Starting /dee2/code/volunteer_pipeline.sh SRR12917556 current disk space = 3090093809664 free memory = 1475302532 SRR12917556 SRAfilesize 85735ba36f8c4965f6f5e7d817b138db SRR12917556.sra SRR12917556.sra file validated SRR12917556 is paired end SRR12917556 is conventional basespace SRR12917556 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917556_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.515 37.0 37.0 37.0 37.0 37.0 2 36.4095 37.0 37.0 37.0 37.0 37.0 3 36.5625 37.0 37.0 37.0 37.0 37.0 4 36.6405 37.0 37.0 37.0 37.0 37.0 5 36.6175 37.0 37.0 37.0 37.0 37.0 6 36.5985 37.0 37.0 37.0 37.0 37.0 7 36.4815 37.0 37.0 37.0 37.0 37.0 8 36.491 37.0 37.0 37.0 37.0 37.0 9 36.6195 37.0 37.0 37.0 37.0 37.0 10-14 36.600300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6005 37.0 37.0 37.0 37.0 37.0 20-24 36.55929999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.53580000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.5108 37.0 37.0 37.0 37.0 37.0 35-39 36.492 37.0 37.0 37.0 37.0 37.0 40-44 36.4874 37.0 37.0 37.0 37.0 37.0 45-49 36.408699999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4062 37.0 37.0 37.0 37.0 37.0 55-59 36.395799999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.358 37.0 37.0 37.0 37.0 37.0 65-69 36.289100000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.292899999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.276599999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.285999999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.279700000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2331 37.0 37.0 37.0 37.0 37.0 95-99 36.144600000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1787 37.0 37.0 37.0 37.0 37.0 105-109 36.0637 37.0 37.0 37.0 37.0 37.0 110-114 36.06320000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.0274 37.0 37.0 37.0 37.0 37.0 120-124 36.0181 37.0 37.0 37.0 37.0 37.0 125-129 35.8985 37.0 37.0 37.0 37.0 37.0 130-134 35.8512 37.0 37.0 37.0 37.0 37.0 135-139 35.8117 37.0 37.0 37.0 37.0 37.0 140-144 35.6237 37.0 37.0 37.0 37.0 37.0 145-149 35.597699999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.323 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 1.0 24 4.0 25 3.0 26 3.0 27 6.0 28 7.0 29 12.0 30 8.0 31 25.0 32 45.0 33 89.0 34 139.0 35 364.0 36 3018.0 37 272.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.84442221110555 14.307153576788394 4.902451225612806 41.945972986493246 2 17.125 9.950000000000001 39.925 33.0 3 16.2 14.174999999999999 28.799999999999997 40.825 4 21.625 22.425 25.275 30.675 5 24.2 28.849999999999998 24.725 22.225 6 20.125 32.975 23.075000000000003 23.825 7 13.525 29.099999999999998 41.449999999999996 15.925 8 15.675 27.0 35.125 22.2 9 15.875 23.325000000000003 36.675000000000004 24.125 10-14 18.884999999999998 30.285 28.355000000000004 22.475 15-19 19.43 27.575 28.549999999999997 24.445 20-24 18.98 28.57 28.744999999999997 23.705000000000002 25-29 19.650000000000002 28.08 28.815 23.455000000000002 30-34 19.015 27.93 28.53 24.525 35-39 18.945 28.71 27.775 24.57 40-44 19.35 29.03 28.32 23.3 45-49 19.425 28.860000000000003 27.815 23.9 50-54 19.825 28.265 28.294999999999998 23.615 55-59 19.439999999999998 28.48 27.955000000000002 24.125 60-64 19.02 28.599999999999998 28.395 23.985 65-69 19.925 28.88 27.445000000000004 23.75 70-74 19.675 28.815 27.994999999999997 23.515 75-79 19.33 29.575000000000003 27.825 23.27 80-84 19.755 28.71 28.055000000000003 23.48 85-89 20.035 28.93 27.915 23.119999999999997 90-94 20.075000000000003 28.599999999999998 27.725 23.599999999999998 95-99 19.77 28.849999999999998 27.435 23.945 100-104 20.315 28.315 27.88 23.49 105-109 20.244999999999997 28.439999999999998 28.110000000000003 23.205000000000002 110-114 19.055 28.42 27.955000000000002 24.57 115-119 20.13 28.625 27.650000000000002 23.595 120-124 19.32 28.535 28.01 24.135 125-129 20.1 28.49 27.965 23.445 130-134 19.965 28.705000000000002 27.54 23.79 135-139 19.919999999999998 28.265 27.944999999999997 23.87 140-144 20.419999999999998 27.584999999999997 27.71 24.285 145-149 20.669999999999998 28.075 27.644999999999996 23.61 150-151 21.1125 27.900000000000002 26.7125 24.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.5 6 1.0 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 2.0 23 2.5 24 3.5 25 5.5 26 8.0 27 14.0 28 14.5 29 15.0 30 17.5 31 20.0 32 34.5 33 50.5 34 54.5 35 75.5 36 98.0 37 105.0 38 118.5 39 161.0 40 201.0 41 239.5 42 266.0 43 262.0 44 264.5 45 281.0 46 268.0 47 245.0 48 225.0 49 198.0 50 177.5 51 129.5 52 104.5 53 89.0 54 59.5 55 42.5 56 37.0 57 28.5 58 17.5 59 10.5 60 9.0 61 10.0 62 8.0 63 5.0 64 4.0 65 3.5 66 0.5 67 1.5 68 2.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.325 #Duplication Level Percentage of deduplicated Percentage of total 1 91.67807281686285 83.72500000000001 2 7.3090610457158505 13.350000000000001 3 0.8486175745962223 2.325 4 0.16424856282507527 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 0.9874999999999999 0.0 0.0 0.0 0.0 108-109 1.1375000000000002 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.45 0.0 0.0 0.0 0.0 116-117 1.5750000000000002 0.0 0.0 0.0 0.0 118-119 1.7125 0.0 0.0 0.0 0.0 120-121 1.8875 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.8 0.0 0.0 0.0 0.0 128-129 2.9875 0.0 0.0 0.0 0.0 130-131 3.1500000000000004 0.0 0.0 0.0 0.0 132-133 3.4375 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTACAA 10 0.006830828 145.0 5 CATTACA 10 0.006830828 145.0 4 >>END_MODULE SRR12917556 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917556_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.402 37.0 37.0 37.0 37.0 37.0 2 36.3245 37.0 37.0 37.0 37.0 37.0 3 36.3765 37.0 37.0 37.0 37.0 37.0 4 36.4155 37.0 37.0 37.0 37.0 37.0 5 36.4675 37.0 37.0 37.0 37.0 37.0 6 36.3595 37.0 37.0 37.0 37.0 37.0 7 36.5155 37.0 37.0 37.0 37.0 37.0 8 36.4635 37.0 37.0 37.0 37.0 37.0 9 36.469 37.0 37.0 37.0 37.0 37.0 10-14 36.4125 37.0 37.0 37.0 37.0 37.0 15-19 36.43579999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.36890000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.2805 37.0 37.0 37.0 37.0 37.0 30-34 36.2412 37.0 37.0 37.0 37.0 37.0 35-39 36.175 37.0 37.0 37.0 37.0 37.0 40-44 36.2193 37.0 37.0 37.0 37.0 37.0 45-49 36.1124 37.0 37.0 37.0 37.0 37.0 50-54 36.1006 37.0 37.0 37.0 37.0 37.0 55-59 36.1006 37.0 37.0 37.0 37.0 37.0 60-64 36.0821 37.0 37.0 37.0 37.0 37.0 65-69 36.087199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0368 37.0 37.0 37.0 37.0 37.0 75-79 35.9916 37.0 37.0 37.0 37.0 37.0 80-84 35.9944 37.0 37.0 37.0 37.0 37.0 85-89 36.008300000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.002 37.0 37.0 37.0 37.0 37.0 95-99 35.927 37.0 37.0 37.0 37.0 37.0 100-104 35.909299999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.802 37.0 37.0 37.0 37.0 37.0 110-114 35.8383 37.0 37.0 37.0 37.0 37.0 115-119 35.763400000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.6548 37.0 37.0 37.0 37.0 37.0 125-129 35.6194 37.0 37.0 37.0 37.0 37.0 130-134 35.586600000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.5031 37.0 37.0 37.0 37.0 37.0 140-144 35.387 37.0 37.0 37.0 34.6 37.0 145-149 35.2267 37.0 37.0 37.0 29.8 37.0 150-151 34.903999999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 3.0 23 2.0 24 5.0 25 3.0 26 4.0 27 2.0 28 13.0 29 13.0 30 31.0 31 29.0 32 66.0 33 104.0 34 232.0 35 599.0 36 2699.0 37 190.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.0 25.525 10.100000000000001 27.375 2 25.650000000000002 24.625 34.35 15.375 3 17.849999999999998 28.050000000000004 35.425000000000004 18.675 4 23.05 33.625 25.55 17.775 5 27.1 36.95 20.775 15.174999999999999 6 20.075000000000003 40.35 21.775 17.8 7 20.9 23.1 37.675 18.325 8 19.325 25.124999999999996 32.324999999999996 23.225 9 22.275 24.05 30.599999999999998 23.075000000000003 10-14 22.7 29.9 27.415 19.985 15-19 23.0 28.310000000000002 27.860000000000003 20.830000000000002 20-24 22.905 28.625 28.384999999999998 20.085 25-29 23.06 28.599999999999998 27.96 20.380000000000003 30-34 22.295 28.4 28.18 21.125 35-39 22.705000000000002 28.585 28.12 20.59 40-44 23.625 28.689999999999998 27.865000000000002 19.82 45-49 22.675 28.965000000000003 28.075 20.285 50-54 23.294999999999998 28.299999999999997 27.52 20.885 55-59 23.055 28.24 28.050000000000004 20.655 60-64 22.97 28.32 28.499999999999996 20.21 65-69 22.915 27.54 28.895 20.65 70-74 23.34 27.955000000000002 27.98 20.724999999999998 75-79 23.02 29.09 27.495000000000005 20.395 80-84 23.135 27.744999999999997 28.025 21.095 85-89 23.285 28.17 27.839999999999996 20.705000000000002 90-94 23.205000000000002 28.285 28.205000000000002 20.305 95-99 23.44 28.12 28.4 20.04 100-104 23.880000000000003 28.389999999999997 27.650000000000002 20.080000000000002 105-109 23.799999999999997 27.725 28.765 19.71 110-114 23.32 28.265 27.91 20.505000000000003 115-119 24.165 28.22 27.485 20.13 120-124 24.4 28.715000000000003 27.185 19.7 125-129 24.695 28.53 26.939999999999998 19.835 130-134 24.044999999999998 28.1 27.92 19.935 135-139 24.035 27.68 28.345 19.939999999999998 140-144 24.505 28.185 27.500000000000004 19.81 145-149 25.295 28.325 26.924999999999997 19.455 150-151 24.275 28.525 27.425 19.775000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 1.0 23 1.5 24 3.0 25 5.0 26 10.0 27 13.0 28 16.5 29 17.0 30 22.5 31 33.0 32 32.5 33 40.0 34 59.0 35 75.5 36 99.5 37 121.0 38 139.0 39 176.5 40 204.0 41 238.0 42 266.0 43 282.5 44 272.0 45 247.5 46 268.0 47 252.5 48 223.0 49 192.0 50 150.5 51 122.0 52 97.0 53 75.0 54 47.5 55 33.0 56 31.0 57 32.5 58 23.0 59 17.0 60 14.5 61 8.5 62 9.5 63 7.0 64 3.5 65 3.0 66 2.5 67 1.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.76470588235294 83.85000000000001 2 7.22298221614227 13.200000000000001 3 0.8207934336525308 2.25 4 0.19151846785225718 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.5 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.7625 0.0 0.0 0.0 0.0 120-121 1.9375 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.4125 0.0 0.0 0.0 0.0 126-127 2.8499999999999996 0.0 0.0 0.0 0.0 128-129 3.0375 0.0 0.0 0.0 0.0 130-131 3.2 0.0 0.0 0.0 0.0 132-133 3.4875 0.0 0.0 0.0 0.0 134-135 3.7375 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGGG 10 0.006830828 145.0 145 CAGCATC 10 0.006830828 145.0 145 GTGAATG 10 0.006830828 145.0 6 >>END_MODULE Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717386 spots for SRR12917556.sra Written 717386 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra Read 717379 spots for SRR12917556.sra Written 717379 spots for SRR12917556.sra SRR ids: ['SRR12917556.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xapn1zmg SRR12917556.sra spots: 14347587 blocks: [[1, 717379], [717380, 1434758], [1434759, 2152137], [2152138, 2869516], [2869517, 3586895], [3586896, 4304274], [4304275, 5021653], [5021654, 5739032], [5739033, 6456411], [6456412, 7173790], [7173791, 7891169], [7891170, 8608548], [8608549, 9325927], [9325928, 10043306], [10043307, 10760685], [10760686, 11478064], [11478065, 12195443], [12195444, 12912822], [12912823, 13630201], [13630202, 14347587]] SRR12917556 file size 4854237 SRR12917556 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917556 SRR12917556_1.fastq SRR12917556_2.fastq Input file: SRR12917556_1.fastq Paired file: SRR12917556_2.fastq trimmed: SRR12917556-trimmed-pair1.fastq, SRR12917556-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:03:58 2025 >> started Thu Feb 13 14:04:14 2025 >> done (15.329s) 14347587 read pairs processed; of these: 163 ( 0.00%) short read pairs filtered out after trimming by size control 635 ( 0.00%) empty read pairs filtered out after trimming by size control 14346789 (99.99%) read pairs available; of these: 914287 ( 6.37%) trimmed read pairs available after processing 13432502 (93.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 13 0.00% 20 4 0.00% 21 13 0.00% 22 13 0.00% 23 13 0.00% 24 13 0.00% 25 18 0.00% 26 18 0.00% 27 19 0.00% 28 18 0.00% 29 21 0.00% 30 18 0.00% 31 14 0.00% 32 16 0.00% 33 16 0.00% 34 20 0.00% 35 19 0.00% 36 26 0.00% 37 21 0.00% 38 18 0.00% 39 24 0.00% 40 34 0.00% 41 22 0.00% 42 28 0.00% 43 32 0.00% 44 41 0.00% 45 38 0.00% 46 33 0.00% 47 37 0.00% 48 55 0.00% 49 71 0.00% 50 62 0.00% 51 75 0.00% 52 67 0.00% 53 86 0.00% 54 87 0.00% 55 75 0.00% 56 111 0.00% 57 108 0.00% 58 116 0.00% 59 147 0.00% 60 166 0.00% 61 199 0.00% 62 226 0.00% 63 262 0.00% 64 306 0.00% 65 294 0.00% 66 387 0.00% 67 415 0.00% 68 457 0.00% 69 497 0.00% 70 558 0.00% 71 676 0.00% 72 788 0.01% 73 899 0.01% 74 991 0.01% 75 1100 0.01% 76 1249 0.01% 77 1313 0.01% 78 1442 0.01% 79 1464 0.01% 80 1675 0.01% 81 1780 0.01% 82 2036 0.01% 83 2316 0.02% 84 2545 0.02% 85 2681 0.02% 86 3043 0.02% 87 3244 0.02% 88 3369 0.02% 89 3423 0.02% 90 3743 0.03% 91 3854 0.03% 92 4116 0.03% 93 4574 0.03% 94 4765 0.03% 95 5185 0.04% 96 5615 0.04% 97 5831 0.04% 98 5994 0.04% 99 6249 0.04% 100 6464 0.05% 101 6656 0.05% 102 6919 0.05% 103 7298 0.05% 104 7693 0.05% 105 8012 0.06% 106 8788 0.06% 107 8952 0.06% 108 9134 0.06% 109 9337 0.07% 110 9687 0.07% 111 9804 0.07% 112 10135 0.07% 113 10592 0.07% 114 10747 0.07% 115 11367 0.08% 116 12030 0.08% 117 12434 0.09% 118 13194 0.09% 119 13167 0.09% 120 13641 0.10% 121 13742 0.10% 122 13849 0.10% 123 14414 0.10% 124 15149 0.11% 125 15619 0.11% 126 15921 0.11% 127 16821 0.12% 128 17112 0.12% 129 17747 0.12% 130 18024 0.13% 131 18433 0.13% 132 18653 0.13% 133 19032 0.13% 134 19489 0.14% 135 19881 0.14% 136 20909 0.15% 137 21238 0.15% 138 21878 0.15% 139 22445 0.16% 140 22500 0.16% 141 23051 0.16% 142 23703 0.17% 143 24120 0.17% 144 24772 0.17% 145 25099 0.17% 146 25227 0.18% 147 25974 0.18% 148 26826 0.19% 149 27287 0.19% 150 27905 0.19% 151 13432502 93.63% 14346789 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=9.85 fanout-score-rank=15 prefix-density=0.36 prefix-fanout=4.7 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=477.51 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=34.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=28 prefix-density=0.25 prefix-fanout=2.6 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=378.96 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=33.1 sequence=AAGAAGAAGAAA SRR12917556 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:05:10 Started mapping on | Feb 13 14:05:10 Finished on | Feb 13 14:06:28 Mapping speed, Million of reads per hour | 662.16 Number of input reads | 14346789 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12997843 Uniquely mapped reads % | 90.60% Average mapped length | 294.57 Number of splices: Total | 12490686 Number of splices: Annotated (sjdb) | 12189886 Number of splices: GT/AG | 12256289 Number of splices: GC/AG | 183525 Number of splices: AT/AC | 12759 Number of splices: Non-canonical | 38113 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 3.04 Insertion rate per base | 0.03% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320198 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 52574 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.70% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1028748 1028748 1028748 N_multimapping 320198 320198 320198 N_noFeature 549771 12860475 598859 N_ambiguous 191867 1017 102954 UnstrandedReadsAssigned:12256205 PositiveStrandReadsAssigned:136351 NegativeStrandReadsAssigned:12296030 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917556 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917556-trimmed-pair1.fastq SRR12917556-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,346,789 reads, 12,844,807 reads pseudoaligned [quant] estimated average fragment length: 280.953 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR12917556.ke.tsv 34699 SRR12917556.se.tsv 87100 total ==> SRR12917556.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.05 473 22.881 Potri.005G024800.1.v4.1 1035 755.047 102 11.358 Potri.004G059700.1.v4.1 961 681.247 47 5.80055 Potri.007G009000.2.v4.1 1416 1136.05 0 0 Potri.003G141000.2.v4.1 2943 2663.05 495.399 15.6405 Potri.016G087400.1.v4.1 270 78.2926 754.52 810.263 Potri.015G069301.1.v4.1 564 303.845 0 0 Potri.010G195200.1.v4.1 1773 1493.05 55 3.09717 Potri.012G127500.1.v4.1 977 697.145 8066 972.772 ==> SRR12917556.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 161 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 4 SRR12917556 completed mapping pipeline successfully