Starting /dee2/code/volunteer_pipeline.sh SRR12917550 current disk space = 3091091730432 free memory = 1449770888 SRR12917550 SRAfilesize ba610ea6eccd95da57742bc4719ce4f1 SRR12917550.sra SRR12917550.sra file validated SRR12917550 is paired end SRR12917550 is conventional basespace SRR12917550 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917550_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6295 37.0 37.0 37.0 37.0 37.0 2 36.407 37.0 37.0 37.0 37.0 37.0 3 36.584 37.0 37.0 37.0 37.0 37.0 4 36.696 37.0 37.0 37.0 37.0 37.0 5 36.676 37.0 37.0 37.0 37.0 37.0 6 36.6505 37.0 37.0 37.0 37.0 37.0 7 36.5845 37.0 37.0 37.0 37.0 37.0 8 36.621 37.0 37.0 37.0 37.0 37.0 9 36.6325 37.0 37.0 37.0 37.0 37.0 10-14 36.6164 37.0 37.0 37.0 37.0 37.0 15-19 36.581 37.0 37.0 37.0 37.0 37.0 20-24 36.5606 37.0 37.0 37.0 37.0 37.0 25-29 36.4935 37.0 37.0 37.0 37.0 37.0 30-34 36.4442 37.0 37.0 37.0 37.0 37.0 35-39 36.459199999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.44200000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3717 37.0 37.0 37.0 37.0 37.0 50-54 36.361000000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3072 37.0 37.0 37.0 37.0 37.0 60-64 36.2918 37.0 37.0 37.0 37.0 37.0 65-69 36.2347 37.0 37.0 37.0 37.0 37.0 70-74 36.307599999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.2874 37.0 37.0 37.0 37.0 37.0 80-84 36.2733 37.0 37.0 37.0 37.0 37.0 85-89 36.193999999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.160799999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.121500000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.098299999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.05559999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.0105 37.0 37.0 37.0 37.0 37.0 115-119 35.9246 37.0 37.0 37.0 37.0 37.0 120-124 35.8918 37.0 37.0 37.0 37.0 37.0 125-129 35.7836 37.0 37.0 37.0 37.0 37.0 130-134 35.695100000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.6524 37.0 37.0 37.0 37.0 37.0 140-144 35.33 37.0 37.0 37.0 34.6 37.0 145-149 35.29780000000001 37.0 37.0 37.0 34.6 37.0 150-151 35.0005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 3.0 22 1.0 23 1.0 24 1.0 25 5.0 26 5.0 27 9.0 28 7.0 29 22.0 30 33.0 31 34.0 32 50.0 33 98.0 34 143.0 35 369.0 36 2891.0 37 328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.19609804902451 12.481240620310155 5.502751375687844 39.81990995497749 2 18.775 12.125 38.925 30.175 3 16.175 16.475 29.4 37.95 4 22.0 23.95 23.225 30.825000000000003 5 23.3 31.1 23.25 22.35 6 19.625 32.65 24.8 22.925 7 15.35 26.400000000000002 40.75 17.5 8 16.25 25.25 34.325 24.175 9 16.825000000000003 23.3 35.925000000000004 23.95 10-14 19.220000000000002 30.220000000000002 27.87 22.689999999999998 15-19 19.445 27.735 28.07 24.75 20-24 19.830000000000002 28.23 28.215 23.724999999999998 25-29 19.634999999999998 27.845 28.305000000000003 24.215 30-34 19.785 28.875 27.325 24.015 35-39 19.41 28.015 28.360000000000003 24.215 40-44 19.435 28.994999999999997 28.26 23.31 45-49 19.439999999999998 28.96 27.855 23.745 50-54 19.869999999999997 28.660000000000004 27.54 23.93 55-59 20.02 28.185 28.08 23.715 60-64 20.25 28.470000000000002 27.265 24.015 65-69 19.509999999999998 28.375 28.155 23.96 70-74 19.71 28.189999999999998 27.505000000000003 24.595 75-79 19.775000000000002 28.79 27.175 24.26 80-84 20.169999999999998 28.15 27.6 24.08 85-89 20.04 28.384999999999998 27.625 23.95 90-94 20.57 28.439999999999998 27.425 23.565 95-99 20.645 28.04 27.365000000000002 23.95 100-104 20.735 28.799999999999997 26.775 23.69 105-109 20.549999999999997 28.075 27.26 24.115000000000002 110-114 20.880000000000003 28.32 26.75 24.05 115-119 20.535 28.77 26.755000000000003 23.94 120-124 20.895 28.804999999999996 26.135 24.165 125-129 20.7 28.035 26.889999999999997 24.375 130-134 20.815 28.549999999999997 26.889999999999997 23.745 135-139 20.535 28.075 26.790000000000003 24.6 140-144 21.17 27.779999999999998 26.415 24.635 145-149 21.515 27.794999999999998 26.21 24.48 150-151 21.1875 28.012500000000003 26.375 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.5 19 1.5 20 1.5 21 1.0 22 0.0 23 2.5 24 4.0 25 3.0 26 2.0 27 5.0 28 11.0 29 14.5 30 22.5 31 27.0 32 29.0 33 38.5 34 48.5 35 67.0 36 90.0 37 109.5 38 133.0 39 154.0 40 170.5 41 217.0 42 255.5 43 250.5 44 261.0 45 271.5 46 267.5 47 261.5 48 224.5 49 190.5 50 183.5 51 163.5 52 129.5 53 91.0 54 67.5 55 51.0 56 34.5 57 27.5 58 26.5 59 27.5 60 20.0 61 11.5 62 6.5 63 5.0 64 2.0 65 3.0 66 5.0 67 3.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.525 #Duplication Level Percentage of deduplicated Percentage of total 1 92.81275330991625 85.875 2 6.45771413131586 11.95 3 0.5674142123750339 1.575 4 0.1621183463928668 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.5375 0.0 0.0 0.0 0.0 80-81 0.65 0.0 0.0 0.0 0.0 82-83 0.7875000000000001 0.0 0.0 0.0 0.0 84-85 0.925 0.0 0.0 0.0 0.0 86-87 1.1625 0.0 0.0 0.0 0.0 88-89 1.375 0.0 0.0 0.0 0.0 90-91 1.65 0.0 0.0 0.0 0.0 92-93 1.9125 0.0 0.0 0.0 0.0 94-95 2.2375 0.0 0.0 0.0 0.0 96-97 2.675 0.0 0.0 0.0 0.0 98-99 2.9375 0.0 0.0 0.0 0.0 100-101 3.2750000000000004 0.0 0.0 0.0 0.0 102-103 3.5875 0.0 0.0 0.0 0.0 104-105 3.9250000000000003 0.0 0.0 0.0 0.0 106-107 4.2875 0.0 0.0 0.0 0.0 108-109 4.637499999999999 0.0 0.0 0.0 0.0 110-111 5.0625 0.0 0.0 0.0 0.0 112-113 5.625 0.0 0.0 0.0 0.0 114-115 6.225 0.0 0.0 0.0 0.0 116-117 6.699999999999999 0.0 0.0 0.0 0.0 118-119 7.275 0.0 0.0 0.0 0.0 120-121 7.825 0.0 0.0 0.0 0.0 122-123 8.5125 0.0 0.0 0.0 0.0 124-125 9.45 0.0 0.0 0.0 0.0 126-127 10.175 0.0 0.0 0.0 0.0 128-129 10.75 0.0 0.0 0.0 0.0 130-131 11.2625 0.0 0.0 0.0 0.0 132-133 11.8625 0.0 0.0 0.0 0.0 134-135 12.8 0.0 0.0 0.0 0.0 136-137 13.825 0.0 0.0 0.0 0.0 138-139 14.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCCTTA 10 0.006830828 145.0 2 >>END_MODULE SRR12917550 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917550_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4535 37.0 37.0 37.0 37.0 37.0 2 36.3035 37.0 37.0 37.0 37.0 37.0 3 36.3095 37.0 37.0 37.0 37.0 37.0 4 36.4015 37.0 37.0 37.0 37.0 37.0 5 36.385 37.0 37.0 37.0 37.0 37.0 6 36.325 37.0 37.0 37.0 37.0 37.0 7 36.2995 37.0 37.0 37.0 37.0 37.0 8 36.477 37.0 37.0 37.0 37.0 37.0 9 36.4195 37.0 37.0 37.0 37.0 37.0 10-14 36.3832 37.0 37.0 37.0 37.0 37.0 15-19 36.3779 37.0 37.0 37.0 37.0 37.0 20-24 36.331199999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.258500000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.169799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.1513 37.0 37.0 37.0 37.0 37.0 40-44 36.1107 37.0 37.0 37.0 37.0 37.0 45-49 36.1019 37.0 37.0 37.0 37.0 37.0 50-54 36.076800000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.035900000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.078700000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.0544 37.0 37.0 37.0 37.0 37.0 70-74 36.0049 37.0 37.0 37.0 37.0 37.0 75-79 35.928999999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.9772 37.0 37.0 37.0 37.0 37.0 85-89 36.0039 37.0 37.0 37.0 37.0 37.0 90-94 35.9598 37.0 37.0 37.0 37.0 37.0 95-99 35.888400000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.840599999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.81869999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.7764 37.0 37.0 37.0 37.0 37.0 115-119 35.6811 37.0 37.0 37.0 37.0 37.0 120-124 35.466699999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.4834 37.0 37.0 37.0 37.0 37.0 130-134 35.320100000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.197500000000005 37.0 37.0 37.0 29.8 37.0 140-144 34.9847 37.0 37.0 37.0 25.0 37.0 145-149 34.749900000000004 37.0 37.0 37.0 25.0 37.0 150-151 34.29975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 1.0 17 1.0 18 2.0 19 2.0 20 1.0 21 2.0 22 2.0 23 4.0 24 8.0 25 7.0 26 5.0 27 7.0 28 15.0 29 16.0 30 21.0 31 45.0 32 77.0 33 101.0 34 218.0 35 618.0 36 2652.0 37 192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.675 25.55 9.4 26.375 2 27.775 27.075 30.825000000000003 14.325 3 18.875 28.9 33.15 19.075 4 24.025 33.45 23.95 18.575 5 25.25 38.025 21.875 14.85 6 19.875 38.35 23.375 18.4 7 20.599999999999998 21.925 38.85 18.625 8 20.225 25.45 30.325000000000003 24.0 9 21.725 25.025 30.099999999999998 23.150000000000002 10-14 22.915 29.310000000000002 27.18 20.595 15-19 23.32 28.725 27.47 20.485 20-24 22.945 28.439999999999998 27.705000000000002 20.91 25-29 23.085 28.000000000000004 28.035 20.880000000000003 30-34 23.285 28.37 27.939999999999998 20.405 35-39 23.419999999999998 27.705000000000002 28.055000000000003 20.82 40-44 23.985 27.084999999999997 28.12 20.810000000000002 45-49 23.515 27.694999999999997 28.325 20.465 50-54 23.555 28.04 27.575 20.830000000000002 55-59 23.52 27.955000000000002 27.894999999999996 20.630000000000003 60-64 23.544999999999998 28.249999999999996 27.495000000000005 20.71 65-69 23.805 28.37 27.48 20.345 70-74 23.880000000000003 28.59 27.689999999999998 19.84 75-79 24.04 27.425 28.115000000000002 20.419999999999998 80-84 23.595 28.325 27.175 20.905 85-89 24.33 27.544999999999998 27.915 20.21 90-94 23.91 27.715 27.58 20.794999999999998 95-99 24.255 27.915 27.33 20.5 100-104 24.22 28.060000000000002 27.52 20.200000000000003 105-109 24.595 27.860000000000003 27.215 20.330000000000002 110-114 24.325 28.42 26.55 20.705000000000002 115-119 25.355 27.395000000000003 27.425 19.825 120-124 25.005 28.244999999999997 26.765 19.985 125-129 25.4 28.365000000000002 26.669999999999998 19.564999999999998 130-134 26.795 28.4 25.89 18.915000000000003 135-139 26.279999999999998 27.744999999999997 26.729999999999997 19.245 140-144 26.955000000000002 27.689999999999998 26.505000000000003 18.85 145-149 28.32 27.250000000000004 25.91 18.52 150-151 28.3375 27.1375 25.837500000000002 18.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 3.5 26 5.0 27 3.0 28 5.0 29 9.5 30 20.0 31 23.0 32 26.0 33 37.5 34 43.5 35 63.0 36 89.5 37 107.5 38 128.5 39 167.5 40 203.5 41 244.5 42 275.0 43 275.5 44 265.0 45 267.5 46 265.5 47 249.5 48 231.5 49 194.5 50 168.5 51 141.0 52 107.0 53 83.5 54 62.0 55 50.0 56 49.0 57 35.0 58 21.5 59 17.5 60 11.5 61 8.5 62 4.5 63 3.0 64 3.0 65 1.5 66 3.5 67 4.5 68 2.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.875 #Duplication Level Percentage of deduplicated Percentage of total 1 93.0013458950202 86.375 2 6.433378196500674 11.95 3 0.4576043068640646 1.275 4 0.10767160161507401 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.5375 0.0 0.0 0.0 0.0 80-81 0.65 0.0 0.0 0.0 0.0 82-83 0.7875000000000001 0.0 0.0 0.0 0.0 84-85 0.925 0.0 0.0 0.0 0.0 86-87 1.1625 0.0 0.0 0.0 0.0 88-89 1.375 0.0 0.0 0.0 0.0 90-91 1.65 0.0 0.0 0.0 0.0 92-93 1.9125 0.0 0.0 0.0 0.0 94-95 2.2874999999999996 0.0 0.0 0.0 0.0 96-97 2.7249999999999996 0.0 0.0 0.0 0.0 98-99 2.9875 0.0 0.0 0.025 0.0 100-101 3.325 0.0 0.0 0.025 0.0 102-103 3.6375 0.0 0.0 0.025 0.0 104-105 4.0 0.0 0.0 0.025 0.0 106-107 4.3625 0.0 0.0 0.025 0.0 108-109 4.7125 0.0 0.0 0.025 0.0 110-111 5.15 0.0 0.0 0.025 0.0 112-113 5.725 0.0 0.0 0.025 0.0 114-115 6.325 0.0 0.0 0.025 0.0 116-117 6.85 0.0 0.0 0.025 0.0 118-119 7.4375 0.0 0.0 0.025 0.0 120-121 8.0125 0.0 0.0 0.025 0.0 122-123 8.7125 0.0 0.0 0.025 0.0 124-125 9.649999999999999 0.0 0.0 0.025 0.0 126-127 10.4125 0.0 0.0 0.025 0.0 128-129 11.025 0.0 0.0 0.025 0.0 130-131 11.575 0.0 0.0 0.025 0.0 132-133 12.1875 0.0 0.0 0.025 0.0 134-135 13.149999999999999 0.0 0.0 0.025 0.0 136-137 14.212499999999999 0.0 0.0 0.025 0.0 138-139 15.025 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463787 spots for SRR12917550.sra Written 463787 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra Read 463768 spots for SRR12917550.sra Written 463768 spots for SRR12917550.sra SRR ids: ['SRR12917550.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5bf28jix SRR12917550.sra spots: 9275379 blocks: [[1, 463768], [463769, 927536], [927537, 1391304], [1391305, 1855072], [1855073, 2318840], [2318841, 2782608], [2782609, 3246376], [3246377, 3710144], [3710145, 4173912], [4173913, 4637680], [4637681, 5101448], [5101449, 5565216], [5565217, 6028984], [6028985, 6492752], [6492753, 6956520], [6956521, 7420288], [7420289, 7884056], [7884057, 8347824], [8347825, 8811592], [8811593, 9275379]] SRR12917550 file size 3131894 SRR12917550 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917550 SRR12917550_1.fastq SRR12917550_2.fastq Input file: SRR12917550_1.fastq Paired file: SRR12917550_2.fastq trimmed: SRR12917550-trimmed-pair1.fastq, SRR12917550-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:18:23 2025 >> started Thu Feb 13 13:18:33 2025 >> done (10.218s) 9275379 read pairs processed; of these: 84 ( 0.00%) short read pairs filtered out after trimming by size control 2400 ( 0.03%) empty read pairs filtered out after trimming by size control 9272895 (99.97%) read pairs available; of these: 1945145 (20.98%) trimmed read pairs available after processing 7327750 (79.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 6 0.00% 21 3 0.00% 22 6 0.00% 23 9 0.00% 24 13 0.00% 25 15 0.00% 26 9 0.00% 27 9 0.00% 28 8 0.00% 29 7 0.00% 30 8 0.00% 31 15 0.00% 32 16 0.00% 33 16 0.00% 34 11 0.00% 35 12 0.00% 36 25 0.00% 37 20 0.00% 38 26 0.00% 39 26 0.00% 40 39 0.00% 41 31 0.00% 42 30 0.00% 43 31 0.00% 44 49 0.00% 45 54 0.00% 46 49 0.00% 47 60 0.00% 48 77 0.00% 49 103 0.00% 50 93 0.00% 51 114 0.00% 52 153 0.00% 53 156 0.00% 54 156 0.00% 55 206 0.00% 56 224 0.00% 57 241 0.00% 58 308 0.00% 59 378 0.00% 60 447 0.00% 61 518 0.01% 62 646 0.01% 63 719 0.01% 64 813 0.01% 65 928 0.01% 66 990 0.01% 67 1161 0.01% 68 1368 0.01% 69 1520 0.02% 70 1751 0.02% 71 2030 0.02% 72 2283 0.02% 73 2722 0.03% 74 3040 0.03% 75 3360 0.04% 76 4043 0.04% 77 4148 0.04% 78 4436 0.05% 79 5120 0.06% 80 5418 0.06% 81 5944 0.06% 82 6680 0.07% 83 7081 0.08% 84 8105 0.09% 85 9102 0.10% 86 9653 0.10% 87 9995 0.11% 88 10759 0.12% 89 11128 0.12% 90 11596 0.13% 91 12161 0.13% 92 13146 0.14% 93 14386 0.16% 94 15283 0.16% 95 16186 0.17% 96 16917 0.18% 97 17708 0.19% 98 18184 0.20% 99 18649 0.20% 100 19135 0.21% 101 19703 0.21% 102 20336 0.22% 103 21640 0.23% 104 22375 0.24% 105 23151 0.25% 106 24350 0.26% 107 24808 0.27% 108 25608 0.28% 109 26059 0.28% 110 25766 0.28% 111 26416 0.28% 112 26776 0.29% 113 27246 0.29% 114 28460 0.31% 115 29227 0.32% 116 30081 0.32% 117 30806 0.33% 118 31625 0.34% 119 31391 0.34% 120 32045 0.35% 121 32256 0.35% 122 32030 0.35% 123 32739 0.35% 124 33429 0.36% 125 33625 0.36% 126 34762 0.37% 127 35249 0.38% 128 36171 0.39% 129 36239 0.39% 130 36472 0.39% 131 36228 0.39% 132 36588 0.39% 133 36720 0.40% 134 36724 0.40% 135 37168 0.40% 136 37821 0.41% 137 38548 0.42% 138 38763 0.42% 139 38559 0.42% 140 39183 0.42% 141 39546 0.43% 142 39581 0.43% 143 38817 0.42% 144 39675 0.43% 145 38987 0.42% 146 39653 0.43% 147 39181 0.42% 148 39921 0.43% 149 40132 0.43% 150 40431 0.44% 151 7327750 79.02% 9272895 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=34 prefix-density=0.57 prefix-fanout=2.2 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCCAGAGTCTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=59.76 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=6.7 sequence=CAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACTTG criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=32 prefix-density=0.54 prefix-fanout=1.9 sequence=CATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTACCTCTGATGTCAACGAAAGGGCTCTGCAAGACTCTGGACTCTATAGCCCTGACAGTGAAGACTCTTCTGTTGACATTGCGGGCAGAAGGTTCCATAGCGGGACACTAAACGGTTCTTCTATTGTATATGTCAAGACAGGGAGTCCTTCAGTAAATATGGCAACAACTTTGCAAATCCTTTTAGCTAGATTCAGCATTCACGGAGTCATCTATTTTGGGAATGCTGGAAGCTTGGATAAGAAAACAATGGTTCCAGGTGATGTTTCTGTGCCGCAGGCTGTTGCCTTCACAGGAGTTTGGAACTGGAAGAAATTCGGATCGGAGAAAGGTAAACTGGTATTTGGAGATTTCAATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=85.74 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=1.9 sequence=GTTGCATTTCTAAAGTACTATCCGTCTGCTCAATCCACTTCACACAATGTCGAGTATCAATTTGGCA SRR12917550 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:19:18 Started mapping on | Feb 13 13:19:18 Finished on | Feb 13 13:20:23 Mapping speed, Million of reads per hour | 513.58 Number of input reads | 9272895 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 8686013 Uniquely mapped reads % | 93.67% Average mapped length | 288.67 Number of splices: Total | 7863196 Number of splices: Annotated (sjdb) | 7693942 Number of splices: GT/AG | 7720469 Number of splices: GC/AG | 111086 Number of splices: AT/AC | 7360 Number of splices: Non-canonical | 24281 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.03% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 259716 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 38295 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 327166 327166 327166 N_multimapping 259716 259716 259716 N_noFeature 317432 8573717 371919 N_ambiguous 112452 415 54440 UnstrandedReadsAssigned:8256129 PositiveStrandReadsAssigned:111881 NegativeStrandReadsAssigned:8259654 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR12917550 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917550-trimmed-pair1.fastq SRR12917550-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,272,895 reads, 8,289,912 reads pseudoaligned [quant] estimated average fragment length: 225.608 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR12917550.ke.tsv 34699 SRR12917550.se.tsv 87100 total ==> SRR12917550.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.39 295 21.4453 Potri.005G024800.1.v4.1 1035 810.392 93 14.9614 Potri.004G059700.1.v4.1 961 736.486 9 1.59318 Potri.007G009000.2.v4.1 1416 1191.39 0 0 Potri.003G141000.2.v4.1 2943 2718.39 345.423 16.5663 Potri.016G087400.1.v4.1 270 102.007 710 907.432 Potri.015G069301.1.v4.1 564 350.073 0 0 Potri.010G195200.1.v4.1 1773 1548.39 33 2.77855 Potri.012G127500.1.v4.1 977 752.432 4643 804.483 ==> SRR12917550.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 48 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 130 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12917550 completed mapping pipeline successfully