Starting /dee2/code/volunteer_pipeline.sh SRR12917548 current disk space = 3091348398080 free memory = 1452132640 SRR12917548 SRAfilesize 99d842a39668dfc8709a825094c18a96 SRR12917548.sra SRR12917548.sra file validated SRR12917548 is paired end SRR12917548 is conventional basespace SRR12917548 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917548_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.63625 37.0 37.0 37.0 37.0 37.0 2 36.4865 37.0 37.0 37.0 37.0 37.0 3 36.5775 37.0 37.0 37.0 37.0 37.0 4 36.5855 37.0 37.0 37.0 37.0 37.0 5 36.7195 37.0 37.0 37.0 37.0 37.0 6 36.6095 37.0 37.0 37.0 37.0 37.0 7 36.5585 37.0 37.0 37.0 37.0 37.0 8 36.5635 37.0 37.0 37.0 37.0 37.0 9 36.619 37.0 37.0 37.0 37.0 37.0 10-14 36.6272 37.0 37.0 37.0 37.0 37.0 15-19 36.6203 37.0 37.0 37.0 37.0 37.0 20-24 36.580999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5376 37.0 37.0 37.0 37.0 37.0 30-34 36.5422 37.0 37.0 37.0 37.0 37.0 35-39 36.4726 37.0 37.0 37.0 37.0 37.0 40-44 36.471599999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.44610000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.4384 37.0 37.0 37.0 37.0 37.0 55-59 36.4167 37.0 37.0 37.0 37.0 37.0 60-64 36.3382 37.0 37.0 37.0 37.0 37.0 65-69 36.3115 37.0 37.0 37.0 37.0 37.0 70-74 36.3293 37.0 37.0 37.0 37.0 37.0 75-79 36.35 37.0 37.0 37.0 37.0 37.0 80-84 36.315 37.0 37.0 37.0 37.0 37.0 85-89 36.3224 37.0 37.0 37.0 37.0 37.0 90-94 36.230199999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.226800000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1491 37.0 37.0 37.0 37.0 37.0 105-109 36.135000000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1092 37.0 37.0 37.0 37.0 37.0 115-119 36.12069999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.0505 37.0 37.0 37.0 37.0 37.0 125-129 35.9537 37.0 37.0 37.0 37.0 37.0 130-134 35.8834 37.0 37.0 37.0 37.0 37.0 135-139 35.8146 37.0 37.0 37.0 37.0 37.0 140-144 35.6699 37.0 37.0 37.0 37.0 37.0 145-149 35.528800000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.384 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 3.0 26 2.0 27 5.0 28 10.0 29 18.0 30 18.0 31 22.0 32 46.0 33 81.0 34 130.0 35 346.0 36 3042.0 37 274.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.26006501625407 11.677919479869967 5.501375343835959 42.56064016004001 2 17.974999999999998 10.15 39.074999999999996 32.800000000000004 3 17.25 15.475 29.975 37.3 4 21.825 21.5 24.525 32.15 5 23.1 31.2 24.3 21.4 6 20.349999999999998 32.824999999999996 23.775 23.05 7 14.524999999999999 28.499999999999996 42.1 14.875 8 15.625 25.074999999999996 35.625 23.674999999999997 9 17.1 22.975 35.125 24.8 10-14 19.33 30.349999999999998 28.09 22.23 15-19 19.564999999999998 28.055000000000003 27.785 24.595 20-24 20.02 28.76 28.285 22.935 25-29 19.439999999999998 28.765 27.88 23.915 30-34 19.41 28.26 28.59 23.74 35-39 19.305 28.4 27.905 24.39 40-44 19.32 28.405 28.285 23.990000000000002 45-49 19.794999999999998 29.185 27.345000000000002 23.674999999999997 50-54 19.675 28.044999999999998 28.275 24.005000000000003 55-59 19.97 28.685 28.155 23.189999999999998 60-64 20.13 28.15 28.000000000000004 23.72 65-69 19.89 27.689999999999998 28.365000000000002 24.055 70-74 20.03 28.38 28.26 23.330000000000002 75-79 20.01 28.389999999999997 28.01 23.59 80-84 20.445 28.175 28.34 23.04 85-89 19.765 28.17 28.265 23.799999999999997 90-94 19.875 28.54 27.794999999999998 23.79 95-99 20.25 28.665000000000003 27.595 23.49 100-104 20.880000000000003 28.375 27.589999999999996 23.155 105-109 19.994999999999997 28.884999999999998 27.544999999999998 23.575 110-114 20.294999999999998 28.03 27.905 23.77 115-119 20.01 28.255000000000003 27.595 24.14 120-124 20.135 29.189999999999998 26.865 23.810000000000002 125-129 20.82 28.21 27.27 23.7 130-134 20.36 28.720000000000002 27.015 23.905 135-139 20.215 28.18 27.744999999999997 23.86 140-144 21.165 28.915000000000003 26.77 23.150000000000002 145-149 20.65 28.299999999999997 27.200000000000003 23.849999999999998 150-151 21.575 28.925 26.5375 22.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.5 10 1.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.5 21 2.5 22 3.5 23 3.0 24 5.0 25 6.0 26 9.5 27 10.5 28 8.5 29 16.5 30 24.5 31 27.0 32 31.5 33 39.0 34 49.5 35 61.0 36 84.0 37 107.0 38 126.5 39 161.5 40 195.5 41 237.0 42 249.0 43 245.0 44 262.5 45 260.5 46 261.0 47 262.0 48 242.5 49 211.5 50 178.0 51 141.5 52 109.0 53 90.0 54 67.0 55 44.0 56 34.5 57 30.0 58 21.0 59 16.0 60 16.0 61 9.0 62 6.5 63 7.5 64 4.0 65 3.5 66 3.0 67 2.0 68 1.5 69 1.0 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.525 #Duplication Level Percentage of deduplicated Percentage of total 1 92.9748716563091 86.02499999999999 2 6.133477438530127 11.35 3 0.7295325587679006 2.025 4 0.1621183463928668 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 1.9874999999999998 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.7125 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.4375 0.0 0.0 0.0 0.0 118-119 3.875 0.0 0.0 0.0 0.0 120-121 4.45 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.2 0.0 0.0 0.0 0.0 126-127 5.5375 0.0 0.0 0.0 0.0 128-129 5.9 0.0 0.0 0.0 0.0 130-131 6.225 0.0 0.0 0.0 0.0 132-133 6.675000000000001 0.0 0.0 0.0 0.0 134-135 7.225 0.0 0.0 0.0 0.0 136-137 7.7375 0.0 0.0 0.0 0.0 138-139 8.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGATG 10 0.006830828 145.0 3 GAGATTT 10 0.006830828 145.0 3 >>END_MODULE SRR12917548 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917548_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2835 37.0 37.0 37.0 37.0 37.0 2 36.219 37.0 37.0 37.0 37.0 37.0 3 36.3265 37.0 37.0 37.0 37.0 37.0 4 36.3155 37.0 37.0 37.0 37.0 37.0 5 36.3745 37.0 37.0 37.0 37.0 37.0 6 36.344 37.0 37.0 37.0 37.0 37.0 7 36.2815 37.0 37.0 37.0 37.0 37.0 8 36.372 37.0 37.0 37.0 37.0 37.0 9 36.3135 37.0 37.0 37.0 37.0 37.0 10-14 36.397099999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.3464 37.0 37.0 37.0 37.0 37.0 20-24 36.3246 37.0 37.0 37.0 37.0 37.0 25-29 36.1845 37.0 37.0 37.0 37.0 37.0 30-34 36.1193 37.0 37.0 37.0 37.0 37.0 35-39 36.10709999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.079899999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.041 37.0 37.0 37.0 37.0 37.0 50-54 36.0152 37.0 37.0 37.0 37.0 37.0 55-59 35.9677 37.0 37.0 37.0 37.0 37.0 60-64 36.0351 37.0 37.0 37.0 37.0 37.0 65-69 35.9416 37.0 37.0 37.0 37.0 37.0 70-74 35.9283 37.0 37.0 37.0 37.0 37.0 75-79 35.8313 37.0 37.0 37.0 37.0 37.0 80-84 35.941700000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.8957 37.0 37.0 37.0 37.0 37.0 90-94 35.883500000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.851299999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.7665 37.0 37.0 37.0 37.0 37.0 105-109 35.727000000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.7606 37.0 37.0 37.0 37.0 37.0 115-119 35.6241 37.0 37.0 37.0 37.0 37.0 120-124 35.5801 37.0 37.0 37.0 37.0 37.0 125-129 35.4951 37.0 37.0 37.0 37.0 37.0 130-134 35.4298 37.0 37.0 37.0 37.0 37.0 135-139 35.3666 37.0 37.0 37.0 37.0 37.0 140-144 35.144600000000004 37.0 37.0 37.0 27.4 37.0 145-149 34.972500000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.619 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 2.0 16 2.0 17 0.0 18 0.0 19 5.0 20 1.0 21 1.0 22 5.0 23 6.0 24 5.0 25 10.0 26 5.0 27 10.0 28 19.0 29 9.0 30 30.0 31 39.0 32 57.0 33 99.0 34 217.0 35 637.0 36 2640.0 37 198.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.15 25.924999999999997 9.049999999999999 25.874999999999996 2 27.6 23.799999999999997 34.125 14.475 3 19.25 27.025 34.875 18.85 4 23.7 33.375 24.4 18.525 5 26.650000000000002 35.125 21.025 17.2 6 21.275 38.550000000000004 22.775000000000002 17.4 7 21.925 21.775 38.0 18.3 8 19.2 24.099999999999998 32.4 24.3 9 20.674999999999997 24.725 31.35 23.25 10-14 23.435 29.115000000000002 26.545 20.905 15-19 23.215 28.565 27.615000000000002 20.605 20-24 22.79 29.535 27.55 20.125 25-29 23.305 28.09 28.27 20.335 30-34 22.81 28.744999999999997 27.74 20.705000000000002 35-39 23.75 28.634999999999998 27.334999999999997 20.28 40-44 22.975 28.68 27.955000000000002 20.39 45-49 23.05 28.449999999999996 28.075 20.424999999999997 50-54 23.3 28.349999999999998 27.825 20.525 55-59 23.52 28.52 27.400000000000002 20.560000000000002 60-64 23.265 28.325 27.77 20.64 65-69 23.695 28.065 28.349999999999998 19.89 70-74 23.494999999999997 28.470000000000002 27.88 20.155 75-79 22.81 28.63 27.500000000000004 21.060000000000002 80-84 23.405 28.660000000000004 27.255000000000003 20.68 85-89 24.05 28.660000000000004 27.455000000000002 19.835 90-94 23.695 28.535 28.199999999999996 19.57 95-99 23.53 28.115000000000002 28.03 20.325 100-104 23.48 29.165000000000003 27.0 20.355 105-109 24.11 28.395 27.985 19.509999999999998 110-114 23.630000000000003 28.945 27.939999999999998 19.485 115-119 24.29 28.785 27.439999999999998 19.485 120-124 24.665 28.715000000000003 26.655 19.965 125-129 25.064999999999998 28.994999999999997 26.465 19.475 130-134 25.590000000000003 28.449999999999996 27.189999999999998 18.77 135-139 25.745 28.4 26.93 18.925 140-144 25.924999999999997 28.84 26.58 18.655 145-149 26.700000000000003 28.255000000000003 25.624999999999996 19.42 150-151 26.1625 28.225 26.450000000000003 19.162499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.5 16 1.0 17 1.0 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 3.0 24 3.5 25 1.5 26 5.5 27 10.0 28 12.0 29 16.0 30 23.5 31 27.0 32 32.0 33 44.0 34 57.0 35 70.5 36 87.5 37 109.5 38 144.0 39 172.0 40 197.5 41 244.5 42 268.0 43 269.0 44 284.5 45 270.5 46 254.0 47 240.5 48 208.5 49 195.5 50 167.5 51 131.5 52 106.5 53 82.5 54 59.5 55 49.0 56 39.5 57 23.5 58 18.5 59 14.5 60 8.5 61 7.0 62 6.5 63 4.5 64 2.5 65 0.5 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 1.0 93 1.0 94 0.5 95 0.5 96 0.5 97 0.5 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.45 #Duplication Level Percentage of deduplicated Percentage of total 1 92.94213088155759 85.925 2 6.165494862087615 11.4 3 0.7301243915630071 2.025 4 0.1352082206598161 0.5 5 0.0 0.0 6 0.027041644131963225 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.6625000000000001 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.3375 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 1.825 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.575 0.0 0.0 0.0 0.0 112-113 2.7875 0.0 0.0 0.0 0.0 114-115 3.0875000000000004 0.0 0.0 0.0 0.0 116-117 3.5374999999999996 0.0 0.0 0.0 0.0 118-119 3.9749999999999996 0.0 0.0 0.0 0.0 120-121 4.5875 0.0 0.0 0.0 0.0 122-123 5.050000000000001 0.0 0.0 0.0 0.0 124-125 5.35 0.0 0.0 0.0 0.0 126-127 5.7 0.0 0.0 0.0 0.0 128-129 6.074999999999999 0.0 0.0 0.0 0.0 130-131 6.4125 0.0 0.0 0.0 0.0 132-133 6.9 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 7.9375 0.0 0.0 0.0 0.0 138-139 8.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAGAT 10 0.006830828 145.0 6 >>END_MODULE Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra Read 480776 spots for SRR12917548.sra Written 480776 spots for SRR12917548.sra SRR ids: ['SRR12917548.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zsrwjxaf SRR12917548.sra spots: 9615520 blocks: [[1, 480776], [480777, 961552], [961553, 1442328], [1442329, 1923104], [1923105, 2403880], [2403881, 2884656], [2884657, 3365432], [3365433, 3846208], [3846209, 4326984], [4326985, 4807760], [4807761, 5288536], [5288537, 5769312], [5769313, 6250088], [6250089, 6730864], [6730865, 7211640], [7211641, 7692416], [7692417, 8173192], [8173193, 8653968], [8653969, 9134744], [9134745, 9615520]] SRR12917548 file size 3246824 SRR12917548 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917548 SRR12917548_1.fastq SRR12917548_2.fastq Input file: SRR12917548_1.fastq Paired file: SRR12917548_2.fastq trimmed: SRR12917548-trimmed-pair1.fastq, SRR12917548-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:02:05 2025 >> started Thu Feb 13 13:02:17 2025 >> done (11.648s) 9615520 read pairs processed; of these: 110 ( 0.00%) short read pairs filtered out after trimming by size control 1815 ( 0.02%) empty read pairs filtered out after trimming by size control 9613595 (99.98%) read pairs available; of these: 1253659 (13.04%) trimmed read pairs available after processing 8359936 (86.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 8 0.00% 21 12 0.00% 22 11 0.00% 23 12 0.00% 24 11 0.00% 25 14 0.00% 26 16 0.00% 27 12 0.00% 28 18 0.00% 29 10 0.00% 30 17 0.00% 31 7 0.00% 32 16 0.00% 33 12 0.00% 34 20 0.00% 35 15 0.00% 36 22 0.00% 37 22 0.00% 38 22 0.00% 39 23 0.00% 40 27 0.00% 41 31 0.00% 42 24 0.00% 43 21 0.00% 44 26 0.00% 45 28 0.00% 46 43 0.00% 47 39 0.00% 48 51 0.00% 49 43 0.00% 50 81 0.00% 51 75 0.00% 52 79 0.00% 53 82 0.00% 54 127 0.00% 55 94 0.00% 56 113 0.00% 57 164 0.00% 58 182 0.00% 59 179 0.00% 60 208 0.00% 61 247 0.00% 62 291 0.00% 63 387 0.00% 64 440 0.00% 65 487 0.01% 66 510 0.01% 67 551 0.01% 68 647 0.01% 69 772 0.01% 70 842 0.01% 71 1009 0.01% 72 1121 0.01% 73 1287 0.01% 74 1511 0.02% 75 1657 0.02% 76 1814 0.02% 77 1908 0.02% 78 2213 0.02% 79 2318 0.02% 80 2664 0.03% 81 2793 0.03% 82 3284 0.03% 83 3487 0.04% 84 3906 0.04% 85 4464 0.05% 86 4615 0.05% 87 4819 0.05% 88 5036 0.05% 89 5419 0.06% 90 5679 0.06% 91 6031 0.06% 92 6364 0.07% 93 7021 0.07% 94 7575 0.08% 95 8099 0.08% 96 8484 0.09% 97 9131 0.09% 98 8827 0.09% 99 9397 0.10% 100 9843 0.10% 101 10038 0.10% 102 10629 0.11% 103 11055 0.11% 104 11778 0.12% 105 12577 0.13% 106 12930 0.13% 107 13512 0.14% 108 13748 0.14% 109 14105 0.15% 110 14358 0.15% 111 14902 0.16% 112 15289 0.16% 113 15775 0.16% 114 16298 0.17% 115 17379 0.18% 116 17856 0.19% 117 18571 0.19% 118 18912 0.20% 119 19210 0.20% 120 19895 0.21% 121 20160 0.21% 122 20104 0.21% 123 20846 0.22% 124 21570 0.22% 125 22034 0.23% 126 22801 0.24% 127 23355 0.24% 128 23423 0.24% 129 24745 0.26% 130 24816 0.26% 131 24636 0.26% 132 25420 0.26% 133 25644 0.27% 134 25842 0.27% 135 26322 0.27% 136 27340 0.28% 137 27636 0.29% 138 28525 0.30% 139 29149 0.30% 140 29428 0.31% 141 29958 0.31% 142 30086 0.31% 143 29850 0.31% 144 30846 0.32% 145 30628 0.32% 146 30939 0.32% 147 31617 0.33% 148 31956 0.33% 149 32518 0.34% 150 33669 0.35% 151 8359936 86.96% 9613595 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=2.5 sequence=GTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATACCAGTTTACCTTTCTCCGATCCGAATTTCTTCCAGTTCCAAACTCCTGTGAAGGCAACAGCCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=45.02 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.9 sequence=AAGTCCACCAGAACAAAAGATAGCAAAGCATTCAAGGATAAAACTAAAACTAATAAAGCTAGCACTTGCACATCAAGGCCAGCTATTGGCACTCTTCAGCACTTGACCTCCTTCAAAGAAGGGGCAAAGTACAAGAATGTTGGATCGGTAGCACCTTCTTTGTAATAAGCAAAGACCAA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=30 prefix-density=0.22 prefix-fanout=2.4 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=411.19 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=13.7 sequence=AGAAAGAGAGCCTCAAGAGAAGTCTTACACTAAAACCAACAAGCCCTCTTTGCCCAACTTGCAATGGCCTCGTGTCAGTGCTCCAAACCCGTTGAGCATCCATGCAACCAAGACCAGAAAAGCCACTCATCGGGCCAAAAGGTAGAGAAACAGGCTGAAGGTGGAGTCGTCAAGACCGGGACTCGCAGCTCAAGCCAAAGCCATTCCCCTGGAAGCACTAATGGCATGACCCCTGCTCCGGCATGCAATGCAAACAAGAGAGGTGAGCGCAAGAAGGGTCTGTTCCAAAGGATCAAGGATGGCATCTCAGGCCATAGTGATGGAGGCGGCAGCAG SRR12917548 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:03:06 Started mapping on | Feb 13 13:03:06 Finished on | Feb 13 13:05:01 Mapping speed, Million of reads per hour | 300.95 Number of input reads | 9613595 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 8884627 Uniquely mapped reads % | 92.42% Average mapped length | 293.90 Number of splices: Total | 8403977 Number of splices: Annotated (sjdb) | 8213957 Number of splices: GT/AG | 8249515 Number of splices: GC/AG | 121358 Number of splices: AT/AC | 7908 Number of splices: Non-canonical | 25196 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.03% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 233085 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 31389 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.65% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 495883 495883 495883 N_multimapping 233085 233085 233085 N_noFeature 359444 8775622 412205 N_ambiguous 110405 424 53952 UnstrandedReadsAssigned:8414778 PositiveStrandReadsAssigned:108581 NegativeStrandReadsAssigned:8418470 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917548 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917548-trimmed-pair1.fastq SRR12917548-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,613,595 reads, 8,444,423 reads pseudoaligned [quant] estimated average fragment length: 252.154 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR12917548.ke.tsv 34699 SRR12917548.se.tsv 87100 total ==> SRR12917548.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.85 373 26.4363 Potri.005G024800.1.v4.1 1035 783.846 104 16.6147 Potri.004G059700.1.v4.1 961 710.027 32 5.64373 Potri.007G009000.2.v4.1 1416 1164.85 0 0 Potri.003G141000.2.v4.1 2943 2691.85 369 17.1659 Potri.016G087400.1.v4.1 270 90.2057 701 973.14 Potri.015G069301.1.v4.1 564 327.953 0 0 Potri.010G195200.1.v4.1 1773 1521.85 63 5.18395 Potri.012G127500.1.v4.1 977 725.932 3417 589.441 ==> SRR12917548.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 155 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 146 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 3 SRR12917548 completed mapping pipeline successfully