Starting /dee2/code/volunteer_pipeline.sh SRR12917549 current disk space = 3091347611648 free memory = 1420880216 SRR12917549 SRAfilesize 03555ba72051418cbdacd334a5ef6797 SRR12917549.sra SRR12917549.sra file validated SRR12917549 is paired end SRR12917549 is conventional basespace SRR12917549 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917549_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.53975 37.0 37.0 37.0 37.0 37.0 2 36.519 37.0 37.0 37.0 37.0 37.0 3 36.5325 37.0 37.0 37.0 37.0 37.0 4 36.618 37.0 37.0 37.0 37.0 37.0 5 36.632 37.0 37.0 37.0 37.0 37.0 6 36.6205 37.0 37.0 37.0 37.0 37.0 7 36.511 37.0 37.0 37.0 37.0 37.0 8 36.5155 37.0 37.0 37.0 37.0 37.0 9 36.6235 37.0 37.0 37.0 37.0 37.0 10-14 36.6229 37.0 37.0 37.0 37.0 37.0 15-19 36.6288 37.0 37.0 37.0 37.0 37.0 20-24 36.576800000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.54260000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.4673 37.0 37.0 37.0 37.0 37.0 35-39 36.458600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.492200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4505 37.0 37.0 37.0 37.0 37.0 50-54 36.468700000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.370000000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.3454 37.0 37.0 37.0 37.0 37.0 65-69 36.3021 37.0 37.0 37.0 37.0 37.0 70-74 36.332499999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.3154 37.0 37.0 37.0 37.0 37.0 80-84 36.36890000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.3159 37.0 37.0 37.0 37.0 37.0 90-94 36.287699999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.2355 37.0 37.0 37.0 37.0 37.0 100-104 36.2031 37.0 37.0 37.0 37.0 37.0 105-109 36.1962 37.0 37.0 37.0 37.0 37.0 110-114 36.1557 37.0 37.0 37.0 37.0 37.0 115-119 36.1062 37.0 37.0 37.0 37.0 37.0 120-124 36.1261 37.0 37.0 37.0 37.0 37.0 125-129 36.0531 37.0 37.0 37.0 37.0 37.0 130-134 35.966699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.8832 37.0 37.0 37.0 37.0 37.0 140-144 35.81849999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.7248 37.0 37.0 37.0 37.0 37.0 150-151 35.5025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 1.0 25 1.0 26 6.0 27 3.0 28 9.0 29 11.0 30 25.0 31 28.0 32 49.0 33 58.0 34 107.0 35 301.0 36 3103.0 37 293.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.46311577894473 12.678169542385595 4.176044011002751 30.682670667666915 2 19.45 11.175 39.675 29.7 3 16.55 18.0 30.9 34.55 4 21.7 22.900000000000002 26.8 28.599999999999998 5 23.5 31.900000000000002 23.95 20.65 6 20.200000000000003 34.475 22.675 22.650000000000002 7 14.924999999999999 27.725 41.3 16.05 8 15.725 25.674999999999997 34.775 23.825 9 16.3 22.725 36.5 24.474999999999998 10-14 19.365 29.84 27.625 23.169999999999998 15-19 20.105 27.825 28.044999999999998 24.025 20-24 19.82 28.92 27.325 23.935000000000002 25-29 19.27 28.9 27.79 24.04 30-34 20.405 28.565 27.075 23.955000000000002 35-39 20.185 28.389999999999997 27.575 23.849999999999998 40-44 20.485 27.92 28.035 23.56 45-49 20.5 28.535 27.735 23.23 50-54 20.41 28.62 27.725 23.244999999999997 55-59 20.32 28.549999999999997 27.755000000000003 23.375 60-64 20.595 28.34 27.46 23.605 65-69 20.169999999999998 28.144999999999996 27.74 23.945 70-74 19.755 28.815 27.11 24.32 75-79 20.125 27.125 28.33 24.42 80-84 20.31 28.349999999999998 27.37 23.97 85-89 20.535 28.595 26.985 23.885 90-94 20.66 28.389999999999997 27.48 23.47 95-99 20.47 28.360000000000003 27.115000000000002 24.055 100-104 20.424999999999997 27.944999999999997 27.525 24.104999999999997 105-109 20.575 27.950000000000003 27.24 24.235 110-114 21.375 28.694999999999997 27.025 22.905 115-119 21.095 27.985 27.465 23.455000000000002 120-124 20.845 27.98 27.034999999999997 24.14 125-129 20.24 28.52 27.33 23.91 130-134 21.085 27.99 27.16 23.765 135-139 20.96 27.750000000000004 27.165 24.125 140-144 21.535 27.74 27.534999999999997 23.189999999999998 145-149 21.48 28.144999999999996 26.77 23.605 150-151 21.2625 27.537499999999998 27.025 24.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.5 22 2.0 23 3.0 24 2.5 25 4.5 26 6.0 27 4.5 28 9.5 29 16.5 30 25.0 31 32.0 32 33.5 33 35.0 34 50.0 35 63.0 36 76.5 37 97.5 38 109.5 39 139.5 40 170.5 41 200.5 42 229.5 43 247.0 44 257.5 45 268.5 46 287.0 47 284.0 48 249.0 49 218.5 50 195.0 51 150.0 52 128.0 53 104.5 54 73.0 55 59.5 56 43.0 57 33.0 58 25.0 59 21.5 60 17.5 61 8.5 62 4.0 63 2.5 64 1.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.25 #Duplication Level Percentage of deduplicated Percentage of total 1 90.24930747922437 81.45 2 8.9196675900277 16.1 3 0.6371191135734072 1.725 4 0.16620498614958448 0.6 5 0.02770083102493075 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCAATGACCCCCACCTCAACAAATTCTCCATATCAACTAGGACTTTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.7374999999999998 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.1 0.0 0.0 0.0 0.0 114-115 2.35 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.1875 0.0 0.0 0.0 0.0 122-123 3.4000000000000004 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 3.875 0.0 0.0 0.0 0.0 128-129 4.1375 0.0 0.0 0.0 0.0 130-131 4.525 0.0 0.0 0.0 0.0 132-133 4.8125 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.675000000000001 0.0 0.0 0.0 0.0 138-139 6.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917549 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917549_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3295 37.0 37.0 37.0 37.0 37.0 2 36.2115 37.0 37.0 37.0 37.0 37.0 3 36.0655 37.0 37.0 37.0 37.0 37.0 4 36.2315 37.0 37.0 37.0 37.0 37.0 5 36.3895 37.0 37.0 37.0 37.0 37.0 6 36.242 37.0 37.0 37.0 37.0 37.0 7 36.313 37.0 37.0 37.0 37.0 37.0 8 36.3475 37.0 37.0 37.0 37.0 37.0 9 36.4145 37.0 37.0 37.0 37.0 37.0 10-14 36.415 37.0 37.0 37.0 37.0 37.0 15-19 36.381600000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.34309999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.281 37.0 37.0 37.0 37.0 37.0 30-34 36.19520000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.100699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1258 37.0 37.0 37.0 37.0 37.0 45-49 36.0613 37.0 37.0 37.0 37.0 37.0 50-54 36.068799999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.093199999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.14319999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.018600000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.980900000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.90690000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.970299999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.94499999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.933800000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.975899999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.8688 37.0 37.0 37.0 37.0 37.0 105-109 35.833299999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.7706 37.0 37.0 37.0 37.0 37.0 115-119 35.7319 37.0 37.0 37.0 37.0 37.0 120-124 35.5826 37.0 37.0 37.0 37.0 37.0 125-129 35.6756 37.0 37.0 37.0 37.0 37.0 130-134 35.4627 37.0 37.0 37.0 37.0 37.0 135-139 35.487399999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.30120000000001 37.0 37.0 37.0 32.2 37.0 145-149 35.1061 37.0 37.0 37.0 29.8 37.0 150-151 34.60025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 3.0 17 2.0 18 0.0 19 3.0 20 2.0 21 4.0 22 1.0 23 5.0 24 1.0 25 5.0 26 11.0 27 6.0 28 13.0 29 18.0 30 25.0 31 34.0 32 58.0 33 81.0 34 223.0 35 558.0 36 2747.0 37 197.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.2 27.3 6.425 20.075000000000003 2 28.7 24.4 31.05 15.85 3 19.825 26.25 36.8 17.125 4 22.7 33.324999999999996 24.625 19.35 5 24.65 37.05 19.3 19.0 6 20.925 39.475 20.775 18.825 7 20.849999999999998 22.45 38.725 17.974999999999998 8 20.025000000000002 27.375 28.575 24.025 9 21.625 22.325 30.325000000000003 25.724999999999998 10-14 23.645 29.095 26.565 20.695 15-19 23.43 27.1 27.925 21.545 20-24 23.43 28.65 26.91 21.01 25-29 22.994999999999997 28.055000000000003 27.694999999999997 21.255 30-34 23.200000000000003 28.275 27.595 20.93 35-39 23.330000000000002 28.26 27.21 21.2 40-44 23.535 28.075 27.400000000000002 20.990000000000002 45-49 23.73 26.995 27.87 21.404999999999998 50-54 23.275000000000002 27.855 27.400000000000002 21.47 55-59 23.59 26.87 27.79 21.75 60-64 23.27 27.125 28.044999999999998 21.560000000000002 65-69 23.369999999999997 27.229999999999997 27.894999999999996 21.505 70-74 23.400000000000002 28.52 26.895000000000003 21.185000000000002 75-79 23.26 27.515 27.884999999999998 21.34 80-84 23.369999999999997 27.375 27.52 21.735 85-89 23.630000000000003 27.83 26.810000000000002 21.73 90-94 23.445 27.900000000000002 27.845 20.810000000000002 95-99 23.665 28.084999999999997 27.275 20.974999999999998 100-104 23.674999999999997 28.139999999999997 27.055 21.13 105-109 23.45 27.889999999999997 27.765 20.895 110-114 24.235 27.725 26.845000000000002 21.195 115-119 24.525 27.82 27.21 20.445 120-124 24.490000000000002 27.025 28.095 20.39 125-129 24.404999999999998 27.27 27.345000000000002 20.979999999999997 130-134 24.975 27.875 27.0 20.150000000000002 135-139 25.369999999999997 26.810000000000002 27.29 20.53 140-144 25.650000000000002 27.089999999999996 26.965 20.294999999999998 145-149 25.729999999999997 27.205000000000002 26.810000000000002 20.255000000000003 150-151 26.187500000000004 26.887499999999996 26.2875 20.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 2.0 24 3.5 25 2.0 26 2.5 27 3.5 28 3.5 29 9.5 30 17.5 31 18.5 32 22.5 33 34.0 34 41.5 35 52.5 36 78.0 37 97.0 38 124.5 39 162.5 40 192.0 41 233.0 42 249.5 43 252.5 44 252.5 45 266.0 46 275.0 47 254.0 48 236.5 49 209.0 50 177.5 51 145.5 52 126.0 53 106.5 54 81.0 55 67.0 56 51.0 57 36.0 58 31.0 59 21.0 60 13.0 61 10.5 62 6.0 63 3.0 64 2.5 65 3.5 66 2.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 1.0 93 1.5 94 1.0 95 0.5 96 0.0 97 0.5 98 1.0 99 1.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.2 #Duplication Level Percentage of deduplicated Percentage of total 1 90.68736141906874 81.8 2 8.453436807095343 15.25 3 0.4988913525498891 1.35 4 0.24944567627494454 0.8999999999999999 5 0.02771618625277162 0.125 6 0.0 0.0 7 0.05543237250554324 0.35000000000000003 8 0.0 0.0 9 0.02771618625277162 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GCTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATC 7 0.17500000000000002 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 7 0.17500000000000002 No Hit GGTCAATCCTTGCATCTCTCAGCACCTTCCAGCAGATGTGGATTTCCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.8875 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.3499999999999996 0.0 0.0 0.0 0.0 124-125 3.6125 0.0 0.0 0.0 0.0 126-127 3.825 0.0 0.0 0.0 0.0 128-129 4.0875 0.0 0.0 0.0 0.0 130-131 4.475 0.0 0.0 0.0 0.0 132-133 4.7625 0.0 0.0 0.0 0.0 134-135 5.225 0.0 0.0 0.0 0.0 136-137 5.625 0.0 0.0 0.0 0.0 138-139 6.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTGC 10 0.006830828 145.0 5 AGATAGA 10 0.006830828 145.0 4 >>END_MODULE Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634515 spots for SRR12917549.sra Written 634515 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra Read 634497 spots for SRR12917549.sra Written 634497 spots for SRR12917549.sra SRR ids: ['SRR12917549.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hai1q4kk SRR12917549.sra spots: 12689958 blocks: [[1, 634497], [634498, 1268994], [1268995, 1903491], [1903492, 2537988], [2537989, 3172485], [3172486, 3806982], [3806983, 4441479], [4441480, 5075976], [5075977, 5710473], [5710474, 6344970], [6344971, 6979467], [6979468, 7613964], [7613965, 8248461], [8248462, 8882958], [8882959, 9517455], [9517456, 10151952], [10151953, 10786449], [10786450, 11420946], [11420947, 12055443], [12055444, 12689958]] SRR12917549 file size 4290902 SRR12917549 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917549 SRR12917549_1.fastq SRR12917549_2.fastq Input file: SRR12917549_1.fastq Paired file: SRR12917549_2.fastq trimmed: SRR12917549-trimmed-pair1.fastq, SRR12917549-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:02:21 2025 >> started Thu Feb 13 13:02:35 2025 >> done (13.827s) 12689958 read pairs processed; of these: 152 ( 0.00%) short read pairs filtered out after trimming by size control 933 ( 0.01%) empty read pairs filtered out after trimming by size control 12688873 (99.99%) read pairs available; of these: 1344252 (10.59%) trimmed read pairs available after processing 11344621 (89.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 17 0.00% 20 21 0.00% 21 21 0.00% 22 11 0.00% 23 21 0.00% 24 17 0.00% 25 21 0.00% 26 36 0.00% 27 20 0.00% 28 27 0.00% 29 27 0.00% 30 32 0.00% 31 29 0.00% 32 18 0.00% 33 30 0.00% 34 32 0.00% 35 36 0.00% 36 33 0.00% 37 32 0.00% 38 29 0.00% 39 24 0.00% 40 23 0.00% 41 36 0.00% 42 33 0.00% 43 47 0.00% 44 22 0.00% 45 36 0.00% 46 32 0.00% 47 53 0.00% 48 53 0.00% 49 54 0.00% 50 71 0.00% 51 70 0.00% 52 93 0.00% 53 81 0.00% 54 103 0.00% 55 120 0.00% 56 144 0.00% 57 113 0.00% 58 157 0.00% 59 190 0.00% 60 214 0.00% 61 256 0.00% 62 294 0.00% 63 362 0.00% 64 338 0.00% 65 381 0.00% 66 439 0.00% 67 486 0.00% 68 529 0.00% 69 646 0.01% 70 783 0.01% 71 871 0.01% 72 1029 0.01% 73 1076 0.01% 74 1185 0.01% 75 1335 0.01% 76 1486 0.01% 77 1635 0.01% 78 1805 0.01% 79 1941 0.02% 80 2172 0.02% 81 2580 0.02% 82 2881 0.02% 83 3171 0.02% 84 3535 0.03% 85 3788 0.03% 86 4014 0.03% 87 4380 0.03% 88 4518 0.04% 89 4866 0.04% 90 5167 0.04% 91 5810 0.05% 92 6024 0.05% 93 6826 0.05% 94 7141 0.06% 95 7478 0.06% 96 7941 0.06% 97 8742 0.07% 98 8510 0.07% 99 9414 0.07% 100 9551 0.08% 101 10016 0.08% 102 10671 0.08% 103 11623 0.09% 104 11832 0.09% 105 12564 0.10% 106 12870 0.10% 107 13530 0.11% 108 13765 0.11% 109 14249 0.11% 110 14435 0.11% 111 15027 0.12% 112 15556 0.12% 113 15964 0.13% 114 16742 0.13% 115 17839 0.14% 116 18335 0.14% 117 19120 0.15% 118 19564 0.15% 119 19773 0.16% 120 20498 0.16% 121 20845 0.16% 122 21413 0.17% 123 21975 0.17% 124 23391 0.18% 125 23460 0.18% 126 24725 0.19% 127 25085 0.20% 128 25754 0.20% 129 26587 0.21% 130 26966 0.21% 131 26921 0.21% 132 27659 0.22% 133 28326 0.22% 134 29012 0.23% 135 30041 0.24% 136 30637 0.24% 137 30899 0.24% 138 32093 0.25% 139 32715 0.26% 140 32999 0.26% 141 33634 0.27% 142 33887 0.27% 143 34750 0.27% 144 35379 0.28% 145 35625 0.28% 146 36796 0.29% 147 36986 0.29% 148 37798 0.30% 149 37920 0.30% 150 38320 0.30% 151 11344621 89.41% 12688873 reads passed initial QC criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=1.00 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=7.95 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=2.6 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=1.39 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=23 prefix-density=1.39 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=77.76 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.0 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR12917549 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:03:16 Started mapping on | Feb 13 13:03:16 Finished on | Feb 13 13:04:39 Mapping speed, Million of reads per hour | 550.36 Number of input reads | 12688873 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11918105 Uniquely mapped reads % | 93.93% Average mapped length | 295.24 Number of splices: Total | 12021827 Number of splices: Annotated (sjdb) | 11786846 Number of splices: GT/AG | 11768185 Number of splices: GC/AG | 206299 Number of splices: AT/AC | 7488 Number of splices: Non-canonical | 39855 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271306 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 28249 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 499462 499462 499462 N_multimapping 271306 271306 271306 N_noFeature 384637 11760953 436955 N_ambiguous 179200 668 73967 UnstrandedReadsAssigned:11354268 PositiveStrandReadsAssigned:156484 NegativeStrandReadsAssigned:11407183 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917549 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917549-trimmed-pair1.fastq SRR12917549-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,688,873 reads, 11,392,371 reads pseudoaligned [quant] estimated average fragment length: 260.152 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52401 SRR12917549.ke.tsv 34699 SRR12917549.se.tsv 87100 total ==> SRR12917549.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.85 235 11.2227 Potri.005G024800.1.v4.1 1035 775.848 140 15.1569 Potri.004G059700.1.v4.1 961 702.088 39 4.66586 Potri.007G009000.2.v4.1 1416 1156.85 0 0 Potri.003G141000.2.v4.1 2943 2683.85 381 11.9241 Potri.016G087400.1.v4.1 270 85.944 401.056 391.966 Potri.015G069301.1.v4.1 564 321.354 0 0 Potri.010G195200.1.v4.1 1773 1513.85 16 0.88776 Potri.012G127500.1.v4.1 977 717.987 397 46.4443 ==> SRR12917549.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 208 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 107 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12917549 completed mapping pipeline successfully