Starting /dee2/code/volunteer_pipeline.sh SRR12917552 current disk space = 3090793644032 free memory = 1427002572 SRR12917552 SRAfilesize 3387e018b81f7da10e6d8b8069664129 SRR12917552.sra SRR12917552.sra file validated SRR12917552 is paired end SRR12917552 is conventional basespace SRR12917552 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917552_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.54475 37.0 37.0 37.0 37.0 37.0 2 36.42 37.0 37.0 37.0 37.0 37.0 3 36.5485 37.0 37.0 37.0 37.0 37.0 4 36.6685 37.0 37.0 37.0 37.0 37.0 5 36.6595 37.0 37.0 37.0 37.0 37.0 6 36.6455 37.0 37.0 37.0 37.0 37.0 7 36.459 37.0 37.0 37.0 37.0 37.0 8 36.585 37.0 37.0 37.0 37.0 37.0 9 36.6315 37.0 37.0 37.0 37.0 37.0 10-14 36.6111 37.0 37.0 37.0 37.0 37.0 15-19 36.5961 37.0 37.0 37.0 37.0 37.0 20-24 36.581 37.0 37.0 37.0 37.0 37.0 25-29 36.516000000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.487399999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.456300000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4836 37.0 37.0 37.0 37.0 37.0 45-49 36.452099999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.421400000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.374300000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.346199999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.29870000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.2833 37.0 37.0 37.0 37.0 37.0 75-79 36.32340000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.3113 37.0 37.0 37.0 37.0 37.0 85-89 36.260000000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2318 37.0 37.0 37.0 37.0 37.0 95-99 36.1737 37.0 37.0 37.0 37.0 37.0 100-104 36.158 37.0 37.0 37.0 37.0 37.0 105-109 36.044399999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.01389999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.0136 37.0 37.0 37.0 37.0 37.0 120-124 36.0649 37.0 37.0 37.0 37.0 37.0 125-129 35.9938 37.0 37.0 37.0 37.0 37.0 130-134 35.9315 37.0 37.0 37.0 37.0 37.0 135-139 35.861200000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.736900000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.6607 37.0 37.0 37.0 37.0 37.0 150-151 35.3535 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 0.0 23 1.0 24 2.0 25 1.0 26 5.0 27 5.0 28 10.0 29 28.0 30 14.0 31 33.0 32 41.0 33 69.0 34 132.0 35 309.0 36 3043.0 37 305.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.710427606901725 12.303075768942236 5.176294073518379 40.81020255063766 2 17.7 11.05 39.074999999999996 32.175 3 17.0 16.425 26.075 40.5 4 22.275 23.849999999999998 24.125 29.75 5 24.0 29.7 24.6 21.7 6 20.4 32.6 23.549999999999997 23.45 7 14.099999999999998 29.125 39.225 17.549999999999997 8 16.75 24.825 34.849999999999994 23.575 9 16.575 22.525000000000002 38.0 22.900000000000002 10-14 18.94 30.270000000000003 27.785 23.005 15-19 19.37 27.894999999999996 27.96 24.775 20-24 18.905 27.965 28.59 24.54 25-29 19.61 27.950000000000003 28.65 23.79 30-34 19.61 28.01 28.605000000000004 23.775 35-39 19.25 28.275 28.389999999999997 24.085 40-44 19.865 28.005000000000003 28.205000000000002 23.925 45-49 20.064999999999998 28.505000000000003 27.165 24.265 50-54 20.0 28.535 27.855 23.61 55-59 20.54 28.125 27.685 23.65 60-64 19.73 28.904999999999998 27.77 23.595 65-69 19.705000000000002 27.700000000000003 28.37 24.224999999999998 70-74 19.955000000000002 28.754999999999995 27.755000000000003 23.535 75-79 19.634999999999998 28.64 28.34 23.385 80-84 20.380000000000003 27.744999999999997 28.455000000000002 23.419999999999998 85-89 19.7 27.884999999999998 28.1 24.315 90-94 19.885 29.255 26.939999999999998 23.919999999999998 95-99 19.685 28.34 27.46 24.515 100-104 20.555 28.265 27.605 23.575 105-109 20.47 28.34 27.860000000000003 23.330000000000002 110-114 21.21 28.34 27.485 22.965 115-119 20.630000000000003 28.68 27.6 23.09 120-124 20.47 28.294999999999998 27.275 23.96 125-129 20.674999999999997 28.595 27.04 23.69 130-134 20.28 28.67 27.62 23.43 135-139 20.275000000000002 28.575 27.400000000000002 23.75 140-144 20.49 28.345 27.245 23.919999999999998 145-149 20.615 28.37 27.1 23.915 150-151 19.825 28.7 27.237499999999997 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.0 22 0.0 23 1.5 24 3.5 25 4.0 26 7.5 27 8.5 28 8.0 29 16.0 30 19.0 31 21.5 32 29.5 33 34.5 34 48.5 35 62.5 36 80.5 37 98.5 38 119.0 39 152.5 40 195.0 41 213.0 42 225.0 43 277.5 44 293.0 45 279.0 46 279.0 47 275.0 48 254.0 49 212.5 50 179.5 51 147.5 52 114.5 53 89.5 54 65.5 55 45.5 56 34.5 57 25.0 58 18.0 59 17.5 60 10.5 61 5.5 62 4.0 63 3.0 64 5.0 65 4.0 66 1.0 67 1.0 68 1.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.75989085948159 84.075 2 7.503410641200546 13.750000000000002 3 0.6275579809004093 1.725 4 0.08185538881309685 0.3 5 0.0 0.0 6 0.027285129604365622 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCGATTTTGCAGTTGCTTCTCTCGATTTCAGCAATGGGGTCTATCAAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.1125 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 1.8625 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.7249999999999996 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.3625 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 4.137499999999999 0.0 0.0 0.0 0.0 122-123 4.4375 0.0 0.0 0.0 0.0 124-125 4.8625 0.0 0.0 0.0 0.0 126-127 5.4 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.4 0.0 0.0 0.0 0.0 132-133 6.7875 0.0 0.0 0.0 0.0 134-135 7.225 0.0 0.0 0.0 0.0 136-137 7.725 0.0 0.0 0.0 0.0 138-139 8.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAATAT 10 0.006830828 145.0 6 >>END_MODULE SRR12917552 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917552_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3155 37.0 37.0 37.0 37.0 37.0 2 36.2125 37.0 37.0 37.0 37.0 37.0 3 36.199 37.0 37.0 37.0 37.0 37.0 4 36.327 37.0 37.0 37.0 37.0 37.0 5 36.438 37.0 37.0 37.0 37.0 37.0 6 36.3645 37.0 37.0 37.0 37.0 37.0 7 36.35 37.0 37.0 37.0 37.0 37.0 8 36.425 37.0 37.0 37.0 37.0 37.0 9 36.3685 37.0 37.0 37.0 37.0 37.0 10-14 36.4221 37.0 37.0 37.0 37.0 37.0 15-19 36.330499999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.3574 37.0 37.0 37.0 37.0 37.0 25-29 36.2142 37.0 37.0 37.0 37.0 37.0 30-34 36.224000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.1237 37.0 37.0 37.0 37.0 37.0 40-44 36.1392 37.0 37.0 37.0 37.0 37.0 45-49 36.0186 37.0 37.0 37.0 37.0 37.0 50-54 36.038 37.0 37.0 37.0 37.0 37.0 55-59 36.0326 37.0 37.0 37.0 37.0 37.0 60-64 36.048500000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.9949 37.0 37.0 37.0 37.0 37.0 70-74 36.0493 37.0 37.0 37.0 37.0 37.0 75-79 35.9005 37.0 37.0 37.0 37.0 37.0 80-84 35.9174 37.0 37.0 37.0 37.0 37.0 85-89 35.923300000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.9419 37.0 37.0 37.0 37.0 37.0 95-99 35.8747 37.0 37.0 37.0 37.0 37.0 100-104 35.8 37.0 37.0 37.0 37.0 37.0 105-109 35.7633 37.0 37.0 37.0 37.0 37.0 110-114 35.704 37.0 37.0 37.0 37.0 37.0 115-119 35.6642 37.0 37.0 37.0 37.0 37.0 120-124 35.6109 37.0 37.0 37.0 37.0 37.0 125-129 35.5869 37.0 37.0 37.0 37.0 37.0 130-134 35.4975 37.0 37.0 37.0 37.0 37.0 135-139 35.4381 37.0 37.0 37.0 37.0 37.0 140-144 35.2151 37.0 37.0 37.0 32.2 37.0 145-149 35.0942 37.0 37.0 37.0 27.4 37.0 150-151 34.61725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 3.0 17 1.0 18 0.0 19 3.0 20 0.0 21 1.0 22 2.0 23 4.0 24 5.0 25 2.0 26 13.0 27 10.0 28 14.0 29 16.0 30 26.0 31 37.0 32 61.0 33 114.0 34 202.0 35 617.0 36 2660.0 37 207.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.25 23.075000000000003 9.85 26.825 2 26.224999999999998 23.549999999999997 33.85 16.375 3 19.5 26.1 35.275 19.125 4 22.7 34.725 24.125 18.45 5 26.950000000000003 36.975 20.125 15.950000000000001 6 21.125 39.4 22.2 17.275 7 20.0 22.675 39.574999999999996 17.75 8 19.7 25.6 30.925000000000004 23.775 9 22.225 24.025 30.975 22.775000000000002 10-14 22.89 29.154999999999998 27.765 20.19 15-19 23.155 28.43 27.58 20.835 20-24 22.455 28.395 28.24 20.91 25-29 22.835 28.055000000000003 29.12 19.99 30-34 22.689999999999998 28.155 28.194999999999997 20.96 35-39 23.044999999999998 28.065 28.599999999999998 20.29 40-44 23.135 28.16 27.91 20.794999999999998 45-49 22.994999999999997 27.875 28.435 20.695 50-54 22.8 28.470000000000002 27.85 20.880000000000003 55-59 23.669999999999998 27.994999999999997 27.97 20.365 60-64 23.165 28.29 27.655 20.89 65-69 23.47 28.360000000000003 28.225 19.945 70-74 23.355 28.249999999999996 28.225 20.169999999999998 75-79 23.555 28.065 28.01 20.369999999999997 80-84 23.724999999999998 28.305000000000003 27.825 20.145 85-89 23.974999999999998 27.689999999999998 27.91 20.424999999999997 90-94 24.265 27.62 27.595 20.52 95-99 23.669999999999998 28.38 27.565 20.385 100-104 24.224999999999998 28.105000000000004 27.33 20.34 105-109 24.104999999999997 27.625 28.485 19.785 110-114 24.279999999999998 28.215 27.01 20.495 115-119 23.925 28.494999999999997 27.295 20.285 120-124 24.275 28.565 27.48 19.68 125-129 24.335 28.360000000000003 27.105 20.200000000000003 130-134 25.135 28.165000000000003 27.229999999999997 19.470000000000002 135-139 25.34 27.98 27.105 19.575 140-144 25.729999999999997 28.04 26.935 19.295 145-149 26.325 28.660000000000004 26.66 18.355 150-151 27.05 27.575 25.7875 19.5875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.5 16 1.5 17 1.0 18 0.5 19 0.0 20 1.0 21 2.5 22 1.5 23 1.0 24 3.5 25 7.5 26 8.0 27 6.5 28 9.5 29 11.5 30 12.5 31 20.0 32 31.0 33 43.0 34 50.5 35 61.0 36 88.5 37 113.5 38 136.0 39 160.0 40 200.0 41 242.0 42 255.5 43 282.0 44 305.0 45 284.0 46 261.5 47 257.5 48 236.5 49 197.5 50 160.0 51 129.0 52 98.0 53 78.0 54 63.0 55 44.5 56 29.5 57 19.5 58 19.0 59 16.5 60 9.5 61 5.0 62 6.5 63 7.0 64 4.0 65 1.5 66 0.5 67 0.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.43638850889192 83.55 2 7.824897400820793 14.299999999999999 3 0.6566347469220246 1.7999999999999998 4 0.027359781121751026 0.1 5 0.05471956224350205 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAGTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTA 5 0.125 No Hit GTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTACATA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.1125 0.0 0.0 0.0 0.0 100-101 1.2625000000000002 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.8875 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.75 0.0 0.0 0.0 0.0 114-115 3.075 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.775 0.0 0.0 0.0 0.0 120-121 4.199999999999999 0.0 0.0 0.0 0.0 122-123 4.512499999999999 0.0 0.0 0.0 0.0 124-125 4.9375 0.0 0.0 0.0 0.0 126-127 5.475 0.0 0.0 0.0 0.0 128-129 6.0375 0.0 0.0 0.0 0.0 130-131 6.5 0.0 0.0 0.0 0.0 132-133 6.9125 0.0 0.0 0.0 0.0 134-135 7.362500000000001 0.0 0.0 0.0 0.0 136-137 7.875 0.0 0.0 0.0 0.0 138-139 8.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTAAAC 10 0.006830828 145.0 2 GGGGGGG 40 0.0076550315 18.125 140-144 >>END_MODULE Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583082 spots for SRR12917552.sra Written 583082 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra Read 583081 spots for SRR12917552.sra Written 583081 spots for SRR12917552.sra SRR ids: ['SRR12917552.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a27i9omz SRR12917552.sra spots: 11661621 blocks: [[1, 583081], [583082, 1166162], [1166163, 1749243], [1749244, 2332324], [2332325, 2915405], [2915406, 3498486], [3498487, 4081567], [4081568, 4664648], [4664649, 5247729], [5247730, 5830810], [5830811, 6413891], [6413892, 6996972], [6996973, 7580053], [7580054, 8163134], [8163135, 8746215], [8746216, 9329296], [9329297, 9912377], [9912378, 10495458], [10495459, 11078539], [11078540, 11661621]] SRR12917552 file size 3941428 SRR12917552 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917552 SRR12917552_1.fastq SRR12917552_2.fastq Input file: SRR12917552_1.fastq Paired file: SRR12917552_2.fastq trimmed: SRR12917552-trimmed-pair1.fastq, SRR12917552-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:31:15 2025 >> started Thu Feb 13 13:31:28 2025 >> done (12.706s) 11661621 read pairs processed; of these: 142 ( 0.00%) short read pairs filtered out after trimming by size control 1098 ( 0.01%) empty read pairs filtered out after trimming by size control 11660381 (99.99%) read pairs available; of these: 1450527 (12.44%) trimmed read pairs available after processing 10209854 (87.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 12 0.00% 21 5 0.00% 22 9 0.00% 23 9 0.00% 24 12 0.00% 25 7 0.00% 26 9 0.00% 27 7 0.00% 28 19 0.00% 29 19 0.00% 30 19 0.00% 31 12 0.00% 32 15 0.00% 33 10 0.00% 34 17 0.00% 35 21 0.00% 36 12 0.00% 37 17 0.00% 38 22 0.00% 39 14 0.00% 40 28 0.00% 41 24 0.00% 42 25 0.00% 43 28 0.00% 44 23 0.00% 45 28 0.00% 46 34 0.00% 47 33 0.00% 48 37 0.00% 49 50 0.00% 50 76 0.00% 51 70 0.00% 52 79 0.00% 53 99 0.00% 54 112 0.00% 55 108 0.00% 56 139 0.00% 57 166 0.00% 58 198 0.00% 59 190 0.00% 60 232 0.00% 61 289 0.00% 62 352 0.00% 63 430 0.00% 64 433 0.00% 65 499 0.00% 66 544 0.00% 67 683 0.01% 68 758 0.01% 69 901 0.01% 70 979 0.01% 71 1181 0.01% 72 1319 0.01% 73 1524 0.01% 74 1710 0.01% 75 1810 0.02% 76 2085 0.02% 77 2305 0.02% 78 2498 0.02% 79 2679 0.02% 80 3031 0.03% 81 3182 0.03% 82 3624 0.03% 83 3911 0.03% 84 4398 0.04% 85 4836 0.04% 86 5307 0.05% 87 5483 0.05% 88 5820 0.05% 89 6065 0.05% 90 6487 0.06% 91 6848 0.06% 92 7112 0.06% 93 7882 0.07% 94 8554 0.07% 95 8955 0.08% 96 9505 0.08% 97 10148 0.09% 98 10477 0.09% 99 10715 0.09% 100 11031 0.09% 101 11493 0.10% 102 12097 0.10% 103 12669 0.11% 104 13475 0.12% 105 14089 0.12% 106 14809 0.13% 107 15309 0.13% 108 15981 0.14% 109 16120 0.14% 110 16462 0.14% 111 16937 0.15% 112 17405 0.15% 113 17913 0.15% 114 18813 0.16% 115 19512 0.17% 116 19957 0.17% 117 20897 0.18% 118 22053 0.19% 119 21821 0.19% 120 22351 0.19% 121 23060 0.20% 122 23084 0.20% 123 23692 0.20% 124 24510 0.21% 125 25612 0.22% 126 26830 0.23% 127 26744 0.23% 128 27474 0.24% 129 28039 0.24% 130 28915 0.25% 131 29187 0.25% 132 29885 0.26% 133 30273 0.26% 134 30257 0.26% 135 31144 0.27% 136 31964 0.27% 137 33197 0.28% 138 33172 0.28% 139 33953 0.29% 140 34963 0.30% 141 35103 0.30% 142 35565 0.31% 143 34969 0.30% 144 36039 0.31% 145 36074 0.31% 146 37095 0.32% 147 37022 0.32% 148 37448 0.32% 149 38096 0.33% 150 38588 0.33% 151 10209854 87.56% 11660381 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=29 prefix-density=0.49 prefix-fanout=2.3 sequence=GCTTCACTTGGAGAGAACATGTTAATTTTCTCATACTCTACAGTCCCCAACAAGTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATACCAGTTTACCTTTCTCCGATCCGAATTTCTTCCAGTTCCAAACTCCTGTGAAGGCAACAGCCTGCGGCACAGAAACATCACCTGGAACCATTGTTTTCTTATCCAAGCTTCCAGCATTCCCAAAATAGATGACTCCGTGAATGCTGAATCTAACTAGAAGGATTTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=33.25 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.0 sequence=TTATTTATTTAAGCAAAGTACCCAGCAACGCCACACATATGAAAAACAAGTAAGAGACTGGCCATGACATGGTTGCTGCATTTTTCTTTTGCGCGAGTTGCATTATTTCACTAACAAGGCTTGGCGCAAAAACAGCGGCGGCGGAACCCTTTGCATTCACCACCGGGAAAACCTTCAGTCTTGCACACACTAGCACAGTTGTGGCCTCTTACACATGGTCCTTTAAAACTATGGCTCTGTGACAAACAAACCCTAGCCTCAGCAGGTACCATCATTTCCTGGGAAGCCAGGGCAATGAGCAGCAACAAGAAAAGACCATAGCATTTCTTCTCCATCTCTCTGTCTAACAAGAAC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=28 prefix-density=0.49 prefix-fanout=2.5 sequence=CCCAAGGAAGTTTTCTGGCTTCCCATCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=389.36 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=14.1 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCG SRR12917552 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:32:08 Started mapping on | Feb 13 13:32:09 Finished on | Feb 13 13:33:31 Mapping speed, Million of reads per hour | 511.92 Number of input reads | 11660381 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10963363 Uniquely mapped reads % | 94.02% Average mapped length | 294.30 Number of splices: Total | 10012500 Number of splices: Annotated (sjdb) | 9747279 Number of splices: GT/AG | 9813687 Number of splices: GC/AG | 143848 Number of splices: AT/AC | 12363 Number of splices: Non-canonical | 42602 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 3.05 Insertion rate per base | 0.03% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318541 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 30165 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 378477 378477 378477 N_multimapping 318541 318541 318541 N_noFeature 464108 10843277 526901 N_ambiguous 130918 600 73267 UnstrandedReadsAssigned:10368337 PositiveStrandReadsAssigned:119486 NegativeStrandReadsAssigned:10363195 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917552 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917552-trimmed-pair1.fastq SRR12917552-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,660,381 reads, 10,332,812 reads pseudoaligned [quant] estimated average fragment length: 256.174 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR12917552.ke.tsv 34699 SRR12917552.se.tsv 87100 total ==> SRR12917552.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.83 398 23.9579 Potri.005G024800.1.v4.1 1035 779.826 145 19.7308 Potri.004G059700.1.v4.1 961 706.022 30 4.50899 Potri.007G009000.2.v4.1 1416 1160.83 1 0.0914131 Potri.003G141000.2.v4.1 2943 2687.83 409.254 16.1572 Potri.016G087400.1.v4.1 270 89.416 870 1032.47 Potri.015G069301.1.v4.1 564 325.499 0 0 Potri.010G195200.1.v4.1 1773 1517.83 49 3.4257 Potri.012G127500.1.v4.1 977 721.892 5010 736.446 ==> SRR12917552.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 94 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 95 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR12917552 completed mapping pipeline successfully