of deduplicated Percentage of total 1 90.58432567155913 81.77499999999999 2 8.224868457491 14.85 3 1.0523400720022156 2.85 4 0.11077263915812793 0.4 5 0.027693159789531983 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCAACATCACACAGCCTAACACTACAACCCACGAACCTATCTATCTACTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.11249999999999999 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.4500000000000002 0.0 0.0 0.0 0.0 102-103 1.5750000000000002 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.9874999999999998 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.2249999999999996 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 3.7750000000000004 0.0 0.0 0.0 0.0 124-125 4.125 0.0 0.0 0.0 0.0 126-127 4.6 0.0 0.0 0.0 0.0 128-129 4.9625 0.0 0.0 0.0 0.0 130-131 5.35 0.0 0.0 0.0 0.0 132-133 5.7875 0.0 0.0 0.0 0.0 134-135 6.375 0.0 0.0 0.0 0.0 136-137 6.775 0.0 0.0 0.0 0.0 138-139 7.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917546 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917546_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46325 37.0 37.0 37.0 37.0 37.0 2 36.1975 37.0 37.0 37.0 37.0 37.0 3 36.3055 37.0 37.0 37.0 37.0 37.0 4 36.4 37.0 37.0 37.0 37.0 37.0 5 36.346 37.0 37.0 37.0 37.0 37.0 6 36.398 37.0 37.0 37.0 37.0 37.0 7 36.343 37.0 37.0 37.0 37.0 37.0 8 36.3925 37.0 37.0 37.0 37.0 37.0 9 36.3295 37.0 37.0 37.0 37.0 37.0 10-14 36.3728 37.0 37.0 37.0 37.0 37.0 15-19 36.3835 37.0 37.0 37.0 37.0 37.0 20-24 36.293200000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.2362 37.0 37.0 37.0 37.0 37.0 30-34 36.135 37.0 37.0 37.0 37.0 37.0 35-39 36.178700000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.1361 37.0 37.0 37.0 37.0 37.0 45-49 36.075500000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.0614 37.0 37.0 37.0 37.0 37.0 55-59 36.0846 37.0 37.0 37.0 37.0 37.0 60-64 36.0135 37.0 37.0 37.0 37.0 37.0 65-69 35.974000000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9623 37.0 37.0 37.0 37.0 37.0 75-79 35.8537 37.0 37.0 37.0 37.0 37.0 80-84 35.974799999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.9941 37.0 37.0 37.0 37.0 37.0 90-94 35.941199999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8904 37.0 37.0 37.0 37.0 37.0 100-104 35.863 37.0 37.0 37.0 37.0 37.0 105-109 35.8893 37.0 37.0 37.0 37.0 37.0 110-114 35.8287 37.0 37.0 37.0 37.0 37.0 115-119 35.75279999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.6452 37.0 37.0 37.0 37.0 37.0 125-129 35.5979 37.0 37.0 37.0 37.0 37.0 130-134 35.45440000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.4678 37.0 37.0 37.0 37.0 37.0 140-144 35.249900000000004 37.0 37.0 37.0 34.6 37.0 145-149 35.1064 37.0 37.0 37.0 25.0 37.0 150-151 34.496 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 1.0 15 0.0 16 0.0 17 3.0 18 1.0 19 0.0 20 0.0 21 3.0 22 2.0 23 9.0 24 7.0 25 7.0 26 5.0 27 3.0 28 12.0 29 13.0 30 31.0 31 38.0 32 57.0 33 97.0 34 208.0 35 600.0 36 2702.0 37 198.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.584646161540384 25.256314078519633 9.227306826706677 26.93173293323331 2 26.174999999999997 24.75 33.025 16.05 3 17.925 27.450000000000003 37.25 17.375 4 23.400000000000002 32.2 25.55 18.85 5 26.400000000000002 36.7 21.425 15.475 6 19.475 40.475 22.75 17.299999999999997 7 20.8 22.325 39.775 17.1 8 19.575 26.8 29.525000000000002 24.099999999999998 9 21.875 24.25 31.15 22.725 10-14 22.68 29.134999999999998 27.27 20.915 15-19 22.869999999999997 27.689999999999998 29.035 20.405 20-24 23.06 28.565 28.035 20.34 25-29 22.96 27.96 28.499999999999996 20.580000000000002 30-34 22.905 27.800000000000004 28.825 20.47 35-39 22.74 28.32 28.575 20.365 40-44 23.05 27.939999999999998 28.494999999999997 20.515 45-49 22.79 26.96 29.304999999999996 20.945 50-54 23.16 28.28 28.07 20.49 55-59 23.23 28.075 28.175 20.52 60-64 23.674999999999997 28.42 27.98 19.925 65-69 23.465 28.16 28.050000000000004 20.325 70-74 23.805 27.77 28.285 20.14 75-79 23.26 28.02 28.660000000000004 20.06 80-84 23.24 27.834999999999997 28.405 20.52 85-89 23.7 27.955000000000002 28.565 19.78 90-94 23.465 28.655 27.72 20.16 95-99 23.51 27.744999999999997 28.055000000000003 20.69 100-104 24.32 27.839999999999996 28.125 19.715 105-109 23.915 28.449999999999996 27.415 20.22 110-114 23.49 28.54 27.57 20.4 115-119 23.77 28.345 28.005000000000003 19.88 120-124 24.169999999999998 28.134999999999998 28.425 19.27 125-129 25.0 28.015 27.279999999999998 19.705000000000002 130-134 24.535 27.905 28.22 19.34 135-139 25.430000000000003 27.22 27.944999999999997 19.405 140-144 25.540000000000003 27.91 27.425 19.125 145-149 26.35 27.63 27.26 18.759999999999998 150-151 26.437500000000004 28.0625 26.687499999999996 18.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 1.0 15 1.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.0 21 3.0 22 3.5 23 1.0 24 5.0 25 7.5 26 7.0 27 5.0 28 6.0 29 14.5 30 23.0 31 24.5 32 32.5 33 49.5 34 60.0 35 73.5 36 101.0 37 120.0 38 129.5 39 161.0 40 221.5 41 260.5 42 272.5 43 280.5 44 276.0 45 287.5 46 267.0 47 232.5 48 212.0 49 181.0 50 149.0 51 117.0 52 89.5 53 62.5 54 55.0 55 50.5 56 34.0 57 24.5 58 18.5 59 13.5 60 10.5 61 6.0 62 6.5 63 4.5 64 5.0 65 6.5 66 3.5 67 2.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.00937672366244 82.5 2 7.859900717043574 14.249999999999998 3 0.9928295642581356 2.7 4 0.11031439602868175 0.4 5 0.0 0.0 6 0.027578599007170437 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.11249999999999999 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 2.0125 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.0375 0.0 0.0 0.0 0.0 118-119 3.2750000000000004 0.0 0.0 0.0 0.0 120-121 3.575 0.0 0.0 0.0 0.0 122-123 3.8 0.0 0.0 0.0 0.0 124-125 4.15 0.0 0.0 0.0 0.0 126-127 4.625 0.0 0.0 0.0 0.0 128-129 4.987500000000001 0.0 0.0 0.0 0.0 130-131 5.3875 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.425000000000001 0.0 0.0 0.0 0.0 136-137 6.825 0.0 0.0 0.0 0.0 138-139 7.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 60 0.004491891 14.500001 70-74 >>END_MODULE Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629204 spots for SRR12917546.sra Written 629204 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra Read 629198 spots for SRR12917546.sra Written 629198 spots for SRR12917546.sra SRR ids: ['SRR12917546.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s07t45d0 SRR12917546.sra spots: 12583966 blocks: [[1, 629198], [629199, 1258396], [1258397, 1887594], [1887595, 2516792], [2516793, 3145990], [3145991, 3775188], [3775189, 4404386], [4404387, 5033584], [5033585, 5662782], [5662783, 6291980], [6291981, 6921178], [6921179, 7550376], [7550377, 8179574], [8179575, 8808772], [8808773, 9437970], [9437971, 10067168], [10067169, 10696366], [10696367, 11325564], [11325565, 11954762], [11954763, 12583966]] SRR12917546 file size 4254881 SRR12917546 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917546 SRR12917546_1.fastq SRR12917546_2.fastq Input file: SRR12917546_1.fastq Paired file: SRR12917546_2.fastq trimmed: SRR12917546-trimmed-pair1.fastq, SRR12917546-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 12:48:49 2025 >> started Thu Feb 13 12:49:03 2025 >> done (13.755s) 12583966 read pairs processed; of these: 117 ( 0.00%) short read pairs filtered out after trimming by size control 1765 ( 0.01%) empty read pairs filtered out after trimming by size control 12582084 (99.99%) read pairs available; of these: 1420554 (11.29%) trimmed read pairs available after processing 11161530 (88.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 11 0.00% 20 7 0.00% 21 10 0.00% 22 9 0.00% 23 11 0.00% 24 13 0.00% 25 17 0.00% 26 12 0.00% 27 9 0.00% 28 16 0.00% 29 9 0.00% 30 13 0.00% 31 17 0.00% 32 24 0.00% 33 17 0.00% 34 27 0.00% 35 30 0.00% 36 19 0.00% 37 22 0.00% 38 30 0.00% 39 28 0.00% 40 25 0.00% 41 30 0.00% 42 26 0.00% 43 27 0.00% 44 47 0.00% 45 32 0.00% 46 53 0.00% 47 43 0.00% 48 54 0.00% 49 57 0.00% 50 98 0.00% 51 90 0.00% 52 106 0.00% 53 110 0.00% 54 108 0.00% 55 109 0.00% 56 149 0.00% 57 157 0.00% 58 167 0.00% 59 232 0.00% 60 261 0.00% 61 311 0.00% 62 369 0.00% 63 390 0.00% 64 440 0.00% 65 512 0.00% 66 570 0.00% 67 614 0.00% 68 668 0.01% 69 786 0.01% 70 889 0.01% 71 1007 0.01% 72 1205 0.01% 73 1454 0.01% 74 1576 0.01% 75 1765 0.01% 76 1887 0.01% 77 2075 0.02% 78 2190 0.02% 79 2339 0.02% 80 2682 0.02% 81 2920 0.02% 82 3263 0.03% 83 3674 0.03% 84 4042 0.03% 85 4430 0.04% 86 4633 0.04% 87 5073 0.04% 88 5280 0.04% 89 5673 0.05% 90 5985 0.05% 91 6460 0.05% 92 6714 0.05% 93 7229 0.06% 94 7810 0.06% 95 8117 0.06% 96 8948 0.07% 97 9385 0.07% 98 9654 0.08% 99 9987 0.08% 100 10177 0.08% 101 10704 0.09% 102 11254 0.09% 103 11872 0.09% 104 12424 0.10% 105 13048 0.10% 106 14092 0.11% 107 14383 0.11% 108 14629 0.12% 109 15474 0.12% 110 15603 0.12% 111 15963 0.13% 112 16220 0.13% 113 16916 0.13% 114 18033 0.14% 115 18326 0.15% 116 19266 0.15% 117 19852 0.16% 118 20469 0.16% 119 21309 0.17% 120 21745 0.17% 121 22263 0.18% 122 22523 0.18% 123 22693 0.18% 124 23553 0.19% 125 24587 0.20% 126 25599 0.20% 127 26567 0.21% 128 27372 0.22% 129 27715 0.22% 130 28524 0.23% 131 28298 0.22% 132 29354 0.23% 133 29649 0.24% 134 29477 0.23% 135 30934 0.25% 136 31835 0.25% 137 32985 0.26% 138 34086 0.27% 139 34371 0.27% 140 34952 0.28% 141 35841 0.28% 142 35896 0.29% 143 35983 0.29% 144 36439 0.29% 145 37069 0.29% 146 37248 0.30% 147 38116 0.30% 148 38905 0.31% 149 39647 0.32% 150 40972 0.33% 151 11161530 88.71% 12582084 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=7.51 fanout-score-rank=18 prefix-density=0.33 prefix-fanout=4.0 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=458.96 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=35.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=38 prefix-density=0.17 prefix-fanout=2.4 sequence=TTAGCAGAAAATGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=641.39 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=10.1 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAACTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGA SRR12917546 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 12:49:47 Started mapping on | Feb 13 12:49:48 Finished on | Feb 13 12:51:10 Mapping speed, Million of reads per hour | 552.38 Number of input reads | 12582084 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11845793 Uniquely mapped reads % | 94.15% Average mapped length | 295.01 Number of splices: Total | 10920901 Number of splices: Annotated (sjdb) | 10658481 Number of splices: GT/AG | 10717314 Number of splices: GC/AG | 157544 Number of splices: AT/AC | 10995 Number of splices: Non-canonical | 35048 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.05 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300094 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 45322 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 436197 436197 436197 N_multimapping 300094 300094 300094 N_noFeature 549283 11701658 620662 N_ambiguous 149981 718 76812 UnstrandedReadsAssigned:11146529 PositiveStrandReadsAssigned:143417 NegativeStrandReadsAssigned:11148319 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917546 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917546-trimmed-pair1.fastq SRR12917546-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,582,084 reads, 11,196,728 reads pseudoaligned [quant] estimated average fragment length: 255.777 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR12917546.ke.tsv 34699 SRR12917546.se.tsv 87100 total ==> SRR12917546.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.22 324 17.9847 Potri.005G024800.1.v4.1 1035 780.223 89 11.1645 Potri.004G059700.1.v4.1 961 706.414 4 0.554201 Potri.007G009000.2.v4.1 1416 1161.22 0 0 Potri.003G141000.2.v4.1 2943 2688.22 519.459 18.9127 Potri.016G087400.1.v4.1 270 86.2962 1613.51 1829.99 Potri.015G069301.1.v4.1 564 324.207 0 0 Potri.010G195200.1.v4.1 1773 1518.22 118 7.60699 Potri.012G127500.1.v4.1 977 722.336 5037 682.495 ==> SRR12917546.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 77 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 155 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12917546 completed mapping pipeline successfully