Starting /dee2/code/volunteer_pipeline.sh SRR12917553 current disk space = 3090962780160 free memory = 1421752092 SRR12917553 SRAfilesize a191d0d22d033b1750c81d5839d10199 SRR12917553.sra SRR12917553.sra file validated SRR12917553 is paired end SRR12917553 is conventional basespace SRR12917553 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917553_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6305 37.0 37.0 37.0 37.0 37.0 2 36.501 37.0 37.0 37.0 37.0 37.0 3 36.598 37.0 37.0 37.0 37.0 37.0 4 36.618 37.0 37.0 37.0 37.0 37.0 5 36.658 37.0 37.0 37.0 37.0 37.0 6 36.6325 37.0 37.0 37.0 37.0 37.0 7 36.571 37.0 37.0 37.0 37.0 37.0 8 36.592 37.0 37.0 37.0 37.0 37.0 9 36.635 37.0 37.0 37.0 37.0 37.0 10-14 36.6212 37.0 37.0 37.0 37.0 37.0 15-19 36.6077 37.0 37.0 37.0 37.0 37.0 20-24 36.5433 37.0 37.0 37.0 37.0 37.0 25-29 36.5059 37.0 37.0 37.0 37.0 37.0 30-34 36.4548 37.0 37.0 37.0 37.0 37.0 35-39 36.4484 37.0 37.0 37.0 37.0 37.0 40-44 36.462900000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4084 37.0 37.0 37.0 37.0 37.0 50-54 36.3918 37.0 37.0 37.0 37.0 37.0 55-59 36.338499999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.332100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.25849999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.2785 37.0 37.0 37.0 37.0 37.0 75-79 36.2798 37.0 37.0 37.0 37.0 37.0 80-84 36.2877 37.0 37.0 37.0 37.0 37.0 85-89 36.2534 37.0 37.0 37.0 37.0 37.0 90-94 36.2819 37.0 37.0 37.0 37.0 37.0 95-99 36.2106 37.0 37.0 37.0 37.0 37.0 100-104 36.167 37.0 37.0 37.0 37.0 37.0 105-109 36.1069 37.0 37.0 37.0 37.0 37.0 110-114 36.0942 37.0 37.0 37.0 37.0 37.0 115-119 36.0452 37.0 37.0 37.0 37.0 37.0 120-124 36.0474 37.0 37.0 37.0 37.0 37.0 125-129 35.9721 37.0 37.0 37.0 37.0 37.0 130-134 35.9482 37.0 37.0 37.0 37.0 37.0 135-139 35.8746 37.0 37.0 37.0 37.0 37.0 140-144 35.715500000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.6546 37.0 37.0 37.0 37.0 37.0 150-151 35.3785 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 0.0 21 2.0 22 1.0 23 1.0 24 2.0 25 4.0 26 4.0 27 10.0 28 11.0 29 12.0 30 24.0 31 29.0 32 44.0 33 82.0 34 100.0 35 317.0 36 3045.0 37 310.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.04752376188094 13.406703351675839 5.602801400700351 35.942971485742866 2 19.7 12.575 36.175000000000004 31.55 3 16.55 16.275000000000002 28.425 38.75 4 21.6 21.45 24.925 32.025 5 22.8 29.125 24.525 23.549999999999997 6 21.125 33.050000000000004 22.575 23.25 7 15.925 30.325000000000003 38.574999999999996 15.174999999999999 8 16.55 27.700000000000003 31.924999999999997 23.825 9 16.725 23.400000000000002 35.35 24.525 10-14 19.215 30.564999999999998 27.384999999999998 22.835 15-19 19.74 28.945 26.96 24.355 20-24 20.200000000000003 28.845 27.034999999999997 23.919999999999998 25-29 19.96 28.599999999999998 27.700000000000003 23.74 30-34 19.99 28.349999999999998 27.18 24.48 35-39 19.93 28.645 27.215 24.21 40-44 19.915 28.4 27.365000000000002 24.32 45-49 20.005 28.549999999999997 27.465 23.98 50-54 20.16 28.775000000000002 26.995 24.07 55-59 20.185 28.165000000000003 27.169999999999998 24.48 60-64 20.560000000000002 28.560000000000002 26.724999999999998 24.154999999999998 65-69 20.035 28.405 27.38 24.18 70-74 20.785 28.18 26.945000000000004 24.09 75-79 20.630000000000003 27.54 27.58 24.25 80-84 20.335 27.91 27.450000000000003 24.305 85-89 20.294999999999998 28.255000000000003 27.045 24.404999999999998 90-94 21.58 27.79 26.115 24.515 95-99 20.599999999999998 27.62 27.115000000000002 24.665 100-104 20.48 28.52 26.5 24.5 105-109 21.02 27.05 27.21 24.72 110-114 20.605 27.74 27.005000000000003 24.65 115-119 20.965 28.42 26.745 23.87 120-124 20.93 28.249999999999996 26.005 24.815 125-129 21.18 27.97 26.66 24.19 130-134 20.9 27.63 27.445000000000004 24.025 135-139 21.98 26.88 26.314999999999998 24.825 140-144 20.93 28.139999999999997 26.705000000000002 24.224999999999998 145-149 21.495 27.445000000000004 26.779999999999998 24.279999999999998 150-151 20.75 27.200000000000003 26.6625 25.387500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.5 19 0.5 20 2.0 21 2.0 22 0.0 23 1.5 24 2.0 25 2.5 26 5.5 27 10.5 28 13.5 29 13.5 30 19.0 31 28.0 32 31.5 33 39.5 34 56.5 35 73.5 36 80.5 37 98.0 38 121.5 39 140.0 40 172.0 41 189.5 42 204.0 43 231.5 44 230.0 45 230.0 46 258.0 47 241.5 48 210.5 49 207.5 50 188.5 51 167.0 52 149.0 53 129.0 54 103.5 55 74.5 56 62.5 57 53.0 58 40.0 59 31.0 60 25.0 61 17.0 62 8.5 63 5.5 64 5.5 65 5.5 66 3.5 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.27000544365815 84.75 2 6.722917800762112 12.35 3 0.9254218835057159 2.55 4 0.027218290691344585 0.1 5 0.05443658138268917 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCA 5 0.125 No Hit GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 3.025 0.0 0.0 0.0 0.0 122-123 3.4125 0.0 0.0 0.0 0.0 124-125 3.6125 0.0 0.0 0.0 0.0 126-127 3.9625 0.0 0.0 0.0 0.0 128-129 4.237500000000001 0.0 0.0 0.0 0.0 130-131 4.5125 0.0 0.0 0.0 0.0 132-133 4.875 0.0 0.0 0.0 0.0 134-135 5.3375 0.0 0.0 0.0 0.0 136-137 5.8375 0.0 0.0 0.0 0.0 138-139 6.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAATG 10 0.006830828 145.0 2 >>END_MODULE SRR12917553 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917553_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4255 37.0 37.0 37.0 37.0 37.0 2 36.3345 37.0 37.0 37.0 37.0 37.0 3 36.2215 37.0 37.0 37.0 37.0 37.0 4 36.3665 37.0 37.0 37.0 37.0 37.0 5 36.4245 37.0 37.0 37.0 37.0 37.0 6 36.319 37.0 37.0 37.0 37.0 37.0 7 36.3155 37.0 37.0 37.0 37.0 37.0 8 36.405 37.0 37.0 37.0 37.0 37.0 9 36.3205 37.0 37.0 37.0 37.0 37.0 10-14 36.324400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.3104 37.0 37.0 37.0 37.0 37.0 20-24 36.3189 37.0 37.0 37.0 37.0 37.0 25-29 36.1941 37.0 37.0 37.0 37.0 37.0 30-34 36.1402 37.0 37.0 37.0 37.0 37.0 35-39 36.109399999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.11200000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.08069999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.0327 37.0 37.0 37.0 37.0 37.0 55-59 36.069100000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.0857 37.0 37.0 37.0 37.0 37.0 65-69 36.042199999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.9904 37.0 37.0 37.0 37.0 37.0 75-79 35.9103 37.0 37.0 37.0 37.0 37.0 80-84 35.9334 37.0 37.0 37.0 37.0 37.0 85-89 35.9643 37.0 37.0 37.0 37.0 37.0 90-94 35.9749 37.0 37.0 37.0 37.0 37.0 95-99 35.9397 37.0 37.0 37.0 37.0 37.0 100-104 35.9141 37.0 37.0 37.0 37.0 37.0 105-109 35.866200000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.8229 37.0 37.0 37.0 37.0 37.0 115-119 35.76270000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.711200000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.6766 37.0 37.0 37.0 37.0 37.0 130-134 35.5717 37.0 37.0 37.0 37.0 37.0 135-139 35.58409999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.4762 37.0 37.0 37.0 37.0 37.0 145-149 35.303200000000004 37.0 37.0 37.0 34.6 37.0 150-151 34.82575 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 3.0 16 4.0 17 3.0 18 0.0 19 3.0 20 2.0 21 3.0 22 6.0 23 5.0 24 9.0 25 5.0 26 2.0 27 4.0 28 12.0 29 14.0 30 16.0 31 32.0 32 53.0 33 91.0 34 162.0 35 539.0 36 2820.0 37 209.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.25 25.224999999999998 8.6 25.924999999999997 2 29.45 24.975 28.249999999999996 17.325 3 21.224999999999998 26.025 33.725 19.025 4 23.425 32.300000000000004 24.075 20.200000000000003 5 25.95 37.675 20.1 16.275000000000002 6 21.075 38.9 22.075 17.95 7 20.625 23.75 36.5 19.125 8 22.15 24.775 28.1 24.975 9 22.025 24.6 29.15 24.224999999999998 10-14 24.044999999999998 28.4 26.740000000000002 20.815 15-19 23.405 28.03 26.775 21.790000000000003 20-24 23.93 28.365000000000002 26.865 20.84 25-29 24.245 27.71 26.805 21.240000000000002 30-34 24.37 27.725 26.965 20.94 35-39 23.855 27.534999999999997 27.16 21.45 40-44 23.395 27.815 27.744999999999997 21.044999999999998 45-49 24.355 27.05 26.775 21.82 50-54 24.185000000000002 27.665 26.945000000000004 21.205 55-59 24.104999999999997 26.595000000000002 27.575 21.725 60-64 24.275 27.115000000000002 26.795 21.815 65-69 24.46 27.395000000000003 26.82 21.325 70-74 24.89 27.365000000000002 26.224999999999998 21.52 75-79 24.279999999999998 28.035 26.145000000000003 21.54 80-84 24.335 27.52 27.01 21.135 85-89 24.310000000000002 27.27 26.55 21.87 90-94 24.495 27.715 26.384999999999998 21.404999999999998 95-99 24.310000000000002 27.55 26.905 21.235 100-104 24.555 27.715 26.700000000000003 21.029999999999998 105-109 24.305 27.334999999999997 27.245 21.115000000000002 110-114 24.785 27.065 26.979999999999997 21.17 115-119 24.2 27.42 27.07 21.310000000000002 120-124 24.884999999999998 26.99 27.13 20.995 125-129 25.525 27.11 26.950000000000003 20.415 130-134 25.145 27.54 27.045 20.27 135-139 25.490000000000002 26.405 27.415 20.69 140-144 25.650000000000002 27.450000000000003 26.889999999999997 20.01 145-149 25.545 27.655 26.515 20.285 150-151 25.662499999999998 28.425 26.474999999999998 19.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 3.0 26 5.0 27 4.0 28 3.5 29 4.5 30 8.0 31 11.0 32 13.5 33 22.0 34 34.5 35 48.0 36 70.0 37 95.5 38 109.0 39 134.0 40 171.0 41 207.0 42 239.0 43 246.5 44 257.0 45 264.0 46 259.5 47 255.5 48 237.5 49 206.0 50 178.5 51 158.5 52 145.0 53 127.5 54 107.5 55 87.5 56 64.0 57 52.5 58 42.0 59 30.5 60 21.0 61 14.5 62 12.0 63 8.0 64 3.5 65 3.5 66 3.5 67 1.0 68 0.5 69 0.5 70 1.0 71 1.5 72 1.5 73 1.0 74 0.5 75 0.5 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 1.5 90 1.0 91 1.0 92 1.0 93 1.0 94 2.0 95 1.0 96 0.0 97 0.5 98 2.0 99 1.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.4 #Duplication Level Percentage of deduplicated Percentage of total 1 92.12253829321662 84.2 2 6.75601750547046 12.35 3 0.8479212253829322 2.325 4 0.16411378555798686 0.6 5 0.08205689277899343 0.375 6 0.02735229759299781 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GATCACTACCCGCATTACGTCCTTCAGTCTTTGCTAGCCTCAACTCCTCT 5 0.125 No Hit AGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCC 5 0.125 No Hit AGGAGATTGTGAAAAAAGAAAGGCAGAAGCAAGTTCAGTAATGGCAGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.3875000000000002 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.6375000000000002 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 1.9875 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.6875 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.6 0.0 0.0 0.0 0.0 126-127 3.9625 0.0 0.0 0.0 0.0 128-129 4.237500000000001 0.0 0.0 0.0 0.0 130-131 4.5375 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.3625 0.0 0.0 0.0 0.0 136-137 5.8875 0.0 0.0 0.0 0.0 138-139 6.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTATCG 10 0.006830828 145.0 7 >>END_MODULE Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446777 spots for SRR12917553.sra Written 446777 spots for SRR12917553.sra Read 446790 spots for SRR12917553.sra Written 446790 spots for SRR12917553.sra SRR ids: ['SRR12917553.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_urhpk378 SRR12917553.sra spots: 8935553 blocks: [[1, 446777], [446778, 893554], [893555, 1340331], [1340332, 1787108], [1787109, 2233885], [2233886, 2680662], [2680663, 3127439], [3127440, 3574216], [3574217, 4020993], [4020994, 4467770], [4467771, 4914547], [4914548, 5361324], [5361325, 5808101], [5808102, 6254878], [6254879, 6701655], [6701656, 7148432], [7148433, 7595209], [7595210, 8041986], [8041987, 8488763], [8488764, 8935553]] SRR12917553 file size 3017070 SRR12917553 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917553 SRR12917553_1.fastq SRR12917553_2.fastq Input file: SRR12917553_1.fastq Paired file: SRR12917553_2.fastq trimmed: SRR12917553-trimmed-pair1.fastq, SRR12917553-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:24:28 2025 >> started Thu Feb 13 13:24:37 2025 >> done (9.433s) 8935553 read pairs processed; of these: 39 ( 0.00%) short read pairs filtered out after trimming by size control 8342 ( 0.09%) empty read pairs filtered out after trimming by size control 8927172 (99.91%) read pairs available; of these: 839941 ( 9.41%) trimmed read pairs available after processing 8087231 (90.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 1 0.00% 21 3 0.00% 22 7 0.00% 23 3 0.00% 24 10 0.00% 25 12 0.00% 26 21 0.00% 27 12 0.00% 28 19 0.00% 29 17 0.00% 30 14 0.00% 31 14 0.00% 32 25 0.00% 33 9 0.00% 34 21 0.00% 35 23 0.00% 36 30 0.00% 37 16 0.00% 38 21 0.00% 39 15 0.00% 40 19 0.00% 41 27 0.00% 42 26 0.00% 43 23 0.00% 44 25 0.00% 45 38 0.00% 46 38 0.00% 47 40 0.00% 48 55 0.00% 49 56 0.00% 50 93 0.00% 51 74 0.00% 52 78 0.00% 53 99 0.00% 54 92 0.00% 55 104 0.00% 56 126 0.00% 57 128 0.00% 58 152 0.00% 59 176 0.00% 60 198 0.00% 61 293 0.00% 62 276 0.00% 63 333 0.00% 64 352 0.00% 65 385 0.00% 66 418 0.00% 67 457 0.01% 68 540 0.01% 69 587 0.01% 70 668 0.01% 71 832 0.01% 72 971 0.01% 73 1108 0.01% 74 1176 0.01% 75 1332 0.01% 76 1431 0.02% 77 1487 0.02% 78 1643 0.02% 79 1776 0.02% 80 1891 0.02% 81 2110 0.02% 82 2411 0.03% 83 2632 0.03% 84 3048 0.03% 85 3090 0.03% 86 3356 0.04% 87 3559 0.04% 88 3714 0.04% 89 3740 0.04% 90 4065 0.05% 91 4185 0.05% 92 4415 0.05% 93 4872 0.05% 94 5223 0.06% 95 5668 0.06% 96 5785 0.06% 97 6107 0.07% 98 6135 0.07% 99 6398 0.07% 100 6582 0.07% 101 6644 0.07% 102 7053 0.08% 103 7375 0.08% 104 7610 0.09% 105 8337 0.09% 106 8587 0.10% 107 8750 0.10% 108 8794 0.10% 109 9140 0.10% 110 9420 0.11% 111 9435 0.11% 112 9681 0.11% 113 10028 0.11% 114 10485 0.12% 115 10811 0.12% 116 11482 0.13% 117 11902 0.13% 118 12126 0.14% 119 12310 0.14% 120 12716 0.14% 121 12817 0.14% 122 12859 0.14% 123 13381 0.15% 124 13858 0.16% 125 14123 0.16% 126 14926 0.17% 127 15153 0.17% 128 15671 0.18% 129 15996 0.18% 130 16130 0.18% 131 15984 0.18% 132 16539 0.19% 133 16801 0.19% 134 17211 0.19% 135 17455 0.20% 136 18137 0.20% 137 18614 0.21% 138 19395 0.22% 139 20017 0.22% 140 19627 0.22% 141 19968 0.22% 142 20218 0.23% 143 20064 0.22% 144 20737 0.23% 145 21260 0.24% 146 21589 0.24% 147 22044 0.25% 148 22788 0.26% 149 23056 0.26% 150 23814 0.27% 151 8087231 90.59% 8927172 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=29 prefix-density=0.86 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=32 fanout-score=51.87 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=9.0 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=13 prefix-density=1.12 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=87.15 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=2.1 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12917553 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:25:23 Started mapping on | Feb 13 13:25:23 Finished on | Feb 13 13:26:16 Mapping speed, Million of reads per hour | 606.37 Number of input reads | 8927172 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 8431400 Uniquely mapped reads % | 94.45% Average mapped length | 295.87 Number of splices: Total | 8166196 Number of splices: Annotated (sjdb) | 8021651 Number of splices: GT/AG | 7984293 Number of splices: GC/AG | 151685 Number of splices: AT/AC | 5674 Number of splices: Non-canonical | 24544 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 209121 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 43674 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 286651 286651 286651 N_multimapping 209121 209121 209121 N_noFeature 184278 8280287 225563 N_ambiguous 168493 394 58571 UnstrandedReadsAssigned:8078629 PositiveStrandReadsAssigned:150719 NegativeStrandReadsAssigned:8147266 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917553 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917553-trimmed-pair1.fastq SRR12917553-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,927,172 reads, 8,171,539 reads pseudoaligned [quant] estimated average fragment length: 264.912 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR12917553.ke.tsv 34699 SRR12917553.se.tsv 87100 total ==> SRR12917553.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.09 218 11.3676 Potri.005G024800.1.v4.1 1035 771.088 195 23.131 Potri.004G059700.1.v4.1 961 697.2 176 23.0897 Potri.007G009000.2.v4.1 1416 1152.09 0 0 Potri.003G141000.2.v4.1 2943 2679.09 333 11.369 Potri.016G087400.1.v4.1 270 82.0503 494 550.694 Potri.015G069301.1.v4.1 564 313.813 0 0 Potri.010G195200.1.v4.1 1773 1509.09 7 0.424274 Potri.012G127500.1.v4.1 977 713.138 1195 153.27 ==> SRR12917553.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 137 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 120 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR12917553 completed mapping pipeline successfully