Starting /dee2/code/volunteer_pipeline.sh SRR12917558 current disk space = 3090562863104 free memory = 1422826932 SRR12917558 SRAfilesize 53011a8b2e4bae21290cab1aea08e156 SRR12917558.sra SRR12917558.sra file validated SRR12917558 is paired end SRR12917558 is conventional basespace SRR12917558 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917558_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6285 37.0 37.0 37.0 37.0 37.0 2 36.5415 37.0 37.0 37.0 37.0 37.0 3 36.682 37.0 37.0 37.0 37.0 37.0 4 36.7355 37.0 37.0 37.0 37.0 37.0 5 36.743 37.0 37.0 37.0 37.0 37.0 6 36.7435 37.0 37.0 37.0 37.0 37.0 7 36.553 37.0 37.0 37.0 37.0 37.0 8 36.6685 37.0 37.0 37.0 37.0 37.0 9 36.7285 37.0 37.0 37.0 37.0 37.0 10-14 36.6768 37.0 37.0 37.0 37.0 37.0 15-19 36.6687 37.0 37.0 37.0 37.0 37.0 20-24 36.6456 37.0 37.0 37.0 37.0 37.0 25-29 36.627399999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.544 37.0 37.0 37.0 37.0 37.0 35-39 36.563300000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.563700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.5291 37.0 37.0 37.0 37.0 37.0 50-54 36.5163 37.0 37.0 37.0 37.0 37.0 55-59 36.455799999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.447199999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.3995 37.0 37.0 37.0 37.0 37.0 70-74 36.378699999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.4807 37.0 37.0 37.0 37.0 37.0 80-84 36.4059 37.0 37.0 37.0 37.0 37.0 85-89 36.4154 37.0 37.0 37.0 37.0 37.0 90-94 36.3423 37.0 37.0 37.0 37.0 37.0 95-99 36.3198 37.0 37.0 37.0 37.0 37.0 100-104 36.28490000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.236000000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.21809999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.0797 37.0 37.0 37.0 37.0 37.0 120-124 36.1253 37.0 37.0 37.0 37.0 37.0 125-129 36.095 37.0 37.0 37.0 37.0 37.0 130-134 36.0092 37.0 37.0 37.0 37.0 37.0 135-139 35.9067 37.0 37.0 37.0 37.0 37.0 140-144 35.814800000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.81519999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.449250000000006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 3.0 26 5.0 27 7.0 28 6.0 29 7.0 30 12.0 31 22.0 32 42.0 33 52.0 34 114.0 35 280.0 36 3098.0 37 350.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.95 12.7 5.225 45.125 2 17.299999999999997 11.55 39.900000000000006 31.25 3 16.7 14.85 28.175 40.275 4 22.1 20.875 24.675 32.35 5 23.225 28.4 24.95 23.425 6 19.475 32.125 24.4 24.0 7 14.224999999999998 28.975 40.675 16.125 8 17.95 25.624999999999996 33.275 23.150000000000002 9 17.375 22.5 36.199999999999996 23.925 10-14 19.18 30.055 27.915 22.85 15-19 19.91 27.63 27.805000000000003 24.654999999999998 20-24 19.63 28.76 27.67 23.94 25-29 19.96 27.525 29.07 23.445 30-34 19.81 27.634999999999998 28.199999999999996 24.355 35-39 20.294999999999998 27.595 27.49 24.62 40-44 20.064999999999998 29.044999999999998 27.474999999999998 23.415 45-49 19.235 28.050000000000004 28.255000000000003 24.46 50-54 19.67 28.26 28.199999999999996 23.87 55-59 19.75 28.88 27.255000000000003 24.115000000000002 60-64 20.265 28.21 27.46 24.065 65-69 19.99 28.815 27.255000000000003 23.94 70-74 20.5 28.365000000000002 27.18 23.955000000000002 75-79 20.395 28.689999999999998 27.155 23.76 80-84 20.405 27.529999999999998 27.339999999999996 24.725 85-89 20.325 28.044999999999998 27.705000000000002 23.925 90-94 20.06 28.015 27.515 24.41 95-99 19.634999999999998 27.950000000000003 28.294999999999998 24.12 100-104 19.41 28.65 27.345000000000002 24.595 105-109 20.330000000000002 28.57 27.22 23.880000000000003 110-114 20.53 28.595 27.36 23.515 115-119 20.61 28.499999999999996 26.979999999999997 23.91 120-124 20.525 27.755000000000003 27.384999999999998 24.335 125-129 20.515 27.92 27.555000000000003 24.01 130-134 20.555 28.21 27.235 24.0 135-139 21.265 27.685 27.57 23.48 140-144 21.525 27.834999999999997 27.310000000000002 23.330000000000002 145-149 21.595 27.615000000000002 27.755000000000003 23.035 150-151 20.4375 28.15 26.825 24.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 1.0 24 2.0 25 2.5 26 3.0 27 5.0 28 9.0 29 13.5 30 14.0 31 26.0 32 38.5 33 41.0 34 53.0 35 66.5 36 80.0 37 93.0 38 118.5 39 145.5 40 180.0 41 210.5 42 227.5 43 245.5 44 264.5 45 269.5 46 257.0 47 252.0 48 229.5 49 231.0 50 223.0 51 159.5 52 110.0 53 97.0 54 85.0 55 59.5 56 49.5 57 41.0 58 29.0 59 22.0 60 13.0 61 7.5 62 6.0 63 4.5 64 2.0 65 1.0 66 1.5 67 2.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.125 #Duplication Level Percentage of deduplicated Percentage of total 1 90.70735090152566 81.75 2 7.9334257975034665 14.299999999999999 3 1.1095700416088765 3.0 4 0.2219140083217753 0.8 5 0.0 0.0 6 0.027739251040221912 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAAATCCGAGATCGTGCTTATGATAACAACAACCAGACCATCTTGGAG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.5125 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.7125 0.0 0.0 0.0 0.0 126-127 2.9875 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.4125 0.0 0.0 0.0 0.0 132-133 3.7 0.0 0.0 0.0 0.0 134-135 3.95 0.0 0.0 0.0 0.0 136-137 4.4125 0.0 0.0 0.0 0.0 138-139 4.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917558 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917558_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4615 37.0 37.0 37.0 37.0 37.0 2 36.3335 37.0 37.0 37.0 37.0 37.0 3 36.2635 37.0 37.0 37.0 37.0 37.0 4 36.459 37.0 37.0 37.0 37.0 37.0 5 36.477 37.0 37.0 37.0 37.0 37.0 6 36.2995 37.0 37.0 37.0 37.0 37.0 7 36.3525 37.0 37.0 37.0 37.0 37.0 8 36.4555 37.0 37.0 37.0 37.0 37.0 9 36.3785 37.0 37.0 37.0 37.0 37.0 10-14 36.441199999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.410999999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.418 37.0 37.0 37.0 37.0 37.0 25-29 36.2941 37.0 37.0 37.0 37.0 37.0 30-34 36.205799999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1755 37.0 37.0 37.0 37.0 37.0 40-44 36.1957 37.0 37.0 37.0 37.0 37.0 45-49 36.0954 37.0 37.0 37.0 37.0 37.0 50-54 36.0877 37.0 37.0 37.0 37.0 37.0 55-59 36.0787 37.0 37.0 37.0 37.0 37.0 60-64 36.1075 37.0 37.0 37.0 37.0 37.0 65-69 36.083999999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0254 37.0 37.0 37.0 37.0 37.0 75-79 35.980000000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0032 37.0 37.0 37.0 37.0 37.0 85-89 36.035000000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9899 37.0 37.0 37.0 37.0 37.0 95-99 35.962 37.0 37.0 37.0 37.0 37.0 100-104 35.8738 37.0 37.0 37.0 37.0 37.0 105-109 35.89190000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.836 37.0 37.0 37.0 37.0 37.0 115-119 35.8574 37.0 37.0 37.0 37.0 37.0 120-124 35.6909 37.0 37.0 37.0 37.0 37.0 125-129 35.6478 37.0 37.0 37.0 37.0 37.0 130-134 35.5822 37.0 37.0 37.0 37.0 37.0 135-139 35.541999999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.3985 37.0 37.0 37.0 37.0 37.0 145-149 35.3169 37.0 37.0 37.0 32.2 37.0 150-151 34.826499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 0.0 17 3.0 18 1.0 19 0.0 20 6.0 21 4.0 22 1.0 23 5.0 24 2.0 25 6.0 26 6.0 27 5.0 28 11.0 29 12.0 30 17.0 31 36.0 32 49.0 33 102.0 34 168.0 35 590.0 36 2799.0 37 175.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.425 25.85 9.2 30.525000000000002 2 26.8 26.224999999999998 32.35 14.625 3 18.45 28.299999999999997 34.300000000000004 18.95 4 24.5 33.925 24.25 17.325 5 25.624999999999996 36.175000000000004 21.525 16.675 6 19.85 39.050000000000004 22.875 18.224999999999998 7 20.825 23.974999999999998 37.375 17.825 8 20.325 25.775 30.75 23.150000000000002 9 20.5 25.174999999999997 30.575000000000003 23.75 10-14 23.419999999999998 29.585 26.05 20.945 15-19 23.265 28.395 27.63 20.71 20-24 22.975 28.63 27.22 21.175 25-29 22.18 28.355000000000004 28.225 21.240000000000002 30-34 22.59 28.325 28.105000000000004 20.979999999999997 35-39 23.445 28.244999999999997 27.37 20.94 40-44 22.994999999999997 28.9 27.560000000000002 20.544999999999998 45-49 23.235 28.185 27.650000000000002 20.93 50-54 23.400000000000002 27.675 28.1 20.825 55-59 22.84 28.310000000000002 27.51 21.34 60-64 22.75 27.785 27.85 21.615000000000002 65-69 23.244999999999997 27.265 28.24 21.25 70-74 23.01 28.425 27.845 20.72 75-79 23.75 27.700000000000003 27.22 21.33 80-84 22.7 28.050000000000004 27.46 21.790000000000003 85-89 23.445 28.189999999999998 27.215 21.15 90-94 23.745 28.235 27.105 20.915 95-99 23.244999999999997 28.435 27.400000000000002 20.919999999999998 100-104 24.03 27.944999999999997 27.105 20.919999999999998 105-109 23.755000000000003 27.755000000000003 28.015 20.474999999999998 110-114 23.325000000000003 28.17 28.194999999999997 20.31 115-119 24.474999999999998 27.07 28.165000000000003 20.29 120-124 23.419999999999998 28.060000000000002 27.839999999999996 20.68 125-129 24.455 28.21 26.865 20.47 130-134 24.66 27.884999999999998 26.985 20.47 135-139 23.98 28.044999999999998 28.01 19.965 140-144 24.865000000000002 27.85 26.735 20.549999999999997 145-149 25.7 28.005000000000003 26.790000000000003 19.505 150-151 26.4625 27.5125 26.6625 19.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 2.5 18 1.5 19 0.5 20 0.5 21 1.0 22 2.0 23 2.0 24 2.0 25 4.0 26 6.0 27 10.5 28 14.5 29 16.0 30 15.0 31 17.0 32 24.5 33 34.5 34 46.5 35 66.5 36 93.5 37 129.0 38 149.0 39 146.0 40 171.0 41 208.0 42 252.5 43 282.0 44 271.5 45 272.5 46 261.0 47 234.5 48 207.5 49 203.0 50 191.5 51 138.5 52 107.0 53 89.5 54 80.0 55 65.5 56 48.0 57 35.0 58 23.0 59 17.5 60 13.0 61 10.5 62 8.0 63 5.0 64 2.0 65 1.5 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 1.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.825 #Duplication Level Percentage of deduplicated Percentage of total 1 90.67631505705539 81.45 2 7.84859448928472 14.099999999999998 3 1.1411077094350126 3.075 4 0.2504870581686613 0.8999999999999999 5 0.0 0.0 6 0.055663790704146954 0.3 7 0.027831895352073477 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTCACGGAAAGGACTAAATAATTAGTTTTTGAAACAAGAGGGA 7 0.17500000000000002 No Hit AGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATT 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0125 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.025 0.0 0.025 0.0 0.0 38-39 0.025 0.0 0.025 0.0 0.0 40-41 0.025 0.0 0.025 0.0 0.0 42-43 0.025 0.0 0.025 0.0 0.0 44-45 0.025 0.0 0.025 0.0 0.0 46-47 0.025 0.0 0.025 0.0 0.0 48-49 0.025 0.0 0.025 0.0 0.0 50-51 0.025 0.0 0.025 0.0 0.0 52-53 0.025 0.0 0.025 0.0 0.0 54-55 0.025 0.0 0.025 0.0 0.0 56-57 0.025 0.0 0.025 0.0 0.0 58-59 0.025 0.0 0.025 0.0 0.0 60-61 0.025 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.05 0.0 0.025 0.0 0.0 68-69 0.05 0.0 0.025 0.0 0.0 70-71 0.05 0.0 0.025 0.0 0.0 72-73 0.05 0.0 0.025 0.0 0.0 74-75 0.075 0.0 0.025 0.0 0.0 76-77 0.075 0.0 0.025 0.0 0.0 78-79 0.1 0.0 0.025 0.0 0.0 80-81 0.1 0.0 0.025 0.0 0.0 82-83 0.125 0.0 0.025 0.0 0.0 84-85 0.1875 0.0 0.025 0.0 0.0 86-87 0.225 0.0 0.025 0.0 0.0 88-89 0.325 0.0 0.025 0.0 0.0 90-91 0.3625 0.0 0.025 0.0 0.0 92-93 0.375 0.0 0.025 0.0 0.0 94-95 0.45 0.0 0.025 0.0 0.0 96-97 0.525 0.0 0.025 0.0 0.0 98-99 0.7125 0.0 0.025 0.0 0.0 100-101 0.8 0.0 0.025 0.0 0.0 102-103 0.875 0.0 0.025 0.0 0.0 104-105 0.95 0.0 0.025 0.0 0.0 106-107 1.0499999999999998 0.0 0.025 0.0 0.0 108-109 1.275 0.0 0.025 0.0 0.0 110-111 1.425 0.0 0.025 0.0 0.0 112-113 1.6125 0.0 0.025 0.0 0.0 114-115 1.7375 0.0 0.025 0.0 0.0 116-117 1.9874999999999998 0.0 0.025 0.0 0.0 118-119 2.1875 0.0 0.025 0.0 0.0 120-121 2.475 0.0 0.025 0.0 0.0 122-123 2.6125 0.0 0.025 0.0 0.0 124-125 2.8125 0.0 0.025 0.0 0.0 126-127 3.0999999999999996 0.0 0.025 0.0 0.0 128-129 3.3625 0.0 0.025 0.0 0.0 130-131 3.55 0.0 0.025 0.0 0.0 132-133 3.875 0.0 0.025 0.0 0.0 134-135 4.125 0.0 0.025 0.0 0.0 136-137 4.5875 0.0 0.025 0.0 0.0 138-139 4.875 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620645 spots for SRR12917558.sra Written 620645 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra Read 620631 spots for SRR12917558.sra Written 620631 spots for SRR12917558.sra SRR ids: ['SRR12917558.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_izpq4n2y SRR12917558.sra spots: 12412634 blocks: [[1, 620631], [620632, 1241262], [1241263, 1861893], [1861894, 2482524], [2482525, 3103155], [3103156, 3723786], [3723787, 4344417], [4344418, 4965048], [4965049, 5585679], [5585680, 6206310], [6206311, 6826941], [6826942, 7447572], [7447573, 8068203], [8068204, 8688834], [8688835, 9309465], [9309466, 9930096], [9930097, 10550727], [10550728, 11171358], [11171359, 11791989], [11791990, 12412634]] SRR12917558 file size 4196655 SRR12917558 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917558 SRR12917558_1.fastq SRR12917558_2.fastq Input file: SRR12917558_1.fastq Paired file: SRR12917558_2.fastq trimmed: SRR12917558-trimmed-pair1.fastq, SRR12917558-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:43:31 2025 >> started Thu Feb 13 13:43:46 2025 >> done (15.591s) 12412634 read pairs processed; of these: 82 ( 0.00%) short read pairs filtered out after trimming by size control 1053 ( 0.01%) empty read pairs filtered out after trimming by size control 12411499 (99.99%) read pairs available; of these: 979943 ( 7.90%) trimmed read pairs available after processing 11431556 (92.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 5 0.00% 21 10 0.00% 22 6 0.00% 23 3 0.00% 24 9 0.00% 25 8 0.00% 26 12 0.00% 27 9 0.00% 28 6 0.00% 29 12 0.00% 30 12 0.00% 31 9 0.00% 32 24 0.00% 33 15 0.00% 34 20 0.00% 35 9 0.00% 36 16 0.00% 37 21 0.00% 38 20 0.00% 39 33 0.00% 40 25 0.00% 41 39 0.00% 42 26 0.00% 43 25 0.00% 44 33 0.00% 45 33 0.00% 46 45 0.00% 47 37 0.00% 48 59 0.00% 49 59 0.00% 50 69 0.00% 51 78 0.00% 52 104 0.00% 53 98 0.00% 54 115 0.00% 55 100 0.00% 56 104 0.00% 57 131 0.00% 58 174 0.00% 59 196 0.00% 60 203 0.00% 61 286 0.00% 62 309 0.00% 63 361 0.00% 64 390 0.00% 65 395 0.00% 66 451 0.00% 67 539 0.00% 68 576 0.00% 69 632 0.01% 70 765 0.01% 71 830 0.01% 72 940 0.01% 73 1183 0.01% 74 1283 0.01% 75 1416 0.01% 76 1562 0.01% 77 1593 0.01% 78 1707 0.01% 79 1888 0.02% 80 1970 0.02% 81 2300 0.02% 82 2513 0.02% 83 2692 0.02% 84 3046 0.02% 85 3136 0.03% 86 3405 0.03% 87 3707 0.03% 88 3714 0.03% 89 4051 0.03% 90 4142 0.03% 91 4449 0.04% 92 4589 0.04% 93 5081 0.04% 94 5540 0.04% 95 5811 0.05% 96 6122 0.05% 97 6386 0.05% 98 6587 0.05% 99 6434 0.05% 100 6864 0.06% 101 7148 0.06% 102 7573 0.06% 103 7701 0.06% 104 8030 0.06% 105 8654 0.07% 106 9106 0.07% 107 9447 0.08% 108 9543 0.08% 109 10143 0.08% 110 10175 0.08% 111 10262 0.08% 112 10858 0.09% 113 10832 0.09% 114 11422 0.09% 115 12278 0.10% 116 12613 0.10% 117 13304 0.11% 118 13566 0.11% 119 14105 0.11% 120 14547 0.12% 121 14866 0.12% 122 15001 0.12% 123 15419 0.12% 124 15893 0.13% 125 16133 0.13% 126 17154 0.14% 127 17694 0.14% 128 18168 0.15% 129 18698 0.15% 130 19206 0.15% 131 19695 0.16% 132 19600 0.16% 133 20327 0.16% 134 20538 0.17% 135 20801 0.17% 136 21955 0.18% 137 22480 0.18% 138 23142 0.19% 139 24224 0.20% 140 24566 0.20% 141 25265 0.20% 142 25283 0.20% 143 25495 0.21% 144 25784 0.21% 145 26616 0.21% 146 27098 0.22% 147 27766 0.22% 148 28862 0.23% 149 29410 0.24% 150 29830 0.24% 151 11431556 92.10% 12411499 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=0.58 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.15 sequence-density-rank=17 fanout-score=22.77 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=8.0 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=26 prefix-density=0.83 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=39.34 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.2 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACCGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG SRR12917558 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:44:31 Started mapping on | Feb 13 13:44:31 Finished on | Feb 13 13:46:06 Mapping speed, Million of reads per hour | 470.33 Number of input reads | 12411499 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 11797446 Uniquely mapped reads % | 95.05% Average mapped length | 296.90 Number of splices: Total | 11921688 Number of splices: Annotated (sjdb) | 11670441 Number of splices: GT/AG | 11677500 Number of splices: GC/AG | 199748 Number of splices: AT/AC | 7992 Number of splices: Non-canonical | 36448 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305537 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 29932 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 308516 308516 308516 N_multimapping 305537 305537 305537 N_noFeature 421583 11629113 474467 N_ambiguous 196115 721 80206 UnstrandedReadsAssigned:11179748 PositiveStrandReadsAssigned:167612 NegativeStrandReadsAssigned:11242773 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917558 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917558-trimmed-pair1.fastq SRR12917558-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,411,499 reads, 11,245,798 reads pseudoaligned [quant] estimated average fragment length: 270.077 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR12917558.ke.tsv 34699 SRR12917558.se.tsv 87100 total ==> SRR12917558.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.92 315 14.8416 Potri.005G024800.1.v4.1 1035 765.923 246 26.4661 Potri.004G059700.1.v4.1 961 692.099 17 2.02404 Potri.007G009000.2.v4.1 1416 1146.92 0 0 Potri.003G141000.2.v4.1 2943 2673.92 471.873 14.5417 Potri.016G087400.1.v4.1 270 78.4276 576 605.191 Potri.015G069301.1.v4.1 564 310.066 0 0 Potri.010G195200.1.v4.1 1773 1503.92 30 1.64375 Potri.012G127500.1.v4.1 977 708.023 233 27.1174 ==> SRR12917558.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 89 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 161 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12917558 completed mapping pipeline successfully