Starting /dee2/code/volunteer_pipeline.sh SRR12917551 current disk space = 3090844897280 free memory = 1422920536 SRR12917551 SRAfilesize fb00138e2f876caffa7a6b7ef23516dc SRR12917551.sra SRR12917551.sra file validated SRR12917551 is paired end SRR12917551 is conventional basespace SRR12917551 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917551_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.72 37.0 37.0 37.0 37.0 37.0 2 36.582 37.0 37.0 37.0 37.0 37.0 3 36.631 37.0 37.0 37.0 37.0 37.0 4 36.75 37.0 37.0 37.0 37.0 37.0 5 36.686 37.0 37.0 37.0 37.0 37.0 6 36.693 37.0 37.0 37.0 37.0 37.0 7 36.5525 37.0 37.0 37.0 37.0 37.0 8 36.677 37.0 37.0 37.0 37.0 37.0 9 36.6075 37.0 37.0 37.0 37.0 37.0 10-14 36.635200000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.6342 37.0 37.0 37.0 37.0 37.0 20-24 36.573899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.5327 37.0 37.0 37.0 37.0 37.0 30-34 36.4836 37.0 37.0 37.0 37.0 37.0 35-39 36.503 37.0 37.0 37.0 37.0 37.0 40-44 36.4738 37.0 37.0 37.0 37.0 37.0 45-49 36.41689999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.4372 37.0 37.0 37.0 37.0 37.0 55-59 36.395300000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.3361 37.0 37.0 37.0 37.0 37.0 65-69 36.28959999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.3305 37.0 37.0 37.0 37.0 37.0 75-79 36.300599999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3617 37.0 37.0 37.0 37.0 37.0 85-89 36.26090000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.2555 37.0 37.0 37.0 37.0 37.0 95-99 36.227399999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2141 37.0 37.0 37.0 37.0 37.0 105-109 36.1736 37.0 37.0 37.0 37.0 37.0 110-114 36.1075 37.0 37.0 37.0 37.0 37.0 115-119 36.09349999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.06400000000001 37.0 37.0 37.0 37.0 37.0 125-129 36.0004 37.0 37.0 37.0 37.0 37.0 130-134 35.87220000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.9089 37.0 37.0 37.0 37.0 37.0 140-144 35.7035 37.0 37.0 37.0 37.0 37.0 145-149 35.6356 37.0 37.0 37.0 37.0 37.0 150-151 35.36175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 4.0 23 1.0 24 3.0 25 4.0 26 5.0 27 4.0 28 7.0 29 12.0 30 28.0 31 30.0 32 44.0 33 62.0 34 112.0 35 328.0 36 3021.0 37 334.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.870935467733865 13.781890945472735 6.8534267133566775 37.49374687343672 2 20.025000000000002 11.575000000000001 36.725 31.674999999999997 3 17.474999999999998 16.275000000000002 26.85 39.4 4 20.95 20.849999999999998 24.75 33.45 5 24.5 29.225 21.95 24.325 6 21.175 32.925 22.55 23.35 7 16.425 29.5 38.525 15.55 8 16.1 28.050000000000004 31.324999999999996 24.525 9 17.724999999999998 22.575 35.4 24.3 10-14 19.39 30.03 27.155 23.425 15-19 20.635 28.525 27.125 23.715 20-24 20.4 28.345 27.355 23.9 25-29 20.150000000000002 27.939999999999998 27.3 24.610000000000003 30-34 20.125 28.38 27.089999999999996 24.404999999999998 35-39 20.57 27.794999999999998 26.865 24.77 40-44 20.49 28.115000000000002 27.169999999999998 24.224999999999998 45-49 20.544999999999998 27.865000000000002 27.61 23.98 50-54 20.82 27.615000000000002 27.32 24.245 55-59 20.495 27.725 27.32 24.46 60-64 20.424999999999997 27.775 27.125 24.675 65-69 20.294999999999998 27.46 27.715 24.529999999999998 70-74 20.64 28.555000000000003 26.495 24.310000000000002 75-79 21.42 27.92 27.034999999999997 23.625 80-84 20.235 27.779999999999998 26.85 25.135 85-89 21.2 28.02 26.75 24.03 90-94 21.67 26.945000000000004 27.405 23.98 95-99 20.845 27.735 27.37 24.05 100-104 20.77 27.884999999999998 26.755000000000003 24.59 105-109 20.5 27.72 27.095000000000002 24.685000000000002 110-114 21.47 26.900000000000002 27.505000000000003 24.125 115-119 21.41 28.185 26.55 23.855 120-124 21.15 27.939999999999998 26.505000000000003 24.404999999999998 125-129 21.404999999999998 27.32 26.784999999999997 24.490000000000002 130-134 21.555 27.73 26.805 23.91 135-139 21.525 27.884999999999998 26.58 24.01 140-144 21.315 27.884999999999998 26.165 24.635 145-149 21.565 28.09 25.790000000000003 24.555 150-151 20.95 27.900000000000002 26.5125 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 1.5 25 3.5 26 3.5 27 4.0 28 5.5 29 11.0 30 15.0 31 20.5 32 26.0 33 37.5 34 50.0 35 60.5 36 72.0 37 92.0 38 120.5 39 130.5 40 140.0 41 174.5 42 202.5 43 229.0 44 245.0 45 262.0 46 255.5 47 243.0 48 257.0 49 232.5 50 203.0 51 174.0 52 134.5 53 128.5 54 117.0 55 77.5 56 56.0 57 53.5 58 37.0 59 24.5 60 27.0 61 21.5 62 16.0 63 5.5 64 5.5 65 5.5 66 4.0 67 4.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.02229654403567 80.75 2 8.695652173913043 15.6 3 1.0590858416945375 2.85 4 0.2229654403567447 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1375 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 1.95 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.9 0.0 0.0 0.0 0.0 112-113 3.1500000000000004 0.0 0.0 0.0 0.0 114-115 3.4375 0.0 0.0 0.0 0.0 116-117 3.8125 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.525 0.0 0.0 0.0 0.0 122-123 4.875 0.0 0.0 0.0 0.0 124-125 5.262499999999999 0.0 0.0 0.0 0.0 126-127 5.7 0.0 0.0 0.0 0.0 128-129 6.3375 0.0 0.0 0.0 0.0 130-131 6.675 0.0 0.0 0.0 0.0 132-133 7.4625 0.0 0.0 0.0 0.0 134-135 8.1 0.0 0.0 0.0 0.0 136-137 8.6875 0.0 0.0 0.0 0.0 138-139 9.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACAAAA 10 0.006830828 145.0 7 >>END_MODULE SRR12917551 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917551_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.391 37.0 37.0 37.0 37.0 37.0 2 36.4085 37.0 37.0 37.0 37.0 37.0 3 36.374 37.0 37.0 37.0 37.0 37.0 4 36.3305 37.0 37.0 37.0 37.0 37.0 5 36.378 37.0 37.0 37.0 37.0 37.0 6 36.3125 37.0 37.0 37.0 37.0 37.0 7 36.304 37.0 37.0 37.0 37.0 37.0 8 36.3185 37.0 37.0 37.0 37.0 37.0 9 36.47 37.0 37.0 37.0 37.0 37.0 10-14 36.38190000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.382 37.0 37.0 37.0 37.0 37.0 20-24 36.2744 37.0 37.0 37.0 37.0 37.0 25-29 36.2318 37.0 37.0 37.0 37.0 37.0 30-34 36.1384 37.0 37.0 37.0 37.0 37.0 35-39 36.1274 37.0 37.0 37.0 37.0 37.0 40-44 36.1126 37.0 37.0 37.0 37.0 37.0 45-49 36.0604 37.0 37.0 37.0 37.0 37.0 50-54 35.9884 37.0 37.0 37.0 37.0 37.0 55-59 35.991600000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.0326 37.0 37.0 37.0 37.0 37.0 65-69 35.9647 37.0 37.0 37.0 37.0 37.0 70-74 35.9522 37.0 37.0 37.0 37.0 37.0 75-79 35.88680000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.9353 37.0 37.0 37.0 37.0 37.0 85-89 35.978100000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.9223 37.0 37.0 37.0 37.0 37.0 95-99 35.8851 37.0 37.0 37.0 37.0 37.0 100-104 35.8678 37.0 37.0 37.0 37.0 37.0 105-109 35.815000000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.7324 37.0 37.0 37.0 37.0 37.0 115-119 35.7237 37.0 37.0 37.0 37.0 37.0 120-124 35.6057 37.0 37.0 37.0 37.0 37.0 125-129 35.64149999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.3994 37.0 37.0 37.0 37.0 37.0 135-139 35.3301 37.0 37.0 37.0 37.0 37.0 140-144 35.1671 37.0 37.0 37.0 32.2 37.0 145-149 34.9556 37.0 37.0 37.0 27.4 37.0 150-151 34.4555 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 3.0 16 3.0 17 2.0 18 1.0 19 0.0 20 2.0 21 4.0 22 3.0 23 8.0 24 4.0 25 4.0 26 7.0 27 4.0 28 17.0 29 17.0 30 29.0 31 37.0 32 44.0 33 109.0 34 205.0 35 562.0 36 2737.0 37 193.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.625 25.974999999999998 9.4 26.0 2 29.849999999999998 25.025 28.4 16.725 3 20.775 28.875 31.674999999999997 18.675 4 24.525 33.775 23.3 18.4 5 27.650000000000002 35.075 20.175 17.1 6 21.4 38.9 20.974999999999998 18.725 7 20.974999999999998 23.974999999999998 34.55 20.5 8 22.525000000000002 25.174999999999997 28.775000000000002 23.525 9 23.225 23.45 29.849999999999998 23.474999999999998 10-14 23.94 29.07 25.605 21.385 15-19 23.31 27.88 27.38 21.43 20-24 23.77 28.455000000000002 26.669999999999998 21.105 25-29 23.849999999999998 28.849999999999998 26.529999999999998 20.77 30-34 23.26 27.96 26.905 21.875 35-39 23.76 28.22 26.575 21.445 40-44 23.599999999999998 27.650000000000002 27.155 21.595 45-49 23.14 27.295 27.834999999999997 21.73 50-54 24.315 27.52 26.97 21.195 55-59 23.98 27.939999999999998 26.815 21.265 60-64 23.335 27.21 27.189999999999998 22.264999999999997 65-69 24.610000000000003 26.805 27.0 21.584999999999997 70-74 24.59 27.74 26.095000000000002 21.575 75-79 23.369999999999997 27.700000000000003 26.97 21.959999999999997 80-84 24.43 28.18 25.945 21.445 85-89 24.43 27.3 26.534999999999997 21.735 90-94 24.395 27.765 26.11 21.73 95-99 24.875 27.250000000000004 26.565 21.310000000000002 100-104 24.015 27.560000000000002 27.235 21.19 105-109 24.525 27.084999999999997 26.884999999999998 21.505 110-114 23.974999999999998 27.725 27.76 20.54 115-119 24.98 27.495000000000005 26.465 21.060000000000002 120-124 24.265 28.105000000000004 26.33 21.3 125-129 25.45 27.565 26.035000000000004 20.95 130-134 25.335 27.639999999999997 26.045 20.979999999999997 135-139 25.729999999999997 27.005000000000003 26.840000000000003 20.424999999999997 140-144 26.815 27.16 26.16 19.865 145-149 27.26 26.924999999999997 25.465 20.349999999999998 150-151 26.987499999999997 26.85 26.5125 19.650000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 1.5 18 1.0 19 1.0 20 1.0 21 0.5 22 1.0 23 1.5 24 1.5 25 1.5 26 1.0 27 2.0 28 2.5 29 3.5 30 10.0 31 13.5 32 15.0 33 23.0 34 37.0 35 53.0 36 78.0 37 102.5 38 111.0 39 137.0 40 170.0 41 186.0 42 201.5 43 228.0 44 262.5 45 263.0 46 260.0 47 274.0 48 264.0 49 227.5 50 190.5 51 168.5 52 133.5 53 116.5 54 102.5 55 67.5 56 53.0 57 52.0 58 39.0 59 28.5 60 24.0 61 18.0 62 14.5 63 8.5 64 8.5 65 5.0 66 2.0 67 3.5 68 1.5 69 1.5 70 1.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 1.5 88 1.0 89 0.5 90 0.5 91 1.5 92 1.0 93 0.5 94 0.5 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.78801331853496 81.8 2 7.8523862375138735 14.149999999999999 3 1.0821309655937847 2.9250000000000003 4 0.22197558268590456 0.8 5 0.02774694783573807 0.125 6 0.0 0.0 7 0.0 0.0 8 0.02774694783573807 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 1.95 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.9124999999999996 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.4625 0.0 0.0 0.0 0.0 116-117 3.825 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.525 0.0 0.0 0.0 0.0 122-123 4.875 0.0 0.0 0.0 0.0 124-125 5.262499999999999 0.0 0.0 0.0 0.0 126-127 5.7 0.0 0.0 0.0 0.0 128-129 6.3375 0.0 0.0 0.0 0.0 130-131 6.675 0.0 0.0 0.0 0.0 132-133 7.475 0.0 0.0 0.0 0.0 134-135 8.125 0.0 0.0 0.0 0.0 136-137 8.712499999999999 0.0 0.0 0.0 0.0 138-139 9.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599900 spots for SRR12917551.sra Written 599900 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra Read 599894 spots for SRR12917551.sra Written 599894 spots for SRR12917551.sra SRR ids: ['SRR12917551.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0wbvtpo_ SRR12917551.sra spots: 11997886 blocks: [[1, 599894], [599895, 1199788], [1199789, 1799682], [1799683, 2399576], [2399577, 2999470], [2999471, 3599364], [3599365, 4199258], [4199259, 4799152], [4799153, 5399046], [5399047, 5998940], [5998941, 6598834], [6598835, 7198728], [7198729, 7798622], [7798623, 8398516], [8398517, 8998410], [8998411, 9598304], [9598305, 10198198], [10198199, 10798092], [10798093, 11397986], [11397987, 11997886]] SRR12917551 file size 4055706 SRR12917551 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917551 SRR12917551_1.fastq SRR12917551_2.fastq Input file: SRR12917551_1.fastq Paired file: SRR12917551_2.fastq trimmed: SRR12917551-trimmed-pair1.fastq, SRR12917551-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:28:47 2025 >> started Thu Feb 13 13:28:59 2025 >> done (12.748s) 11997886 read pairs processed; of these: 46 ( 0.00%) short read pairs filtered out after trimming by size control 8308 ( 0.07%) empty read pairs filtered out after trimming by size control 11989532 (99.93%) read pairs available; of these: 1646833 (13.74%) trimmed read pairs available after processing 10342699 (86.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 0 0.00% 20 4 0.00% 21 3 0.00% 22 13 0.00% 23 10 0.00% 24 2 0.00% 25 9 0.00% 26 12 0.00% 27 21 0.00% 28 12 0.00% 29 12 0.00% 30 10 0.00% 31 9 0.00% 32 22 0.00% 33 23 0.00% 34 24 0.00% 35 19 0.00% 36 18 0.00% 37 17 0.00% 38 30 0.00% 39 29 0.00% 40 28 0.00% 41 27 0.00% 42 27 0.00% 43 28 0.00% 44 25 0.00% 45 31 0.00% 46 31 0.00% 47 47 0.00% 48 45 0.00% 49 70 0.00% 50 77 0.00% 51 86 0.00% 52 106 0.00% 53 119 0.00% 54 134 0.00% 55 126 0.00% 56 140 0.00% 57 153 0.00% 58 187 0.00% 59 230 0.00% 60 267 0.00% 61 330 0.00% 62 343 0.00% 63 455 0.00% 64 490 0.00% 65 544 0.00% 66 555 0.00% 67 691 0.01% 68 831 0.01% 69 924 0.01% 70 963 0.01% 71 1109 0.01% 72 1371 0.01% 73 1599 0.01% 74 1752 0.01% 75 1964 0.02% 76 2126 0.02% 77 2294 0.02% 78 2555 0.02% 79 2803 0.02% 80 3034 0.03% 81 3438 0.03% 82 3838 0.03% 83 4402 0.04% 84 4861 0.04% 85 5382 0.04% 86 5678 0.05% 87 6187 0.05% 88 6499 0.05% 89 6669 0.06% 90 7092 0.06% 91 7663 0.06% 92 8278 0.07% 93 8833 0.07% 94 9617 0.08% 95 10351 0.09% 96 10730 0.09% 97 11449 0.10% 98 11745 0.10% 99 12484 0.10% 100 12561 0.10% 101 13167 0.11% 102 13543 0.11% 103 14319 0.12% 104 14942 0.12% 105 15987 0.13% 106 16612 0.14% 107 17507 0.15% 108 18038 0.15% 109 18367 0.15% 110 18649 0.16% 111 19468 0.16% 112 19636 0.16% 113 20092 0.17% 114 20961 0.17% 115 22305 0.19% 116 22945 0.19% 117 24193 0.20% 118 24818 0.21% 119 25602 0.21% 120 26493 0.22% 121 26327 0.22% 122 26469 0.22% 123 27124 0.23% 124 28259 0.24% 125 28587 0.24% 126 30279 0.25% 127 30795 0.26% 128 31734 0.26% 129 33004 0.28% 130 33297 0.28% 131 33036 0.28% 132 33987 0.28% 133 34545 0.29% 134 35054 0.29% 135 35334 0.29% 136 36380 0.30% 137 37003 0.31% 138 37453 0.31% 139 39296 0.33% 140 39059 0.33% 141 39614 0.33% 142 40015 0.33% 143 40076 0.33% 144 40681 0.34% 145 41717 0.35% 146 40759 0.34% 147 41764 0.35% 148 42733 0.36% 149 43612 0.36% 150 44416 0.37% 151 10342699 86.26% 11989532 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=12 prefix-density=0.93 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=69.38 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=2.1 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=1.28 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=1.28 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=15.36 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.9 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12917551 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:29:41 Started mapping on | Feb 13 13:29:41 Finished on | Feb 13 13:31:03 Mapping speed, Million of reads per hour | 526.37 Number of input reads | 11989532 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11035545 Uniquely mapped reads % | 92.04% Average mapped length | 293.93 Number of splices: Total | 10509953 Number of splices: Annotated (sjdb) | 10355741 Number of splices: GT/AG | 10280722 Number of splices: GC/AG | 198685 Number of splices: AT/AC | 7137 Number of splices: Non-canonical | 23409 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 319764 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 219857 % of reads mapped to too many loci | 1.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.15% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 634223 634223 634223 N_multimapping 319764 319764 319764 N_noFeature 289455 10890370 328686 N_ambiguous 183955 521 77729 UnstrandedReadsAssigned:10562135 PositiveStrandReadsAssigned:144654 NegativeStrandReadsAssigned:10629130 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917551 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917551-trimmed-pair1.fastq SRR12917551-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,989,532 reads, 10,863,818 reads pseudoaligned [quant] estimated average fragment length: 246.052 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR12917551.ke.tsv 34699 SRR12917551.se.tsv 87100 total ==> SRR12917551.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.95 193 8.44004 Potri.005G024800.1.v4.1 1035 789.948 186 18.2557 Potri.004G059700.1.v4.1 961 716.059 54 5.84694 Potri.007G009000.2.v4.1 1416 1170.95 0 0 Potri.003G141000.2.v4.1 2943 2697.95 286 8.21894 Potri.016G087400.1.v4.1 270 89.9029 703 606.269 Potri.015G069301.1.v4.1 564 330.96 0 0 Potri.010G195200.1.v4.1 1773 1527.95 2 0.101486 Potri.012G127500.1.v4.1 977 731.999 569 60.2678 ==> SRR12917551.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 171 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 98 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12917551 completed mapping pipeline successfully