Starting /dee2/code/volunteer_pipeline.sh SRR12917547 current disk space = 3090452201472 free memory = 1581358172 SRR12917547 SRAfilesize f8147c02317b94312772e1a4e3c7b617 SRR12917547.sra SRR12917547.sra file validated SRR12917547 is paired end SRR12917547 is conventional basespace SRR12917547 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917547_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.568 37.0 37.0 37.0 37.0 37.0 2 36.445 37.0 37.0 37.0 37.0 37.0 3 36.569 37.0 37.0 37.0 37.0 37.0 4 36.585 37.0 37.0 37.0 37.0 37.0 5 36.602 37.0 37.0 37.0 37.0 37.0 6 36.567 37.0 37.0 37.0 37.0 37.0 7 36.546 37.0 37.0 37.0 37.0 37.0 8 36.6015 37.0 37.0 37.0 37.0 37.0 9 36.592 37.0 37.0 37.0 37.0 37.0 10-14 36.5752 37.0 37.0 37.0 37.0 37.0 15-19 36.5526 37.0 37.0 37.0 37.0 37.0 20-24 36.5702 37.0 37.0 37.0 37.0 37.0 25-29 36.4885 37.0 37.0 37.0 37.0 37.0 30-34 36.4233 37.0 37.0 37.0 37.0 37.0 35-39 36.4653 37.0 37.0 37.0 37.0 37.0 40-44 36.4251 37.0 37.0 37.0 37.0 37.0 45-49 36.3775 37.0 37.0 37.0 37.0 37.0 50-54 36.4349 37.0 37.0 37.0 37.0 37.0 55-59 36.3294 37.0 37.0 37.0 37.0 37.0 60-64 36.3677 37.0 37.0 37.0 37.0 37.0 65-69 36.2576 37.0 37.0 37.0 37.0 37.0 70-74 36.2586 37.0 37.0 37.0 37.0 37.0 75-79 36.247 37.0 37.0 37.0 37.0 37.0 80-84 36.225 37.0 37.0 37.0 37.0 37.0 85-89 36.230500000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.2457 37.0 37.0 37.0 37.0 37.0 95-99 36.1685 37.0 37.0 37.0 37.0 37.0 100-104 36.1809 37.0 37.0 37.0 37.0 37.0 105-109 36.0641 37.0 37.0 37.0 37.0 37.0 110-114 36.0584 37.0 37.0 37.0 37.0 37.0 115-119 36.039300000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0707 37.0 37.0 37.0 37.0 37.0 125-129 35.932100000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.8367 37.0 37.0 37.0 37.0 37.0 135-139 35.8247 37.0 37.0 37.0 37.0 37.0 140-144 35.6364 37.0 37.0 37.0 37.0 37.0 145-149 35.481899999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.19725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 1.0 22 0.0 23 2.0 24 1.0 25 3.0 26 4.0 27 4.0 28 15.0 29 22.0 30 32.0 31 28.0 32 48.0 33 79.0 34 115.0 35 315.0 36 3018.0 37 310.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.65 11.85 5.800000000000001 32.7 2 20.25 11.575000000000001 37.675 30.5 3 17.65 17.75 28.875 35.725 4 22.35 24.55 24.3 28.799999999999997 5 22.650000000000002 33.1 24.3 19.950000000000003 6 19.5 34.375 23.875 22.25 7 15.075 28.349999999999998 40.8 15.775 8 15.85 26.400000000000002 34.150000000000006 23.599999999999998 9 17.375 23.400000000000002 34.8 24.425 10-14 19.735 30.98 26.825 22.46 15-19 20.28 28.48 27.744999999999997 23.494999999999997 20-24 19.935 28.785 27.73 23.549999999999997 25-29 19.355 29.085 27.48 24.08 30-34 19.439999999999998 28.610000000000003 27.855 24.095 35-39 20.13 28.215 27.935 23.72 40-44 20.21 29.165000000000003 27.450000000000003 23.175 45-49 19.814999999999998 29.365000000000002 27.345000000000002 23.474999999999998 50-54 20.46 28.625 26.950000000000003 23.965 55-59 20.330000000000002 28.749999999999996 27.685 23.235 60-64 19.55 28.835 27.900000000000002 23.715 65-69 20.23 28.575 27.63 23.565 70-74 19.895 28.4 27.639999999999997 24.065 75-79 19.794999999999998 28.32 28.015 23.87 80-84 20.435 28.49 27.345000000000002 23.73 85-89 19.869999999999997 28.92 28.09 23.119999999999997 90-94 20.525 28.67 27.065 23.74 95-99 20.275000000000002 28.64 27.61 23.474999999999998 100-104 20.755000000000003 28.9 26.979999999999997 23.365 105-109 20.645 28.46 27.3 23.595 110-114 21.035 28.055000000000003 27.05 23.86 115-119 21.22 28.265 27.525 22.99 120-124 20.91 28.310000000000002 27.195000000000004 23.585 125-129 20.78 28.765 26.625 23.830000000000002 130-134 20.880000000000003 28.705000000000002 26.495 23.919999999999998 135-139 21.075 29.104999999999997 26.22 23.599999999999998 140-144 21.385 27.485 26.5 24.63 145-149 21.47 28.405 26.275 23.849999999999998 150-151 20.5625 28.962500000000002 26.4125 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 1.0 20 0.5 21 3.0 22 3.5 23 3.0 24 5.5 25 6.0 26 5.5 27 10.0 28 12.5 29 14.0 30 18.5 31 25.5 32 44.0 33 56.5 34 58.5 35 65.5 36 72.5 37 100.0 38 135.5 39 173.5 40 205.0 41 210.5 42 215.0 43 234.5 44 256.0 45 263.5 46 242.5 47 236.0 48 239.0 49 217.5 50 202.5 51 155.5 52 108.5 53 89.5 54 79.5 55 61.0 56 37.5 57 36.5 58 28.5 59 21.0 60 19.5 61 10.0 62 4.5 63 2.0 64 2.0 65 3.0 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.04918032786885 84.22500000000001 2 6.857923497267759 12.55 3 0.9016393442622952 2.475 4 0.16393442622950818 0.6 5 0.0 0.0 6 0.0273224043715847 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCTAAGATGTTTGCAATTACATTCCTGCATATATCGAAATATCGACTC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.1124999999999998 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.6749999999999998 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.0375 0.0 0.0 0.0 0.0 108-109 2.2875 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.9 0.0 0.0 0.0 0.0 114-115 3.3125 0.0 0.0 0.0 0.0 116-117 3.825 0.0 0.0 0.0 0.0 118-119 4.237500000000001 0.0 0.0 0.0 0.0 120-121 4.7875 0.0 0.0 0.0 0.0 122-123 5.275 0.0 0.0 0.0 0.0 124-125 5.8875 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 7.0625 0.0 0.0 0.0 0.0 130-131 7.5875 0.0 0.0 0.0 0.0 132-133 8.1375 0.0 0.0 0.0 0.0 134-135 8.6125 0.0 0.0 0.0 0.0 136-137 9.125 0.0 0.0 0.0 0.0 138-139 9.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTCTT 10 0.006830828 145.0 4 GGGAGGC 10 0.006830828 145.0 3 >>END_MODULE SRR12917547 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917547_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.328 37.0 37.0 37.0 37.0 37.0 2 36.198 37.0 37.0 37.0 37.0 37.0 3 36.1185 37.0 37.0 37.0 37.0 37.0 4 36.194 37.0 37.0 37.0 37.0 37.0 5 36.3215 37.0 37.0 37.0 37.0 37.0 6 36.2275 37.0 37.0 37.0 37.0 37.0 7 36.2595 37.0 37.0 37.0 37.0 37.0 8 36.348 37.0 37.0 37.0 37.0 37.0 9 36.3445 37.0 37.0 37.0 37.0 37.0 10-14 36.334199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2684 37.0 37.0 37.0 37.0 37.0 20-24 36.2789 37.0 37.0 37.0 37.0 37.0 25-29 36.193200000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.1051 37.0 37.0 37.0 37.0 37.0 35-39 36.0531 37.0 37.0 37.0 37.0 37.0 40-44 36.02329999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.007799999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.912699999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.8711 37.0 37.0 37.0 37.0 37.0 60-64 35.9351 37.0 37.0 37.0 37.0 37.0 65-69 35.9245 37.0 37.0 37.0 37.0 37.0 70-74 35.9028 37.0 37.0 37.0 37.0 37.0 75-79 35.7687 37.0 37.0 37.0 37.0 37.0 80-84 35.818200000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.834799999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.8237 37.0 37.0 37.0 37.0 37.0 95-99 35.8099 37.0 37.0 37.0 37.0 37.0 100-104 35.762 37.0 37.0 37.0 37.0 37.0 105-109 35.6572 37.0 37.0 37.0 37.0 37.0 110-114 35.6135 37.0 37.0 37.0 37.0 37.0 115-119 35.6371 37.0 37.0 37.0 37.0 37.0 120-124 35.47239999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.494299999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.3584 37.0 37.0 37.0 34.6 37.0 135-139 35.269000000000005 37.0 37.0 37.0 34.6 37.0 140-144 35.0993 37.0 37.0 37.0 27.4 37.0 145-149 35.0162 37.0 37.0 37.0 25.0 37.0 150-151 34.44225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 1.0 16 4.0 17 1.0 18 1.0 19 5.0 20 5.0 21 4.0 22 11.0 23 9.0 24 5.0 25 6.0 26 6.0 27 9.0 28 18.0 29 16.0 30 30.0 31 37.0 32 55.0 33 88.0 34 204.0 35 591.0 36 2696.0 37 193.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.15 24.5 9.675 20.674999999999997 2 29.9 23.1 30.975 16.025 3 21.175 27.725 33.5 17.599999999999998 4 23.775 35.0 23.0 18.224999999999998 5 25.825 37.775 20.175 16.225 6 21.075 39.074999999999996 21.5 18.35 7 21.475 22.475 37.125 18.925 8 20.674999999999997 25.7 29.825000000000003 23.799999999999997 9 22.650000000000002 23.3 30.0 24.05 10-14 23.555 29.425 26.875 20.145 15-19 22.955000000000002 27.72 28.16 21.165 20-24 23.7 28.689999999999998 27.005000000000003 20.605 25-29 23.145 28.29 27.49 21.075 30-34 23.355 28.605000000000004 27.24 20.8 35-39 23.66 28.605000000000004 26.810000000000002 20.925 40-44 23.46 28.215 27.694999999999997 20.630000000000003 45-49 23.64 27.689999999999998 27.465 21.205 50-54 22.470000000000002 28.43 27.965 21.135 55-59 23.16 27.200000000000003 28.34 21.3 60-64 22.98 27.744999999999997 28.15 21.125 65-69 22.895 27.884999999999998 28.299999999999997 20.919999999999998 70-74 24.08 27.155 27.474999999999998 21.29 75-79 24.59 28.384999999999998 26.555 20.47 80-84 23.935000000000002 28.155 26.950000000000003 20.96 85-89 23.54 27.735 27.794999999999998 20.93 90-94 23.385 28.02 26.924999999999997 21.67 95-99 23.415 28.415000000000003 27.175 20.995 100-104 24.55 27.655 27.33 20.465 105-109 23.669999999999998 28.050000000000004 27.79 20.49 110-114 24.279999999999998 28.275 27.534999999999997 19.91 115-119 24.685000000000002 28.025 27.115000000000002 20.175 120-124 24.64 28.235 27.650000000000002 19.475 125-129 24.884999999999998 28.15 26.69 20.275000000000002 130-134 25.52 28.415000000000003 26.405 19.66 135-139 25.314999999999998 27.66 26.935 20.09 140-144 25.715 27.975 26.56 19.75 145-149 26.55 28.050000000000004 25.895000000000003 19.505 150-151 27.3625 28.0875 25.387500000000003 19.162499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 1.5 14 1.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 2.0 24 4.5 25 4.0 26 4.0 27 6.0 28 7.0 29 10.0 30 12.5 31 21.0 32 31.5 33 41.0 34 50.5 35 58.5 36 71.0 37 100.0 38 135.0 39 159.0 40 192.0 41 230.0 42 252.5 43 268.0 44 266.5 45 253.0 46 264.0 47 265.0 48 239.0 49 203.0 50 165.5 51 142.0 52 110.5 53 88.5 54 82.0 55 59.5 56 47.5 57 38.5 58 22.0 59 15.0 60 9.0 61 10.0 62 11.0 63 4.5 64 4.0 65 4.0 66 0.5 67 0.0 68 1.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.5 91 1.0 92 0.0 93 0.5 94 0.5 95 0.0 96 1.0 97 2.0 98 1.0 99 1.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 92.37079573420837 84.45 2 6.562756357670222 12.0 3 0.8750341810226961 2.4 4 0.10937927262783702 0.4 5 0.0 0.0 6 0.027344818156959255 0.15 7 0.027344818156959255 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.027344818156959255 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit TTATTCCTTTCAGCTGCGTCTTAGAGAGAAATCTTGCTGATATGCTACCT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.1124999999999998 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.7000000000000002 0.0 0.0 0.0 0.0 104-105 1.925 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.3375 0.0 0.0 0.0 0.0 110-111 2.7125 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.3625 0.0 0.0 0.0 0.0 116-117 3.875 0.0 0.0 0.0 0.0 118-119 4.3125 0.0 0.0 0.0 0.0 120-121 4.8625 0.0 0.0 0.0 0.0 122-123 5.35 0.0 0.0 0.0 0.0 124-125 5.9625 0.0 0.0 0.0 0.0 126-127 6.487500000000001 0.0 0.0 0.0 0.0 128-129 7.1625 0.0 0.0 0.0 0.0 130-131 7.6875 0.0 0.0 0.0 0.0 132-133 8.2375 0.0 0.0 0.0 0.0 134-135 8.712499999999999 0.0 0.0 0.0 0.0 136-137 9.1875 0.0 0.0 0.0 0.0 138-139 9.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAAGG 10 0.006830828 145.0 6 TTACTAC 10 0.006830828 145.0 9 GATGCAC 10 0.006830828 145.0 1 >>END_MODULE Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451340 spots for SRR12917547.sra Written 451340 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra Read 451331 spots for SRR12917547.sra Written 451331 spots for SRR12917547.sra SRR ids: ['SRR12917547.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1tb4pdg9 SRR12917547.sra spots: 9026629 blocks: [[1, 451331], [451332, 902662], [902663, 1353993], [1353994, 1805324], [1805325, 2256655], [2256656, 2707986], [2707987, 3159317], [3159318, 3610648], [3610649, 4061979], [4061980, 4513310], [4513311, 4964641], [4964642, 5415972], [5415973, 5867303], [5867304, 6318634], [6318635, 6769965], [6769966, 7221296], [7221297, 7672627], [7672628, 8123958], [8123959, 8575289], [8575290, 9026629]] SRR12917547 file size 3047844 SRR12917547 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917547 SRR12917547_1.fastq SRR12917547_2.fastq Input file: SRR12917547_1.fastq Paired file: SRR12917547_2.fastq trimmed: SRR12917547-trimmed-pair1.fastq, SRR12917547-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:46:39 2025 >> started Thu Feb 13 13:46:49 2025 >> done (9.401s) 9026629 read pairs processed; of these: 113 ( 0.00%) short read pairs filtered out after trimming by size control 1061 ( 0.01%) empty read pairs filtered out after trimming by size control 9025455 (99.99%) read pairs available; of these: 1339989 (14.85%) trimmed read pairs available after processing 7685466 (85.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 9 0.00% 21 9 0.00% 22 14 0.00% 23 12 0.00% 24 14 0.00% 25 8 0.00% 26 11 0.00% 27 9 0.00% 28 17 0.00% 29 16 0.00% 30 23 0.00% 31 20 0.00% 32 18 0.00% 33 10 0.00% 34 20 0.00% 35 18 0.00% 36 20 0.00% 37 26 0.00% 38 19 0.00% 39 24 0.00% 40 16 0.00% 41 21 0.00% 42 30 0.00% 43 25 0.00% 44 21 0.00% 45 20 0.00% 46 24 0.00% 47 33 0.00% 48 31 0.00% 49 40 0.00% 50 68 0.00% 51 69 0.00% 52 66 0.00% 53 80 0.00% 54 93 0.00% 55 103 0.00% 56 103 0.00% 57 120 0.00% 58 133 0.00% 59 193 0.00% 60 214 0.00% 61 234 0.00% 62 247 0.00% 63 302 0.00% 64 341 0.00% 65 361 0.00% 66 446 0.00% 67 493 0.01% 68 523 0.01% 69 632 0.01% 70 693 0.01% 71 790 0.01% 72 1066 0.01% 73 1123 0.01% 74 1300 0.01% 75 1433 0.02% 76 1566 0.02% 77 1673 0.02% 78 1864 0.02% 79 2143 0.02% 80 2287 0.03% 81 2604 0.03% 82 3138 0.03% 83 3314 0.04% 84 3730 0.04% 85 4053 0.04% 86 4356 0.05% 87 4709 0.05% 88 5010 0.06% 89 5151 0.06% 90 5619 0.06% 91 6261 0.07% 92 6693 0.07% 93 7291 0.08% 94 7936 0.09% 95 8421 0.09% 96 8971 0.10% 97 9199 0.10% 98 9451 0.10% 99 10105 0.11% 100 10525 0.12% 101 10831 0.12% 102 11653 0.13% 103 12270 0.14% 104 12794 0.14% 105 13595 0.15% 106 13827 0.15% 107 14599 0.16% 108 14990 0.17% 109 15349 0.17% 110 15359 0.17% 111 16214 0.18% 112 16685 0.18% 113 17123 0.19% 114 18115 0.20% 115 18760 0.21% 116 19955 0.22% 117 19987 0.22% 118 20721 0.23% 119 20801 0.23% 120 21237 0.24% 121 21814 0.24% 122 22153 0.25% 123 22674 0.25% 124 23837 0.26% 125 24169 0.27% 126 25462 0.28% 127 25146 0.28% 128 25766 0.29% 129 26642 0.30% 130 26688 0.30% 131 26530 0.29% 132 27337 0.30% 133 27826 0.31% 134 28041 0.31% 135 29149 0.32% 136 29378 0.33% 137 29729 0.33% 138 30124 0.33% 139 31003 0.34% 140 31391 0.35% 141 31405 0.35% 142 31701 0.35% 143 32179 0.36% 144 33015 0.37% 145 33332 0.37% 146 33748 0.37% 147 33753 0.37% 148 34147 0.38% 149 34116 0.38% 150 34981 0.39% 151 7685466 85.15% 9025455 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=18 prefix-density=0.68 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=17.23 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=3.4 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGG criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=21 prefix-density=0.77 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.19 sequence-density-rank=19 fanout-score=13.77 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=5.2 sequence=AGCAATGGCAGC SRR12917547 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:47:32 Started mapping on | Feb 13 13:47:32 Finished on | Feb 13 13:48:33 Mapping speed, Million of reads per hour | 532.65 Number of input reads | 9025455 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 8412053 Uniquely mapped reads % | 93.20% Average mapped length | 292.80 Number of splices: Total | 8323811 Number of splices: Annotated (sjdb) | 8141780 Number of splices: GT/AG | 8143449 Number of splices: GC/AG | 140370 Number of splices: AT/AC | 5165 Number of splices: Non-canonical | 34827 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 221180 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 16984 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.01% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 392222 392222 392222 N_multimapping 221180 221180 221180 N_noFeature 318745 8279097 368040 N_ambiguous 142266 558 58297 UnstrandedReadsAssigned:7951042 PositiveStrandReadsAssigned:132398 NegativeStrandReadsAssigned:7985716 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917547 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917547-trimmed-pair1.fastq SRR12917547-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,025,455 reads, 8,000,296 reads pseudoaligned [quant] estimated average fragment length: 242.222 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR12917547.ke.tsv 34699 SRR12917547.se.tsv 87100 total ==> SRR12917547.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.78 168 11.133 Potri.005G024800.1.v4.1 1035 793.778 247 36.6382 Potri.004G059700.1.v4.1 961 719.873 18 2.9441 Potri.007G009000.2.v4.1 1416 1174.78 0 0 Potri.003G141000.2.v4.1 2943 2701.78 337.949 14.7278 Potri.016G087400.1.v4.1 270 91.7802 316.974 406.641 Potri.015G069301.1.v4.1 564 335.072 0 0 Potri.010G195200.1.v4.1 1773 1531.78 15 1.15301 Potri.012G127500.1.v4.1 977 735.834 81 12.9611 ==> SRR12917547.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 94 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR12917547 completed mapping pipeline successfully