Starting /dee2/code/volunteer_pipeline.sh SRR12917554 current disk space = 3090948718592 free memory = 1392747704 SRR12917554 SRAfilesize c958966b1a23dd6b96c5c1c50e342545 SRR12917554.sra SRR12917554.sra file validated SRR12917554 is paired end SRR12917554 is conventional basespace SRR12917554 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917554_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5495 37.0 37.0 37.0 37.0 37.0 2 36.4225 37.0 37.0 37.0 37.0 37.0 3 36.539 37.0 37.0 37.0 37.0 37.0 4 36.703 37.0 37.0 37.0 37.0 37.0 5 36.6785 37.0 37.0 37.0 37.0 37.0 6 36.6535 37.0 37.0 37.0 37.0 37.0 7 36.5335 37.0 37.0 37.0 37.0 37.0 8 36.4795 37.0 37.0 37.0 37.0 37.0 9 36.613 37.0 37.0 37.0 37.0 37.0 10-14 36.639799999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.6487 37.0 37.0 37.0 37.0 37.0 20-24 36.579899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.6042 37.0 37.0 37.0 37.0 37.0 30-34 36.5582 37.0 37.0 37.0 37.0 37.0 35-39 36.558 37.0 37.0 37.0 37.0 37.0 40-44 36.5241 37.0 37.0 37.0 37.0 37.0 45-49 36.462700000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.4524 37.0 37.0 37.0 37.0 37.0 55-59 36.482299999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3808 37.0 37.0 37.0 37.0 37.0 65-69 36.31410000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.372 37.0 37.0 37.0 37.0 37.0 75-79 36.3861 37.0 37.0 37.0 37.0 37.0 80-84 36.328599999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.353300000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.3455 37.0 37.0 37.0 37.0 37.0 95-99 36.289300000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.212799999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.216100000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1693 37.0 37.0 37.0 37.0 37.0 115-119 36.1588 37.0 37.0 37.0 37.0 37.0 120-124 36.1428 37.0 37.0 37.0 37.0 37.0 125-129 36.087900000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.001799999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.9543 37.0 37.0 37.0 37.0 37.0 140-144 35.8315 37.0 37.0 37.0 37.0 37.0 145-149 35.7894 37.0 37.0 37.0 37.0 37.0 150-151 35.5 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 2.0 26 4.0 27 2.0 28 3.0 29 12.0 30 27.0 31 31.0 32 41.0 33 59.0 34 102.0 35 360.0 36 3019.0 37 335.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.44372186093047 12.88144072036018 6.3031515757878935 43.37168584292146 2 18.4 11.625 37.9 32.074999999999996 3 16.075 15.525 27.200000000000003 41.199999999999996 4 20.349999999999998 22.05 25.275 32.324999999999996 5 23.674999999999997 28.050000000000004 26.025 22.25 6 20.549999999999997 32.0 23.474999999999998 23.974999999999998 7 15.375 28.275 40.1 16.25 8 15.825 27.1 34.875 22.2 9 16.85 23.7 36.475 22.975 10-14 19.53 30.12 27.51 22.84 15-19 19.63 28.38 27.66 24.33 20-24 20.29 28.73 27.36 23.62 25-29 19.564999999999998 28.4 27.705000000000002 24.33 30-34 20.330000000000002 28.605000000000004 27.045 24.02 35-39 19.71 28.305000000000003 27.79 24.195 40-44 20.080000000000002 28.810000000000002 27.485 23.625 45-49 19.88 28.23 27.87 24.02 50-54 20.48 28.244999999999997 27.305 23.97 55-59 20.57 28.415000000000003 27.439999999999998 23.575 60-64 19.855 28.42 28.144999999999996 23.580000000000002 65-69 20.23 29.15 27.305 23.315 70-74 19.79 28.299999999999997 27.589999999999996 24.32 75-79 20.880000000000003 27.860000000000003 27.41 23.849999999999998 80-84 20.435 28.77 27.575 23.22 85-89 20.13 28.64 27.650000000000002 23.580000000000002 90-94 20.825 28.03 27.725 23.419999999999998 95-99 20.87 27.889999999999997 27.295 23.945 100-104 20.435 27.96 27.49 24.115000000000002 105-109 20.794999999999998 27.705000000000002 27.935 23.565 110-114 20.94 27.224999999999998 28.110000000000003 23.724999999999998 115-119 21.245 27.834999999999997 26.790000000000003 24.13 120-124 20.810000000000002 27.85 27.839999999999996 23.5 125-129 20.71 28.23 26.900000000000002 24.16 130-134 21.255 27.165 27.855 23.724999999999998 135-139 20.9 27.605 27.534999999999997 23.96 140-144 20.32 27.915 27.205000000000002 24.560000000000002 145-149 21.015 27.205000000000002 27.339999999999996 24.44 150-151 20.974999999999998 27.1 28.4375 23.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 4.0 20 4.0 21 1.0 22 1.0 23 1.0 24 1.5 25 2.0 26 5.0 27 5.5 28 8.5 29 18.5 30 20.5 31 21.0 32 36.0 33 50.5 34 64.0 35 81.0 36 86.0 37 95.0 38 124.0 39 153.0 40 158.5 41 176.5 42 207.5 43 238.5 44 270.5 45 273.5 46 269.5 47 267.0 48 237.0 49 197.5 50 176.0 51 161.0 52 131.5 53 99.0 54 85.5 55 75.0 56 55.0 57 35.0 58 29.5 59 24.5 60 14.5 61 7.5 62 5.0 63 4.5 64 2.5 65 5.0 66 6.0 67 2.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.575 #Duplication Level Percentage of deduplicated Percentage of total 1 90.51074518559867 81.075 2 8.121685738208205 14.549999999999999 3 1.0047446274072007 2.7 4 0.2511861568518002 0.8999999999999999 5 0.027909572983533353 0.125 6 0.0 0.0 7 0.0 0.0 8 0.027909572983533353 0.2 9 0.055819145967066705 0.44999999999999996 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 9 0.22499999999999998 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGCTGTATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 12 (97% over 37bp) TCTCTGTTCAACAACTTATAAATTATATCAATTTGATCTTAAAACTTTCT 8 0.2 No Hit CCCCACTCTTTCCTTATCTTGTTACCTTCGTCGCTCAGCAATGTAAATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.0875000000000004 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.4625 0.0 0.0 0.0 0.0 120-121 2.6875 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.05 0.0 0.0 0.0 0.0 126-127 3.175 0.0 0.0 0.0 0.0 128-129 3.45 0.0 0.0 0.0 0.0 130-131 3.8 0.0 0.0 0.0 0.0 132-133 4.1875 0.0 0.0 0.0 0.0 134-135 4.4625 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138-139 4.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTAAT 10 0.006830828 145.0 1 >>END_MODULE SRR12917554 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917554_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.324 37.0 37.0 37.0 37.0 37.0 2 36.2095 37.0 37.0 37.0 37.0 37.0 3 36.063 37.0 37.0 37.0 37.0 37.0 4 36.275 37.0 37.0 37.0 37.0 37.0 5 36.282 37.0 37.0 37.0 37.0 37.0 6 36.2525 37.0 37.0 37.0 37.0 37.0 7 36.13 37.0 37.0 37.0 37.0 37.0 8 36.1825 37.0 37.0 37.0 37.0 37.0 9 36.2465 37.0 37.0 37.0 37.0 37.0 10-14 36.30650000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.202999999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.1871 37.0 37.0 37.0 37.0 37.0 25-29 36.1275 37.0 37.0 37.0 37.0 37.0 30-34 36.05650000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.0253 37.0 37.0 37.0 37.0 37.0 40-44 35.98630000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.893800000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.8962 37.0 37.0 37.0 37.0 37.0 55-59 35.884100000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.902 37.0 37.0 37.0 37.0 37.0 65-69 35.8996 37.0 37.0 37.0 37.0 37.0 70-74 35.795399999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.769000000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.78079999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.8323 37.0 37.0 37.0 37.0 37.0 90-94 35.8134 37.0 37.0 37.0 37.0 37.0 95-99 35.725699999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.7033 37.0 37.0 37.0 37.0 37.0 105-109 35.6594 37.0 37.0 37.0 37.0 37.0 110-114 35.6153 37.0 37.0 37.0 37.0 37.0 115-119 35.5845 37.0 37.0 37.0 37.0 37.0 120-124 35.452999999999996 37.0 37.0 37.0 34.6 37.0 125-129 35.378699999999995 37.0 37.0 37.0 34.6 37.0 130-134 35.387299999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.370099999999994 37.0 37.0 37.0 34.6 37.0 140-144 35.142399999999995 37.0 37.0 37.0 25.0 37.0 145-149 34.997 37.0 37.0 37.0 25.0 37.0 150-151 34.55275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 0.0 19 1.0 20 3.0 21 4.0 22 3.0 23 3.0 24 5.0 25 7.0 26 8.0 27 9.0 28 14.0 29 24.0 30 31.0 31 49.0 32 82.0 33 129.0 34 223.0 35 714.0 36 2545.0 37 143.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.599999999999994 24.925 11.05 29.425 2 27.650000000000002 25.624999999999996 30.349999999999998 16.375 3 18.325 28.225 33.6 19.85 4 22.875 32.05 25.275 19.8 5 26.025 35.725 21.75 16.5 6 20.5 39.15 22.025 18.325 7 20.125 23.9 37.05 18.925 8 20.45 24.675 29.725 25.15 9 20.925 24.325 30.25 24.5 10-14 22.945 29.544999999999998 26.400000000000002 21.11 15-19 22.884999999999998 28.144999999999996 27.855 21.115000000000002 20-24 22.994999999999997 28.610000000000003 27.139999999999997 21.255 25-29 22.915 27.735 27.92 21.43 30-34 23.105 28.439999999999998 27.71 20.745 35-39 22.985 27.61 27.48 21.925 40-44 23.32 27.57 28.535 20.575 45-49 22.81 27.765 28.325 21.099999999999998 50-54 23.335 27.150000000000002 27.85 21.665 55-59 23.580000000000002 27.275 28.235 20.91 60-64 22.97 27.589999999999996 27.875 21.565 65-69 23.74 27.994999999999997 27.24 21.025 70-74 23.425 27.485 27.52 21.57 75-79 23.87 28.33 27.015 20.785 80-84 23.235 27.51 28.055000000000003 21.2 85-89 24.255 28.134999999999998 26.855 20.755000000000003 90-94 23.52 28.435 27.42 20.625 95-99 24.035 27.365000000000002 27.85 20.75 100-104 24.610000000000003 27.37 27.735 20.285 105-109 23.669999999999998 28.125 27.375 20.830000000000002 110-114 24.224999999999998 28.410000000000004 27.189999999999998 20.175 115-119 24.15 28.155 27.089999999999996 20.605 120-124 24.255 27.05 27.839999999999996 20.855 125-129 24.93 27.755000000000003 26.779999999999998 20.535 130-134 25.005 28.115000000000002 26.985 19.895 135-139 24.905 27.165 27.105 20.825 140-144 24.38 27.66 27.200000000000003 20.76 145-149 25.25 27.139999999999997 27.32 20.29 150-151 25.174999999999997 28.549999999999997 25.525 20.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 3.5 25 5.5 26 7.0 27 9.0 28 12.5 29 12.5 30 14.0 31 25.5 32 32.5 33 38.5 34 49.0 35 58.5 36 68.5 37 95.5 38 125.5 39 153.5 40 189.0 41 218.5 42 247.5 43 263.5 44 275.5 45 279.0 46 265.5 47 247.0 48 223.5 49 206.5 50 188.5 51 152.0 52 107.5 53 80.5 54 76.0 55 66.0 56 54.0 57 41.0 58 23.0 59 16.0 60 10.0 61 6.5 62 7.0 63 6.5 64 3.5 65 0.5 66 1.0 67 2.0 68 2.0 69 1.5 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 1.0 94 1.0 95 0.5 96 0.5 97 0.5 98 1.0 99 2.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.77008618293021 81.625 2 7.978871281623576 14.35 3 0.8896302474284126 2.4 4 0.25020850708924103 0.8999999999999999 5 0.027800945232137893 0.125 6 0.027800945232137893 0.15 7 0.0 0.0 8 0.027800945232137893 0.2 9 0.0 0.0 >10 0.027800945232137893 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit ATTCAATGACCATGATGACTCCTCTTCTTATGTCAGAGGAAGATTATAGC 8 0.2 No Hit CCTCAAAATGCAAATCACATCCTTGTTAGTGTTGTTCGTGGGAGTAGTTG 6 0.15 No Hit AAACAGGCCTGTGCTTTTAGAGATTCTTATGAGAAGTTCAAGAAAGCAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.0875000000000004 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.475 0.0 0.0 0.0 0.0 120-121 2.7125 0.0 0.0 0.0 0.0 122-123 2.8499999999999996 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.2 0.0 0.0 0.0 0.0 128-129 3.475 0.0 0.0 0.0 0.0 130-131 3.825 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.487500000000001 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 4.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAAAT 10 0.006830828 145.0 8 CCAGAAC 10 0.006830828 145.0 145 GCAAATC 10 0.006830828 145.0 9 TCACCAG 10 0.006830828 145.0 145 AAATGCA 10 0.006830828 145.0 5 GGGGGGG 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464765 spots for SRR12917554.sra Written 464765 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra Read 464758 spots for SRR12917554.sra Written 464758 spots for SRR12917554.sra SRR ids: ['SRR12917554.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__wfcxnfp SRR12917554.sra spots: 9295167 blocks: [[1, 464758], [464759, 929516], [929517, 1394274], [1394275, 1859032], [1859033, 2323790], [2323791, 2788548], [2788549, 3253306], [3253307, 3718064], [3718065, 4182822], [4182823, 4647580], [4647581, 5112338], [5112339, 5577096], [5577097, 6041854], [6041855, 6506612], [6506613, 6971370], [6971371, 7436128], [7436129, 7900886], [7900887, 8365644], [8365645, 8830402], [8830403, 9295167]] SRR12917554 file size 3138580 SRR12917554 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917554 SRR12917554_1.fastq SRR12917554_2.fastq Input file: SRR12917554_1.fastq Paired file: SRR12917554_2.fastq trimmed: SRR12917554-trimmed-pair1.fastq, SRR12917554-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:25:16 2025 >> started Thu Feb 13 13:25:28 2025 >> done (11.529s) 9295167 read pairs processed; of these: 59 ( 0.00%) short read pairs filtered out after trimming by size control 32771 ( 0.35%) empty read pairs filtered out after trimming by size control 9262337 (99.65%) read pairs available; of these: 685214 ( 7.40%) trimmed read pairs available after processing 8577123 (92.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 6 0.00% 21 2 0.00% 22 7 0.00% 23 4 0.00% 24 8 0.00% 25 4 0.00% 26 6 0.00% 27 7 0.00% 28 8 0.00% 29 7 0.00% 30 10 0.00% 31 12 0.00% 32 11 0.00% 33 9 0.00% 34 9 0.00% 35 11 0.00% 36 11 0.00% 37 20 0.00% 38 6 0.00% 39 11 0.00% 40 16 0.00% 41 20 0.00% 42 17 0.00% 43 25 0.00% 44 22 0.00% 45 17 0.00% 46 27 0.00% 47 22 0.00% 48 31 0.00% 49 28 0.00% 50 35 0.00% 51 42 0.00% 52 46 0.00% 53 61 0.00% 54 66 0.00% 55 82 0.00% 56 66 0.00% 57 63 0.00% 58 87 0.00% 59 103 0.00% 60 105 0.00% 61 156 0.00% 62 162 0.00% 63 200 0.00% 64 221 0.00% 65 271 0.00% 66 289 0.00% 67 313 0.00% 68 324 0.00% 69 370 0.00% 70 423 0.00% 71 522 0.01% 72 591 0.01% 73 695 0.01% 74 747 0.01% 75 824 0.01% 76 926 0.01% 77 1028 0.01% 78 1132 0.01% 79 1234 0.01% 80 1239 0.01% 81 1466 0.02% 82 1598 0.02% 83 1734 0.02% 84 1978 0.02% 85 2314 0.02% 86 2318 0.03% 87 2425 0.03% 88 2650 0.03% 89 2787 0.03% 90 2839 0.03% 91 3139 0.03% 92 3413 0.04% 93 3648 0.04% 94 3806 0.04% 95 4239 0.05% 96 4176 0.05% 97 4607 0.05% 98 4753 0.05% 99 4847 0.05% 100 5004 0.05% 101 5086 0.05% 102 5519 0.06% 103 5562 0.06% 104 6010 0.06% 105 6409 0.07% 106 6629 0.07% 107 6825 0.07% 108 7302 0.08% 109 7410 0.08% 110 7525 0.08% 111 7687 0.08% 112 7790 0.08% 113 8054 0.09% 114 8277 0.09% 115 8909 0.10% 116 9067 0.10% 117 9531 0.10% 118 9776 0.11% 119 9977 0.11% 120 10449 0.11% 121 10335 0.11% 122 10633 0.11% 123 11008 0.12% 124 11533 0.12% 125 11631 0.13% 126 12254 0.13% 127 12586 0.14% 128 12950 0.14% 129 13259 0.14% 130 13418 0.14% 131 13645 0.15% 132 13627 0.15% 133 14150 0.15% 134 14131 0.15% 135 14766 0.16% 136 15122 0.16% 137 15557 0.17% 138 16123 0.17% 139 16688 0.18% 140 16614 0.18% 141 17227 0.19% 142 17594 0.19% 143 17499 0.19% 144 17973 0.19% 145 18171 0.20% 146 18123 0.20% 147 18718 0.20% 148 19532 0.21% 149 19760 0.21% 150 20233 0.22% 151 8577123 92.60% 9262337 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.62 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=105.88 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=15.3 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=20 prefix-density=0.69 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=59.89 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.0 sequence=ACACAGAGAACACATTCATAC SRR12917554 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:26:13 Started mapping on | Feb 13 13:26:13 Finished on | Feb 13 13:27:16 Mapping speed, Million of reads per hour | 529.28 Number of input reads | 9262337 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 8754726 Uniquely mapped reads % | 94.52% Average mapped length | 297.09 Number of splices: Total | 8658964 Number of splices: Annotated (sjdb) | 8477428 Number of splices: GT/AG | 8477022 Number of splices: GC/AG | 153748 Number of splices: AT/AC | 5577 Number of splices: Non-canonical | 22617 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 240225 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 90607 % of reads mapped to too many loci | 0.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.75% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 267386 267386 267386 N_multimapping 240225 240225 240225 N_noFeature 316936 8637298 348451 N_ambiguous 149630 511 63491 UnstrandedReadsAssigned:8288160 PositiveStrandReadsAssigned:116917 NegativeStrandReadsAssigned:8342784 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917554 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917554-trimmed-pair1.fastq SRR12917554-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,262,337 reads, 8,420,370 reads pseudoaligned [quant] estimated average fragment length: 279.846 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52401 SRR12917554.ke.tsv 34699 SRR12917554.se.tsv 87100 total ==> SRR12917554.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.15 225 13.7357 Potri.005G024800.1.v4.1 1035 756.154 145 20.3594 Potri.004G059700.1.v4.1 961 682.281 49 7.625 Potri.007G009000.2.v4.1 1416 1137.15 0 0 Potri.003G141000.2.v4.1 2943 2664.15 361 14.3865 Potri.016G087400.1.v4.1 270 77.7289 571 779.938 Potri.015G069301.1.v4.1 564 303.414 0 0 Potri.010G195200.1.v4.1 1773 1494.15 28 1.98962 Potri.012G127500.1.v4.1 977 698.216 160 24.3297 ==> SRR12917554.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 207 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 138 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12917554 completed mapping pipeline successfully