Starting /dee2/code/volunteer_pipeline.sh SRR12917557 current disk space = 3090588508160 free memory = 1382699944 SRR12917557 SRAfilesize 9f7fa50933a681df970111bb64fb0d5d SRR12917557.sra SRR12917557.sra file validated SRR12917557 is paired end SRR12917557 is conventional basespace SRR12917557 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917557_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.57375 37.0 37.0 37.0 37.0 37.0 2 36.3645 37.0 37.0 37.0 37.0 37.0 3 36.555 37.0 37.0 37.0 37.0 37.0 4 36.583 37.0 37.0 37.0 37.0 37.0 5 36.6645 37.0 37.0 37.0 37.0 37.0 6 36.637 37.0 37.0 37.0 37.0 37.0 7 36.5635 37.0 37.0 37.0 37.0 37.0 8 36.6145 37.0 37.0 37.0 37.0 37.0 9 36.687 37.0 37.0 37.0 37.0 37.0 10-14 36.6211 37.0 37.0 37.0 37.0 37.0 15-19 36.6133 37.0 37.0 37.0 37.0 37.0 20-24 36.5501 37.0 37.0 37.0 37.0 37.0 25-29 36.535900000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.487 37.0 37.0 37.0 37.0 37.0 35-39 36.4644 37.0 37.0 37.0 37.0 37.0 40-44 36.4714 37.0 37.0 37.0 37.0 37.0 45-49 36.3968 37.0 37.0 37.0 37.0 37.0 50-54 36.4073 37.0 37.0 37.0 37.0 37.0 55-59 36.3112 37.0 37.0 37.0 37.0 37.0 60-64 36.3315 37.0 37.0 37.0 37.0 37.0 65-69 36.216300000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.289 37.0 37.0 37.0 37.0 37.0 75-79 36.2882 37.0 37.0 37.0 37.0 37.0 80-84 36.2799 37.0 37.0 37.0 37.0 37.0 85-89 36.2957 37.0 37.0 37.0 37.0 37.0 90-94 36.2522 37.0 37.0 37.0 37.0 37.0 95-99 36.175799999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1696 37.0 37.0 37.0 37.0 37.0 105-109 36.1011 37.0 37.0 37.0 37.0 37.0 110-114 36.1077 37.0 37.0 37.0 37.0 37.0 115-119 36.0155 37.0 37.0 37.0 37.0 37.0 120-124 36.0368 37.0 37.0 37.0 37.0 37.0 125-129 35.882400000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.8485 37.0 37.0 37.0 37.0 37.0 135-139 35.6948 37.0 37.0 37.0 37.0 37.0 140-144 35.5832 37.0 37.0 37.0 37.0 37.0 145-149 35.4574 37.0 37.0 37.0 37.0 37.0 150-151 35.35225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 3.0 24 1.0 25 3.0 26 8.0 27 6.0 28 5.0 29 10.0 30 18.0 31 36.0 32 54.0 33 89.0 34 140.0 35 308.0 36 3015.0 37 300.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.73818454613654 11.47786946736684 5.576394098524632 30.207551887971995 2 19.125 10.525 37.075 33.275 3 15.975 18.099999999999998 31.225 34.699999999999996 4 22.125 22.1 26.700000000000003 29.075 5 24.025 29.875 24.85 21.25 6 20.075000000000003 34.325 24.5 21.099999999999998 7 14.274999999999999 28.525 41.25 15.950000000000001 8 16.25 26.55 33.6 23.599999999999998 9 16.25 24.15 34.699999999999996 24.9 10-14 19.615 30.709999999999997 27.584999999999997 22.09 15-19 20.11 27.655 28.505000000000003 23.73 20-24 19.975 27.98 28.560000000000002 23.485 25-29 19.6 27.810000000000002 28.98 23.61 30-34 19.7 28.84 27.915 23.544999999999998 35-39 19.41 29.14 27.775 23.674999999999997 40-44 19.2 28.95 27.93 23.919999999999998 45-49 19.555 28.804999999999996 28.1 23.54 50-54 20.44 27.985 28.205000000000002 23.369999999999997 55-59 19.905 27.83 28.194999999999997 24.07 60-64 19.5 28.439999999999998 28.155 23.905 65-69 20.25 28.155 27.875 23.72 70-74 20.4 28.494999999999997 27.43 23.674999999999997 75-79 20.405 28.83 27.279999999999998 23.485 80-84 19.91 28.825 27.67 23.595 85-89 20.655 28.605000000000004 27.860000000000003 22.88 90-94 20.285 28.42 27.54 23.755000000000003 95-99 20.365 28.939999999999998 27.67 23.025000000000002 100-104 19.86 29.544999999999998 26.88 23.715 105-109 19.96 28.63 28.055000000000003 23.355 110-114 20.565 28.599999999999998 26.86 23.974999999999998 115-119 20.5 28.825 26.919999999999998 23.755000000000003 120-124 20.105 28.994999999999997 27.200000000000003 23.7 125-129 20.01 28.605000000000004 27.169999999999998 24.215 130-134 20.49 28.970000000000002 27.485 23.055 135-139 20.7 28.435 27.46 23.405 140-144 21.425 28.305000000000003 27.450000000000003 22.82 145-149 20.7 27.395000000000003 28.1 23.805 150-151 20.8875 28.1875 27.175 23.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 3.0 25 6.0 26 10.0 27 11.5 28 9.5 29 10.5 30 16.0 31 24.0 32 32.5 33 40.0 34 52.5 35 66.5 36 87.0 37 109.5 38 134.5 39 166.0 40 197.5 41 223.5 42 244.0 43 259.0 44 260.5 45 284.0 46 295.5 47 262.5 48 219.5 49 187.0 50 162.0 51 152.0 52 132.5 53 87.0 54 68.0 55 53.5 56 30.5 57 20.5 58 15.0 59 15.5 60 12.0 61 7.5 62 7.0 63 3.5 64 1.5 65 3.0 66 3.0 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.1878453038674 82.525 2 7.734806629834254 14.000000000000002 3 0.8287292817679558 2.25 4 0.05524861878453039 0.2 5 0.08287292817679558 0.375 6 0.08287292817679558 0.44999999999999996 7 0.0 0.0 8 0.027624309392265196 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATATTTACTGAATGACTCCCTGTCTTGACATATACAATAGAAGAACC 8 0.2 No Hit GGTAATCCAAAACCGGACTCCACTTCTCTTGTATTGTAATTTATGATTCG 6 0.15 No Hit GTGCGATTTTGCAGTTGCTTCTCTCGATTTCAGCAATGGGGTCTATCAAA 6 0.15 No Hit TTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTT 6 0.15 No Hit CTCAGAGTTCCTCACATGAACATAAGTTACAAAAGAATATCGAATGCCAT 5 0.125 No Hit GTTTAGTGTCCCGCTATGGAACCTTCTGCCCGCAATGTCAACAGAAGAGT 5 0.125 No Hit CTCTAGCATTGAAAAGTATCTCTAGCGCACGTGCGCAAACTTGCATCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.65 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.4625000000000004 0.0 0.0 0.0 0.0 128-129 3.9375 0.0 0.0 0.0 0.0 130-131 4.300000000000001 0.0 0.0 0.0 0.0 132-133 4.575 0.0 0.0 0.0 0.0 134-135 4.887499999999999 0.0 0.0 0.0 0.0 136-137 5.262499999999999 0.0 0.0 0.0 0.0 138-139 5.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917557 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917557_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.19775 37.0 37.0 37.0 37.0 37.0 2 36.299 37.0 37.0 37.0 37.0 37.0 3 36.225 37.0 37.0 37.0 37.0 37.0 4 36.279 37.0 37.0 37.0 37.0 37.0 5 36.324 37.0 37.0 37.0 37.0 37.0 6 36.3685 37.0 37.0 37.0 37.0 37.0 7 36.3155 37.0 37.0 37.0 37.0 37.0 8 36.272 37.0 37.0 37.0 37.0 37.0 9 36.375 37.0 37.0 37.0 37.0 37.0 10-14 36.3103 37.0 37.0 37.0 37.0 37.0 15-19 36.2531 37.0 37.0 37.0 37.0 37.0 20-24 36.22090000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.0421 37.0 37.0 37.0 37.0 37.0 30-34 36.0467 37.0 37.0 37.0 37.0 37.0 35-39 36.0463 37.0 37.0 37.0 37.0 37.0 40-44 35.9748 37.0 37.0 37.0 37.0 37.0 45-49 35.949200000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.8712 37.0 37.0 37.0 37.0 37.0 55-59 35.8908 37.0 37.0 37.0 37.0 37.0 60-64 35.933899999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.8797 37.0 37.0 37.0 37.0 37.0 70-74 35.800599999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.732099999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.8369 37.0 37.0 37.0 37.0 37.0 85-89 35.8041 37.0 37.0 37.0 37.0 37.0 90-94 35.7712 37.0 37.0 37.0 37.0 37.0 95-99 35.694900000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.6944 37.0 37.0 37.0 37.0 37.0 105-109 35.5937 37.0 37.0 37.0 37.0 37.0 110-114 35.651599999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.575 37.0 37.0 37.0 37.0 37.0 120-124 35.4647 37.0 37.0 37.0 37.0 37.0 125-129 35.3973 37.0 37.0 37.0 37.0 37.0 130-134 35.3284 37.0 37.0 37.0 34.6 37.0 135-139 35.349599999999995 37.0 37.0 37.0 34.6 37.0 140-144 35.1886 37.0 37.0 37.0 29.8 37.0 145-149 35.063900000000004 37.0 37.0 37.0 27.4 37.0 150-151 34.68425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 7.0 16 4.0 17 4.0 18 3.0 19 5.0 20 1.0 21 3.0 22 7.0 23 6.0 24 8.0 25 9.0 26 9.0 27 10.0 28 12.0 29 16.0 30 27.0 31 44.0 32 57.0 33 87.0 34 180.0 35 608.0 36 2702.0 37 186.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.18679669917479 25.581395348837212 7.201800450112527 20.030007501875467 2 28.9 23.825 29.75 17.525 3 19.975 26.150000000000002 36.3 17.575 4 23.75 34.55 23.375 18.325 5 25.55 36.775000000000006 21.25 16.425 6 21.125 39.775 22.0 17.1 7 21.625 22.475 37.724999999999994 18.175 8 20.05 25.825 30.4 23.724999999999998 9 22.45 25.4 28.975 23.175 10-14 23.425 29.68 26.97 19.925 15-19 23.62 28.585 27.91 19.885 20-24 23.385 28.76 27.384999999999998 20.47 25-29 23.085 28.625 28.09 20.200000000000003 30-34 23.015 27.79 28.595 20.599999999999998 35-39 22.755 28.17 28.194999999999997 20.880000000000003 40-44 23.849999999999998 27.994999999999997 27.325 20.830000000000002 45-49 23.65 28.23 27.810000000000002 20.31 50-54 23.35 28.98 27.965 19.705000000000002 55-59 23.65 28.560000000000002 27.735 20.055 60-64 23.200000000000003 28.084999999999997 28.51 20.205000000000002 65-69 23.395 28.735 28.134999999999998 19.735 70-74 23.095 28.205000000000002 27.97 20.73 75-79 23.705000000000002 28.505000000000003 27.82 19.97 80-84 23.375 28.205000000000002 27.925 20.495 85-89 23.715 28.605000000000004 27.875 19.805 90-94 24.095 28.015 27.92 19.97 95-99 23.544999999999998 27.744999999999997 28.244999999999997 20.465 100-104 24.169999999999998 28.29 28.075 19.465 105-109 24.16 27.900000000000002 27.905 20.035 110-114 23.355 28.405 27.779999999999998 20.46 115-119 23.74 28.83 27.22 20.21 120-124 24.279999999999998 28.665000000000003 27.325 19.73 125-129 24.875 28.43 27.36 19.335 130-134 24.385 27.765 28.125 19.725 135-139 24.565 28.67 27.015 19.75 140-144 24.665 28.735 26.775 19.825 145-149 25.385 28.694999999999997 26.13 19.79 150-151 25.412499999999998 28.6625 26.937499999999996 18.987499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 1.0 9 1.0 10 0.5 11 1.0 12 2.5 13 2.5 14 1.5 15 1.0 16 0.5 17 0.5 18 1.0 19 2.0 20 2.0 21 1.0 22 2.5 23 3.5 24 5.5 25 7.0 26 5.0 27 5.5 28 8.0 29 12.0 30 17.0 31 21.5 32 28.0 33 38.0 34 49.0 35 65.0 36 83.0 37 118.5 38 152.5 39 172.0 40 223.0 41 267.0 42 283.0 43 291.5 44 281.0 45 268.5 46 254.0 47 237.5 48 219.5 49 174.5 50 145.5 51 134.5 52 93.0 53 66.0 54 57.5 55 42.0 56 33.5 57 24.0 58 15.5 59 13.5 60 10.0 61 4.5 62 2.0 63 3.0 64 2.0 65 1.0 66 0.5 67 0.5 68 1.0 69 1.0 70 2.5 71 2.5 72 2.0 73 1.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.5 86 1.5 87 1.0 88 0.5 89 0.5 90 0.5 91 0.5 92 1.0 93 2.0 94 1.5 95 1.0 96 0.5 97 0.5 98 2.5 99 2.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.425 #Duplication Level Percentage of deduplicated Percentage of total 1 91.78877522808958 83.0 2 7.077688692286426 12.8 3 0.8294166436273155 2.25 4 0.0552944429084877 0.2 5 0.02764722145424385 0.125 6 0.08294166436273154 0.44999999999999996 7 0.08294166436273154 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.0552944429084877 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit GTTGCATTTATCTAAAGTATTGTCACTTTACTTAACACTTGAGCTGCATA 12 0.3 No Hit AGCAGTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTA 7 0.17500000000000002 No Hit GCTCTGCAAGACTCTGGACTCTATAGCCCTGACAGTGAAGACTCTTCTGT 7 0.17500000000000002 No Hit GTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTACATA 7 0.17500000000000002 No Hit CCCAGACCCTAAAGCTGTCCAATATGTGAGGAATGACAGAGGCACACCCA 6 0.15 No Hit GCCAAAAAAACCAATCTAATCCTCAAAATTTTCTCCCTCGCGCAAAATCT 6 0.15 No Hit GTTCTCTCCAAGTGAAGCACCCAAGGAAGTTTTCTGGCTTCCCATCACCA 6 0.15 No Hit GTCCAGGATGTGATGCCATCCATGTTACGGAGATTGAGACGAGTGTTGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.1625 0.0 0.0 0.0 0.0 126-127 3.5 0.0 0.0 0.0 0.0 128-129 4.0 0.0 0.0 0.0 0.0 130-131 4.324999999999999 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 4.9375 0.0 0.0 0.0 0.0 136-137 5.3375 0.0 0.0 0.0 0.0 138-139 5.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686804 spots for SRR12917557.sra Written 686804 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra Read 686790 spots for SRR12917557.sra Written 686790 spots for SRR12917557.sra SRR ids: ['SRR12917557.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tx7rj2pu SRR12917557.sra spots: 13735814 blocks: [[1, 686790], [686791, 1373580], [1373581, 2060370], [2060371, 2747160], [2747161, 3433950], [3433951, 4120740], [4120741, 4807530], [4807531, 5494320], [5494321, 6181110], [6181111, 6867900], [6867901, 7554690], [7554691, 8241480], [8241481, 8928270], [8928271, 9615060], [9615061, 10301850], [10301851, 10988640], [10988641, 11675430], [11675431, 12362220], [12362221, 13049010], [13049011, 13735814]] SRR12917557 file size 4646330 SRR12917557 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917557 SRR12917557_1.fastq SRR12917557_2.fastq Input file: SRR12917557_1.fastq Paired file: SRR12917557_2.fastq trimmed: SRR12917557-trimmed-pair1.fastq, SRR12917557-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:42:16 2025 >> started Thu Feb 13 13:42:32 2025 >> done (15.375s) 13735814 read pairs processed; of these: 179 ( 0.00%) short read pairs filtered out after trimming by size control 7916 ( 0.06%) empty read pairs filtered out after trimming by size control 13727719 (99.94%) read pairs available; of these: 1122147 ( 8.17%) trimmed read pairs available after processing 12605572 (91.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 12 0.00% 20 24 0.00% 21 14 0.00% 22 19 0.00% 23 29 0.00% 24 28 0.00% 25 23 0.00% 26 22 0.00% 27 30 0.00% 28 34 0.00% 29 41 0.00% 30 36 0.00% 31 39 0.00% 32 35 0.00% 33 30 0.00% 34 55 0.00% 35 39 0.00% 36 29 0.00% 37 50 0.00% 38 35 0.00% 39 47 0.00% 40 43 0.00% 41 44 0.00% 42 58 0.00% 43 45 0.00% 44 44 0.00% 45 35 0.00% 46 61 0.00% 47 69 0.00% 48 53 0.00% 49 67 0.00% 50 96 0.00% 51 92 0.00% 52 103 0.00% 53 117 0.00% 54 121 0.00% 55 111 0.00% 56 134 0.00% 57 182 0.00% 58 202 0.00% 59 211 0.00% 60 292 0.00% 61 326 0.00% 62 333 0.00% 63 394 0.00% 64 473 0.00% 65 482 0.00% 66 521 0.00% 67 594 0.00% 68 662 0.00% 69 760 0.01% 70 818 0.01% 71 962 0.01% 72 1152 0.01% 73 1317 0.01% 74 1447 0.01% 75 1639 0.01% 76 1736 0.01% 77 1787 0.01% 78 1940 0.01% 79 2092 0.02% 80 2467 0.02% 81 2634 0.02% 82 3042 0.02% 83 3233 0.02% 84 3527 0.03% 85 3887 0.03% 86 4010 0.03% 87 4270 0.03% 88 4322 0.03% 89 4477 0.03% 90 4806 0.04% 91 5132 0.04% 92 5599 0.04% 93 6000 0.04% 94 6328 0.05% 95 6830 0.05% 96 7130 0.05% 97 7578 0.06% 98 7626 0.06% 99 7855 0.06% 100 7921 0.06% 101 8339 0.06% 102 8899 0.06% 103 9506 0.07% 104 10214 0.07% 105 10561 0.08% 106 10926 0.08% 107 11352 0.08% 108 11869 0.09% 109 11758 0.09% 110 11848 0.09% 111 12297 0.09% 112 12769 0.09% 113 12918 0.09% 114 13764 0.10% 115 14671 0.11% 116 15098 0.11% 117 15286 0.11% 118 15994 0.12% 119 16159 0.12% 120 16429 0.12% 121 16654 0.12% 122 16818 0.12% 123 17616 0.13% 124 18338 0.13% 125 19255 0.14% 126 19706 0.14% 127 20248 0.15% 128 20557 0.15% 129 21178 0.15% 130 21624 0.16% 131 22019 0.16% 132 22341 0.16% 133 22615 0.16% 134 23348 0.17% 135 24961 0.18% 136 24741 0.18% 137 25445 0.19% 138 26354 0.19% 139 26654 0.19% 140 28076 0.20% 141 27935 0.20% 142 28545 0.21% 143 28607 0.21% 144 29773 0.22% 145 30047 0.22% 146 30885 0.22% 147 31252 0.23% 148 31010 0.23% 149 31300 0.23% 150 32615 0.24% 151 12605572 91.83% 13727719 reads passed initial QC criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=18 prefix-density=1.03 prefix-fanout=2.0 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCC criterion=fanout-score sequence-density=0.13 sequence-density-rank=18 fanout-score=9.76 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=1.3 sequence=AGCTAACTCCTTTGTTTGAACTTGTTT criterion=sequence-density sequence-density=1.62 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=20 prefix-density=1.59 prefix-fanout=2.0 sequence=CATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.14 sequence-density-rank=23 fanout-score=14.83 fanout-score-rank=1 prefix-density=1.85 prefix-fanout=1.2 sequence=CAATTTGGCAGTACTGCTGGTGCTTGGGCTG SRR12917557 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:43:25 Started mapping on | Feb 13 13:43:25 Finished on | Feb 13 13:45:13 Mapping speed, Million of reads per hour | 457.59 Number of input reads | 13727719 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12661744 Uniquely mapped reads % | 92.23% Average mapped length | 296.36 Number of splices: Total | 11801448 Number of splices: Annotated (sjdb) | 11487399 Number of splices: GT/AG | 11584649 Number of splices: GC/AG | 164034 Number of splices: AT/AC | 14070 Number of splices: Non-canonical | 38695 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 358979 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 47221 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.51% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 706996 706996 706996 N_multimapping 358979 358979 358979 N_noFeature 481517 12512862 559303 N_ambiguous 168997 789 97457 UnstrandedReadsAssigned:12011230 PositiveStrandReadsAssigned:148093 NegativeStrandReadsAssigned:12004984 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917557 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917557-trimmed-pair1.fastq SRR12917557-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,727,719 reads, 11,858,367 reads pseudoaligned [quant] estimated average fragment length: 272.433 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR12917557.ke.tsv 34699 SRR12917557.se.tsv 87100 total ==> SRR12917557.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.57 475 23.8227 Potri.005G024800.1.v4.1 1035 763.567 160 18.3551 Potri.004G059700.1.v4.1 961 689.756 61 7.74671 Potri.007G009000.2.v4.1 1416 1144.57 0 0 Potri.003G141000.2.v4.1 2943 2671.57 368.226 12.0735 Potri.016G087400.1.v4.1 270 80.6976 741 804.341 Potri.015G069301.1.v4.1 564 309.398 0 0 Potri.010G195200.1.v4.1 1773 1501.57 44 2.56679 Potri.012G127500.1.v4.1 977 705.682 4659 578.318 ==> SRR12917557.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 105 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 129 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 28 SRR12917557 completed mapping pipeline successfully