Starting /dee2/code/volunteer_pipeline.sh SRR12917555 current disk space = 3090582216704 free memory = 1446681200 SRR12917555 SRAfilesize 727738f6bc13046020227b92524fade0 SRR12917555.sra SRR12917555.sra file validated SRR12917555 is paired end SRR12917555 is conventional basespace SRR12917555 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917555_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.60475 37.0 37.0 37.0 37.0 37.0 2 36.4895 37.0 37.0 37.0 37.0 37.0 3 36.6735 37.0 37.0 37.0 37.0 37.0 4 36.671 37.0 37.0 37.0 37.0 37.0 5 36.683 37.0 37.0 37.0 37.0 37.0 6 36.612 37.0 37.0 37.0 37.0 37.0 7 36.4315 37.0 37.0 37.0 37.0 37.0 8 36.597 37.0 37.0 37.0 37.0 37.0 9 36.615 37.0 37.0 37.0 37.0 37.0 10-14 36.6657 37.0 37.0 37.0 37.0 37.0 15-19 36.6271 37.0 37.0 37.0 37.0 37.0 20-24 36.574 37.0 37.0 37.0 37.0 37.0 25-29 36.5646 37.0 37.0 37.0 37.0 37.0 30-34 36.5332 37.0 37.0 37.0 37.0 37.0 35-39 36.5096 37.0 37.0 37.0 37.0 37.0 40-44 36.5603 37.0 37.0 37.0 37.0 37.0 45-49 36.4288 37.0 37.0 37.0 37.0 37.0 50-54 36.44690000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.41459999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.3745 37.0 37.0 37.0 37.0 37.0 65-69 36.2957 37.0 37.0 37.0 37.0 37.0 70-74 36.3211 37.0 37.0 37.0 37.0 37.0 75-79 36.3849 37.0 37.0 37.0 37.0 37.0 80-84 36.3258 37.0 37.0 37.0 37.0 37.0 85-89 36.306 37.0 37.0 37.0 37.0 37.0 90-94 36.3073 37.0 37.0 37.0 37.0 37.0 95-99 36.2359 37.0 37.0 37.0 37.0 37.0 100-104 36.1956 37.0 37.0 37.0 37.0 37.0 105-109 36.1279 37.0 37.0 37.0 37.0 37.0 110-114 36.0894 37.0 37.0 37.0 37.0 37.0 115-119 36.08239999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.094100000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.971500000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.9577 37.0 37.0 37.0 37.0 37.0 135-139 35.8971 37.0 37.0 37.0 37.0 37.0 140-144 35.833000000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.7524 37.0 37.0 37.0 37.0 37.0 150-151 35.54625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 2.0 25 2.0 26 7.0 27 5.0 28 4.0 29 19.0 30 15.0 31 33.0 32 40.0 33 64.0 34 115.0 35 301.0 36 3090.0 37 301.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.98424606151538 14.128532133033259 4.3760940235058765 44.51112778194549 2 17.325 12.15 42.125 28.4 3 16.35 15.675 29.4 38.574999999999996 4 21.425 22.15 24.05 32.375 5 22.7 31.525 24.875 20.9 6 18.825 33.725 24.15 23.3 7 14.924999999999999 27.425 43.025000000000006 14.625 8 16.425 24.15 34.75 24.675 9 17.075000000000003 22.400000000000002 34.825 25.7 10-14 19.759999999999998 30.285 27.165 22.79 15-19 19.675 27.73 27.87 24.725 20-24 20.125 28.294999999999998 27.875 23.705000000000002 25-29 19.82 27.935 27.63 24.615000000000002 30-34 20.53 28.810000000000002 26.740000000000002 23.919999999999998 35-39 19.74 28.005000000000003 28.15 24.104999999999997 40-44 19.79 28.875 27.634999999999998 23.7 45-49 19.45 28.970000000000002 27.55 24.03 50-54 20.31 28.749999999999996 27.275 23.665 55-59 20.48 29.28 27.435 22.805 60-64 19.8 27.810000000000002 28.185 24.205 65-69 20.200000000000003 28.49 27.894999999999996 23.415 70-74 20.44 28.42 27.029999999999998 24.11 75-79 20.07 28.965000000000003 27.565 23.400000000000002 80-84 20.75 28.16 27.37 23.72 85-89 19.775000000000002 28.875 27.450000000000003 23.9 90-94 20.46 27.54 28.115000000000002 23.885 95-99 20.560000000000002 27.74 27.245 24.455 100-104 20.655 28.689999999999998 27.715 22.939999999999998 105-109 20.46 28.08 27.445000000000004 24.015 110-114 21.224999999999998 27.88 27.134999999999998 23.76 115-119 21.02 28.299999999999997 27.375 23.305 120-124 20.91 28.125 27.150000000000002 23.815 125-129 20.76 28.12 27.565 23.555 130-134 20.66 27.689999999999998 27.805000000000003 23.845 135-139 20.195 27.905 27.18 24.72 140-144 20.810000000000002 28.095 27.189999999999998 23.905 145-149 20.985 27.48 27.24 24.295 150-151 20.0125 28.3625 26.687499999999996 24.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 1.5 23 2.0 24 2.0 25 3.0 26 5.5 27 7.5 28 12.0 29 17.0 30 20.5 31 28.5 32 36.5 33 44.0 34 50.0 35 63.0 36 81.0 37 101.0 38 123.0 39 156.5 40 176.5 41 192.0 42 229.0 43 252.5 44 252.0 45 264.0 46 265.5 47 263.5 48 260.5 49 219.0 50 182.5 51 148.0 52 116.0 53 93.5 54 76.0 55 63.0 56 48.5 57 38.0 58 29.0 59 20.0 60 15.5 61 11.0 62 9.0 63 7.0 64 3.5 65 1.5 66 1.0 67 2.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.825 #Duplication Level Percentage of deduplicated Percentage of total 1 90.31450041747843 81.125 2 8.23824102421375 14.799999999999999 3 1.2524352908433063 3.375 4 0.19482326746451434 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.3875000000000002 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.6749999999999998 0.0 0.0 0.0 0.0 116-117 1.7999999999999998 0.0 0.0 0.0 0.0 118-119 1.9375 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 2.8375 0.0 0.0 0.0 0.0 128-129 3.1625 0.0 0.0 0.0 0.0 130-131 3.4749999999999996 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 3.95 0.0 0.0 0.0 0.0 136-137 4.1625 0.0 0.0 0.0 0.0 138-139 4.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTGTC 10 0.006830828 145.0 7 GCCATAA 10 0.006830828 145.0 1 TGTATGA 10 0.006830828 145.0 9 ATCTGCT 10 0.006830828 145.0 1 >>END_MODULE SRR12917555 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917555_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2925 37.0 37.0 37.0 37.0 37.0 2 36.1985 37.0 37.0 37.0 37.0 37.0 3 36.237 37.0 37.0 37.0 37.0 37.0 4 36.2285 37.0 37.0 37.0 37.0 37.0 5 36.4075 37.0 37.0 37.0 37.0 37.0 6 36.2085 37.0 37.0 37.0 37.0 37.0 7 36.323 37.0 37.0 37.0 37.0 37.0 8 36.407 37.0 37.0 37.0 37.0 37.0 9 36.4085 37.0 37.0 37.0 37.0 37.0 10-14 36.347699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.380399999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.309000000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.2134 37.0 37.0 37.0 37.0 37.0 30-34 36.1931 37.0 37.0 37.0 37.0 37.0 35-39 36.169500000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.1135 37.0 37.0 37.0 37.0 37.0 45-49 36.076800000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.1065 37.0 37.0 37.0 37.0 37.0 55-59 36.0466 37.0 37.0 37.0 37.0 37.0 60-64 36.0687 37.0 37.0 37.0 37.0 37.0 65-69 35.9875 37.0 37.0 37.0 37.0 37.0 70-74 35.9448 37.0 37.0 37.0 37.0 37.0 75-79 35.928399999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.9281 37.0 37.0 37.0 37.0 37.0 85-89 35.907300000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.9306 37.0 37.0 37.0 37.0 37.0 95-99 35.8948 37.0 37.0 37.0 37.0 37.0 100-104 35.7912 37.0 37.0 37.0 37.0 37.0 105-109 35.8448 37.0 37.0 37.0 37.0 37.0 110-114 35.7972 37.0 37.0 37.0 37.0 37.0 115-119 35.7346 37.0 37.0 37.0 37.0 37.0 120-124 35.6432 37.0 37.0 37.0 37.0 37.0 125-129 35.6315 37.0 37.0 37.0 37.0 37.0 130-134 35.5113 37.0 37.0 37.0 37.0 37.0 135-139 35.535900000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.338899999999995 37.0 37.0 37.0 34.6 37.0 145-149 35.3289 37.0 37.0 37.0 29.8 37.0 150-151 34.825500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 0.0 20 2.0 21 3.0 22 3.0 23 3.0 24 5.0 25 4.0 26 5.0 27 7.0 28 13.0 29 18.0 30 24.0 31 46.0 32 58.0 33 105.0 34 221.0 35 635.0 36 2645.0 37 201.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.675000000000004 24.575 8.924999999999999 29.825000000000003 2 25.174999999999997 24.425 35.175 15.225 3 19.625 26.3 35.05 19.025 4 22.85 34.0 24.099999999999998 19.05 5 25.174999999999997 36.25 21.55 17.025000000000002 6 18.75 41.725 22.7 16.825000000000003 7 20.974999999999998 21.475 38.375 19.175 8 20.375 25.575 29.349999999999998 24.7 9 21.975 23.875 30.85 23.3 10-14 23.715 29.09 26.8 20.395 15-19 23.7 27.52 27.16 21.62 20-24 23.255 28.51 27.560000000000002 20.674999999999997 25-29 22.905 27.810000000000002 28.005000000000003 21.279999999999998 30-34 22.395 28.215 28.29 21.099999999999998 35-39 23.145 28.51 26.715 21.63 40-44 23.275000000000002 27.79 28.01 20.925 45-49 22.645 27.525 27.975 21.855 50-54 22.67 27.845 28.299999999999997 21.185000000000002 55-59 23.799999999999997 27.589999999999996 27.48 21.13 60-64 22.509999999999998 27.985 27.889999999999997 21.615000000000002 65-69 23.26 27.68 27.875 21.185000000000002 70-74 23.400000000000002 27.74 27.384999999999998 21.475 75-79 22.830000000000002 28.215 27.35 21.605 80-84 22.99 28.794999999999998 26.939999999999998 21.275 85-89 23.84 28.345 26.590000000000003 21.224999999999998 90-94 23.84 27.994999999999997 27.435 20.73 95-99 23.65 28.065 27.625 20.66 100-104 23.77 27.779999999999998 27.465 20.985 105-109 23.145 28.24 28.044999999999998 20.57 110-114 23.875 27.83 27.500000000000004 20.794999999999998 115-119 23.59 27.74 27.71 20.96 120-124 24.335 28.115000000000002 27.384999999999998 20.165 125-129 24.355 28.15 27.450000000000003 20.044999999999998 130-134 24.279999999999998 27.689999999999998 27.125 20.905 135-139 23.895 27.839999999999996 27.689999999999998 20.575 140-144 24.795 27.474999999999998 27.485 20.244999999999997 145-149 25.314999999999998 27.589999999999996 26.965 20.13 150-151 25.1 27.487499999999997 27.537499999999998 19.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 1.0 23 1.5 24 3.0 25 5.5 26 7.0 27 9.5 28 9.5 29 7.0 30 8.5 31 20.0 32 27.5 33 31.0 34 45.0 35 56.5 36 67.5 37 98.0 38 130.5 39 170.5 40 205.5 41 227.5 42 251.5 43 263.0 44 275.5 45 276.0 46 263.5 47 252.5 48 240.0 49 211.0 50 171.5 51 143.5 52 111.5 53 84.0 54 75.0 55 64.0 56 49.0 57 40.0 58 25.5 59 13.5 60 13.0 61 7.5 62 4.0 63 5.0 64 4.0 65 2.5 66 1.5 67 2.0 68 1.5 69 2.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.57547956630525 81.45 2 7.895468445927162 14.2 3 1.3344453711426187 3.5999999999999996 4 0.16680567139282734 0.6 5 0.0 0.0 6 0.027800945232137893 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.2999999999999998 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.7000000000000002 0.0 0.0 0.0 0.0 116-117 1.8250000000000002 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.5250000000000004 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 2.8375 0.0 0.0 0.0 0.0 128-129 3.1625 0.0 0.0 0.0 0.0 130-131 3.4749999999999996 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 3.95 0.0 0.0 0.0 0.0 136-137 4.1625 0.0 0.0 0.0 0.0 138-139 4.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAATAG 10 0.006830828 145.0 5 GTCTGGC 10 0.006830828 145.0 1 CTGGCAA 10 0.006830828 145.0 3 ACTGGGA 10 0.006830828 145.0 8 AGTCATC 10 0.006830828 145.0 9 CAAGTCA 10 0.006830828 145.0 7 AAAAAAA 20 0.00593511 29.0 45-49 >>END_MODULE Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570587 spots for SRR12917555.sra Written 570587 spots for SRR12917555.sra Read 570595 spots for SRR12917555.sra Written 570595 spots for SRR12917555.sra SRR ids: ['SRR12917555.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q9i9_hfx SRR12917555.sra spots: 11411748 blocks: [[1, 570587], [570588, 1141174], [1141175, 1711761], [1711762, 2282348], [2282349, 2852935], [2852936, 3423522], [3423523, 3994109], [3994110, 4564696], [4564697, 5135283], [5135284, 5705870], [5705871, 6276457], [6276458, 6847044], [6847045, 7417631], [7417632, 7988218], [7988219, 8558805], [8558806, 9129392], [9129393, 9699979], [9699980, 10270566], [10270567, 10841153], [10841154, 11411748]] SRR12917555 file size 3856510 SRR12917555 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917555 SRR12917555_1.fastq SRR12917555_2.fastq Input file: SRR12917555_1.fastq Paired file: SRR12917555_2.fastq trimmed: SRR12917555-trimmed-pair1.fastq, SRR12917555-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:42:06 2025 >> started Thu Feb 13 13:42:18 2025 >> done (12.605s) 11411748 read pairs processed; of these: 91 ( 0.00%) short read pairs filtered out after trimming by size control 974 ( 0.01%) empty read pairs filtered out after trimming by size control 11410683 (99.99%) read pairs available; of these: 822602 ( 7.21%) trimmed read pairs available after processing 10588081 (92.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 9 0.00% 21 6 0.00% 22 10 0.00% 23 6 0.00% 24 10 0.00% 25 14 0.00% 26 12 0.00% 27 12 0.00% 28 13 0.00% 29 8 0.00% 30 12 0.00% 31 15 0.00% 32 20 0.00% 33 14 0.00% 34 12 0.00% 35 18 0.00% 36 24 0.00% 37 24 0.00% 38 23 0.00% 39 18 0.00% 40 20 0.00% 41 34 0.00% 42 16 0.00% 43 41 0.00% 44 28 0.00% 45 33 0.00% 46 27 0.00% 47 33 0.00% 48 46 0.00% 49 59 0.00% 50 42 0.00% 51 66 0.00% 52 66 0.00% 53 61 0.00% 54 85 0.00% 55 74 0.00% 56 97 0.00% 57 109 0.00% 58 152 0.00% 59 134 0.00% 60 182 0.00% 61 199 0.00% 62 252 0.00% 63 256 0.00% 64 292 0.00% 65 345 0.00% 66 307 0.00% 67 398 0.00% 68 461 0.00% 69 470 0.00% 70 600 0.01% 71 695 0.01% 72 701 0.01% 73 806 0.01% 74 976 0.01% 75 1024 0.01% 76 1212 0.01% 77 1199 0.01% 78 1255 0.01% 79 1453 0.01% 80 1642 0.01% 81 1732 0.02% 82 1912 0.02% 83 2174 0.02% 84 2343 0.02% 85 2653 0.02% 86 2797 0.02% 87 2914 0.03% 88 2936 0.03% 89 3096 0.03% 90 3259 0.03% 91 3521 0.03% 92 3783 0.03% 93 4025 0.04% 94 4324 0.04% 95 4794 0.04% 96 4989 0.04% 97 5299 0.05% 98 5495 0.05% 99 5615 0.05% 100 5820 0.05% 101 5825 0.05% 102 6059 0.05% 103 6400 0.06% 104 6717 0.06% 105 7203 0.06% 106 7681 0.07% 107 7902 0.07% 108 7991 0.07% 109 8114 0.07% 110 8489 0.07% 111 8661 0.08% 112 9204 0.08% 113 9243 0.08% 114 9823 0.09% 115 10156 0.09% 116 10563 0.09% 117 11068 0.10% 118 11520 0.10% 119 11570 0.10% 120 12036 0.11% 121 12294 0.11% 122 12495 0.11% 123 12788 0.11% 124 13262 0.12% 125 13732 0.12% 126 14682 0.13% 127 15025 0.13% 128 15545 0.14% 129 15709 0.14% 130 16233 0.14% 131 16201 0.14% 132 16795 0.15% 133 17109 0.15% 134 17584 0.15% 135 17888 0.16% 136 18608 0.16% 137 19029 0.17% 138 19623 0.17% 139 20640 0.18% 140 20835 0.18% 141 21021 0.18% 142 21325 0.19% 143 21886 0.19% 144 22351 0.20% 145 22682 0.20% 146 23093 0.20% 147 23365 0.20% 148 24471 0.21% 149 24637 0.22% 150 25748 0.23% 151 10588081 92.79% 11410683 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=20 prefix-density=0.69 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=63.56 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=2.2 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=21 prefix-density=0.78 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=46.14 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.5 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12917555 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:43:01 Started mapping on | Feb 13 13:43:01 Finished on | Feb 13 13:44:23 Mapping speed, Million of reads per hour | 500.96 Number of input reads | 11410683 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10837862 Uniquely mapped reads % | 94.98% Average mapped length | 297.23 Number of splices: Total | 10945811 Number of splices: Annotated (sjdb) | 10730184 Number of splices: GT/AG | 10722993 Number of splices: GC/AG | 189912 Number of splices: AT/AC | 6612 Number of splices: Non-canonical | 26294 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275966 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 35045 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.22% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 296855 296855 296855 N_multimapping 275966 275966 275966 N_noFeature 368177 10712244 418884 N_ambiguous 144850 629 69514 UnstrandedReadsAssigned:10324835 PositiveStrandReadsAssigned:124989 NegativeStrandReadsAssigned:10349464 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917555 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917555-trimmed-pair1.fastq SRR12917555-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,410,683 reads, 10,368,999 reads pseudoaligned [quant] estimated average fragment length: 273.898 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR12917555.ke.tsv 34699 SRR12917555.se.tsv 87100 total ==> SRR12917555.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.1 246 13.6211 Potri.005G024800.1.v4.1 1035 762.102 162 20.54 Potri.004G059700.1.v4.1 961 688.248 22 3.0887 Potri.007G009000.2.v4.1 1416 1143.1 0 0 Potri.003G141000.2.v4.1 2943 2670.1 348 12.5936 Potri.016G087400.1.v4.1 270 77.1928 590 738.538 Potri.015G069301.1.v4.1 564 306.655 0 0 Potri.010G195200.1.v4.1 1773 1500.1 23 1.48151 Potri.012G127500.1.v4.1 977 704.176 656 90.0162 ==> SRR12917555.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 89 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12917555 completed mapping pipeline successfully