Starting /dee2/code/volunteer_pipeline.sh SRR12917559 current disk space = 3090321997824 free memory = 1461683164 SRR12917559 SRAfilesize 2cc6f5b74dadb204963bdf874773becb SRR12917559.sra SRR12917559.sra file validated SRR12917559 is paired end SRR12917559 is conventional basespace SRR12917559 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917559_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.59375 37.0 37.0 37.0 37.0 37.0 2 36.4795 37.0 37.0 37.0 37.0 37.0 3 36.5575 37.0 37.0 37.0 37.0 37.0 4 36.6055 37.0 37.0 37.0 37.0 37.0 5 36.624 37.0 37.0 37.0 37.0 37.0 6 36.641 37.0 37.0 37.0 37.0 37.0 7 36.6155 37.0 37.0 37.0 37.0 37.0 8 36.551 37.0 37.0 37.0 37.0 37.0 9 36.5835 37.0 37.0 37.0 37.0 37.0 10-14 36.614700000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.603899999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5438 37.0 37.0 37.0 37.0 37.0 25-29 36.5428 37.0 37.0 37.0 37.0 37.0 30-34 36.4898 37.0 37.0 37.0 37.0 37.0 35-39 36.471500000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.4625 37.0 37.0 37.0 37.0 37.0 45-49 36.417 37.0 37.0 37.0 37.0 37.0 50-54 36.3651 37.0 37.0 37.0 37.0 37.0 55-59 36.3538 37.0 37.0 37.0 37.0 37.0 60-64 36.352999999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.257799999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3192 37.0 37.0 37.0 37.0 37.0 75-79 36.292 37.0 37.0 37.0 37.0 37.0 80-84 36.314 37.0 37.0 37.0 37.0 37.0 85-89 36.252300000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2806 37.0 37.0 37.0 37.0 37.0 95-99 36.234500000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1864 37.0 37.0 37.0 37.0 37.0 105-109 36.0972 37.0 37.0 37.0 37.0 37.0 110-114 36.120599999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0399 37.0 37.0 37.0 37.0 37.0 120-124 36.0227 37.0 37.0 37.0 37.0 37.0 125-129 35.8206 37.0 37.0 37.0 37.0 37.0 130-134 35.82770000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.7793 37.0 37.0 37.0 37.0 37.0 140-144 35.5844 37.0 37.0 37.0 37.0 37.0 145-149 35.5082 37.0 37.0 37.0 37.0 37.0 150-151 35.2825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 2.0 24 3.0 25 3.0 26 5.0 27 5.0 28 12.0 29 17.0 30 22.0 31 24.0 32 50.0 33 76.0 34 139.0 35 312.0 36 3035.0 37 291.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.0112528132033 13.103275818954737 4.926231557889473 36.959239809952486 2 18.65 9.8 39.95 31.6 3 15.475 16.525000000000002 28.199999999999996 39.800000000000004 4 21.775 22.525000000000002 24.15 31.55 5 24.9 28.7 24.05 22.35 6 21.099999999999998 30.9 23.925 24.075 7 15.325 27.6 40.6 16.475 8 15.950000000000001 25.575 34.425 24.05 9 17.5 22.875 35.4 24.224999999999998 10-14 19.72 30.005 27.750000000000004 22.525000000000002 15-19 20.044999999999998 27.765 28.215 23.974999999999998 20-24 19.735 27.63 28.37 24.265 25-29 19.665 28.139999999999997 27.85 24.345 30-34 19.32 27.98 28.355000000000004 24.345 35-39 19.25 28.310000000000002 28.294999999999998 24.145 40-44 19.665 28.65 27.67 24.015 45-49 19.68 28.285 27.615000000000002 24.42 50-54 20.23 28.08 27.825 23.865 55-59 19.93 28.38 27.76 23.93 60-64 19.915 27.48 27.405 25.2 65-69 19.425 28.64 27.21 24.725 70-74 20.560000000000002 28.375 27.35 23.715 75-79 19.86 28.225 27.52 24.395 80-84 20.015 27.455000000000002 27.855 24.675 85-89 20.27 28.465 27.55 23.715 90-94 20.19 27.6 27.845 24.365000000000002 95-99 20.3 27.735 27.615000000000002 24.349999999999998 100-104 20.885 27.705000000000002 27.555000000000003 23.855 105-109 20.23 27.91 27.750000000000004 24.11 110-114 20.195 27.865000000000002 27.77 24.169999999999998 115-119 20.275000000000002 28.299999999999997 26.945000000000004 24.48 120-124 20.84 28.78 26.625 23.755000000000003 125-129 20.474999999999998 27.915 27.38 24.23 130-134 20.64 28.485 27.005000000000003 23.87 135-139 20.49 27.265 27.46 24.785 140-144 20.835 27.894999999999996 27.235 24.035 145-149 21.265 27.235 27.495000000000005 24.005000000000003 150-151 22.162499999999998 28.0875 26.137500000000003 23.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 3.0 26 2.0 27 6.5 28 10.5 29 7.0 30 9.5 31 18.5 32 24.0 33 30.0 34 40.5 35 55.5 36 76.0 37 91.0 38 120.0 39 159.5 40 199.5 41 234.0 42 240.0 43 253.5 44 285.0 45 281.5 46 260.5 47 260.5 48 245.0 49 219.5 50 184.0 51 149.5 52 123.0 53 96.0 54 79.5 55 60.0 56 40.0 57 31.0 58 29.0 59 20.0 60 10.5 61 6.5 62 6.0 63 5.5 64 5.0 65 5.0 66 4.5 67 2.5 68 0.5 69 0.0 70 0.5 71 1.5 72 2.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.4 #Duplication Level Percentage of deduplicated Percentage of total 1 91.82166301969366 83.92500000000001 2 7.138949671772429 13.05 3 0.87527352297593 2.4 4 0.13676148796498905 0.5 5 0.02735229759299781 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGGGCAACAGTTGAGTAATTCTCAAAAAGGTTATCATCCTGACCATCAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.425 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.7625 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 3.9125 0.0 0.0 0.0 0.0 128-129 4.15 0.0 0.0 0.0 0.0 130-131 4.487500000000001 0.0 0.0 0.0 0.0 132-133 4.675 0.0 0.0 0.0 0.0 134-135 5.1125 0.0 0.0 0.0 0.0 136-137 5.475 0.0 0.0 0.0 0.0 138-139 5.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917559 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917559_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.405 37.0 37.0 37.0 37.0 37.0 2 36.355 37.0 37.0 37.0 37.0 37.0 3 36.289 37.0 37.0 37.0 37.0 37.0 4 36.4055 37.0 37.0 37.0 37.0 37.0 5 36.352 37.0 37.0 37.0 37.0 37.0 6 36.317 37.0 37.0 37.0 37.0 37.0 7 36.3625 37.0 37.0 37.0 37.0 37.0 8 36.3885 37.0 37.0 37.0 37.0 37.0 9 36.3455 37.0 37.0 37.0 37.0 37.0 10-14 36.363299999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.2881 37.0 37.0 37.0 37.0 37.0 20-24 36.25020000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.1415 37.0 37.0 37.0 37.0 37.0 30-34 36.0899 37.0 37.0 37.0 37.0 37.0 35-39 36.0684 37.0 37.0 37.0 37.0 37.0 40-44 36.072199999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.0201 37.0 37.0 37.0 37.0 37.0 50-54 35.935599999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.9264 37.0 37.0 37.0 37.0 37.0 60-64 35.9531 37.0 37.0 37.0 37.0 37.0 65-69 35.9029 37.0 37.0 37.0 37.0 37.0 70-74 35.852000000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.833000000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.8351 37.0 37.0 37.0 37.0 37.0 85-89 35.791599999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.8163 37.0 37.0 37.0 37.0 37.0 95-99 35.781600000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.745400000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.64809999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.6738 37.0 37.0 37.0 37.0 37.0 115-119 35.662 37.0 37.0 37.0 37.0 37.0 120-124 35.5248 37.0 37.0 37.0 37.0 37.0 125-129 35.4497 37.0 37.0 37.0 37.0 37.0 130-134 35.4491 37.0 37.0 37.0 37.0 37.0 135-139 35.370999999999995 37.0 37.0 37.0 34.6 37.0 140-144 35.1862 37.0 37.0 37.0 29.8 37.0 145-149 35.1233 37.0 37.0 37.0 27.4 37.0 150-151 34.61425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 2.0 16 4.0 17 2.0 18 3.0 19 5.0 20 2.0 21 3.0 22 6.0 23 6.0 24 13.0 25 10.0 26 6.0 27 13.0 28 14.0 29 20.0 30 22.0 31 29.0 32 44.0 33 94.0 34 184.0 35 562.0 36 2743.0 37 206.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.65 27.35 7.75 24.25 2 27.500000000000004 25.650000000000002 30.675 16.175 3 20.25 27.700000000000003 33.7 18.35 4 24.099999999999998 33.475 22.45 19.975 5 26.724999999999998 37.7 20.275000000000002 15.299999999999999 6 21.075 38.800000000000004 23.150000000000002 16.975 7 20.625 23.05 37.425000000000004 18.9 8 19.275000000000002 25.2 29.925 25.6 9 21.675 23.625 32.45 22.25 10-14 23.315 29.020000000000003 27.245 20.419999999999998 15-19 23.655 28.439999999999998 27.24 20.665 20-24 23.315 28.67 27.26 20.755000000000003 25-29 23.1 28.199999999999996 27.384999999999998 21.315 30-34 23.68 27.845 28.08 20.395 35-39 23.195 28.910000000000004 26.945000000000004 20.95 40-44 23.185 28.32 27.685 20.810000000000002 45-49 23.835 28.4 26.655 21.11 50-54 23.65 28.27 27.625 20.455000000000002 55-59 23.645 28.244999999999997 27.37 20.74 60-64 24.05 28.115000000000002 27.355 20.48 65-69 23.585 27.805000000000003 27.675 20.935000000000002 70-74 24.34 27.889999999999997 27.395000000000003 20.375 75-79 24.099999999999998 27.79 27.200000000000003 20.91 80-84 23.915 27.860000000000003 27.150000000000002 21.075 85-89 24.445 27.495000000000005 27.3 20.76 90-94 24.325 27.455000000000002 27.735 20.485 95-99 23.990000000000002 27.62 27.68 20.71 100-104 24.275 27.315 27.955000000000002 20.455000000000002 105-109 24.15 27.98 27.97 19.900000000000002 110-114 23.785 28.315 27.105 20.794999999999998 115-119 24.82 27.715 27.045 20.419999999999998 120-124 24.310000000000002 27.85 27.73 20.11 125-129 24.965 28.09 27.04 19.905 130-134 25.1 28.765 26.47 19.665 135-139 25.430000000000003 28.025 27.025 19.52 140-144 25.650000000000002 28.549999999999997 25.979999999999997 19.82 145-149 26.21 27.794999999999998 26.87 19.125 150-151 26.0 28.575 25.887500000000003 19.537499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 3.0 22 2.5 23 3.0 24 2.5 25 3.0 26 4.5 27 5.0 28 9.5 29 10.5 30 10.0 31 16.0 32 24.0 33 31.0 34 45.0 35 58.0 36 73.0 37 114.5 38 140.0 39 158.0 40 196.5 41 235.0 42 255.5 43 261.5 44 270.0 45 281.0 46 278.5 47 255.0 48 237.5 49 209.0 50 155.5 51 122.0 52 107.5 53 94.5 54 73.5 55 45.5 56 39.5 57 35.0 58 22.0 59 15.5 60 14.5 61 9.5 62 7.5 63 7.0 64 4.0 65 3.5 66 4.5 67 3.5 68 2.0 69 2.0 70 2.0 71 3.5 72 2.5 73 1.0 74 2.0 75 1.0 76 1.0 77 1.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 1.0 85 1.0 86 0.0 87 0.0 88 0.5 89 1.5 90 1.0 91 0.5 92 1.0 93 1.0 94 0.5 95 0.0 96 0.5 97 1.0 98 1.0 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.85855263157895 83.775 2 7.044956140350878 12.85 3 0.9046052631578948 2.475 4 0.10964912280701754 0.4 5 0.027412280701754384 0.125 6 0.027412280701754384 0.15 7 0.0 0.0 8 0.0 0.0 9 0.027412280701754384 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GTTGCATTTATCTAAAGTATTGTCACTTTACTTAACACTTGAGCTGCATA 6 0.15 No Hit AAACAATTCAGTATCTTATTGGGTCAGGAATGGATCCTAAAACAGAAAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.2999999999999998 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0125 0.0 0.0 120-121 3.0250000000000004 0.0 0.025 0.0 0.0 122-123 3.3875 0.0 0.025 0.0 0.0 124-125 3.7125 0.0 0.025 0.0 0.0 126-127 3.9375 0.0 0.025 0.0 0.0 128-129 4.2125 0.0 0.025 0.0 0.0 130-131 4.5875 0.0 0.025 0.0 0.0 132-133 4.8 0.0 0.025 0.0 0.0 134-135 5.2375 0.0 0.025 0.0 0.0 136-137 5.6 0.0 0.025 0.0 0.0 138-139 5.9375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAACA 10 0.006830828 145.0 9 TCAGCTC 10 0.006830828 145.0 9 AGTATAC 10 0.006830828 145.0 145 TTGGCCT 10 0.006830828 145.0 7 CTTTGGC 10 0.006830828 145.0 5 >>END_MODULE Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra Read 591187 spots for SRR12917559.sra Written 591187 spots for SRR12917559.sra Read 591169 spots for SRR12917559.sra Written 591169 spots for SRR12917559.sra SRR ids: ['SRR12917559.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ug89xfg5 SRR12917559.sra spots: 11823398 blocks: [[1, 591169], [591170, 1182338], [1182339, 1773507], [1773508, 2364676], [2364677, 2955845], [2955846, 3547014], [3547015, 4138183], [4138184, 4729352], [4729353, 5320521], [5320522, 5911690], [5911691, 6502859], [6502860, 7094028], [7094029, 7685197], [7685198, 8276366], [8276367, 8867535], [8867536, 9458704], [9458705, 10049873], [10049874, 10641042], [10641043, 11232211], [11232212, 11823398]] SRR12917559 file size 3996407 SRR12917559 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917559 SRR12917559_1.fastq SRR12917559_2.fastq Input file: SRR12917559_1.fastq Paired file: SRR12917559_2.fastq trimmed: SRR12917559-trimmed-pair1.fastq, SRR12917559-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:53:25 2025 >> started Thu Feb 13 13:53:37 2025 >> done (12.169s) 11823398 read pairs processed; of these: 122 ( 0.00%) short read pairs filtered out after trimming by size control 3507 ( 0.03%) empty read pairs filtered out after trimming by size control 11819769 (99.97%) read pairs available; of these: 978932 ( 8.28%) trimmed read pairs available after processing 10840837 (91.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 10 0.00% 21 18 0.00% 22 22 0.00% 23 17 0.00% 24 26 0.00% 25 20 0.00% 26 23 0.00% 27 20 0.00% 28 20 0.00% 29 17 0.00% 30 31 0.00% 31 34 0.00% 32 36 0.00% 33 30 0.00% 34 28 0.00% 35 19 0.00% 36 37 0.00% 37 25 0.00% 38 36 0.00% 39 25 0.00% 40 31 0.00% 41 33 0.00% 42 48 0.00% 43 39 0.00% 44 40 0.00% 45 54 0.00% 46 53 0.00% 47 67 0.00% 48 69 0.00% 49 77 0.00% 50 82 0.00% 51 77 0.00% 52 122 0.00% 53 131 0.00% 54 108 0.00% 55 124 0.00% 56 138 0.00% 57 157 0.00% 58 215 0.00% 59 233 0.00% 60 263 0.00% 61 304 0.00% 62 365 0.00% 63 404 0.00% 64 431 0.00% 65 439 0.00% 66 522 0.00% 67 555 0.00% 68 625 0.01% 69 713 0.01% 70 869 0.01% 71 921 0.01% 72 1046 0.01% 73 1280 0.01% 74 1371 0.01% 75 1485 0.01% 76 1634 0.01% 77 1771 0.01% 78 1865 0.02% 79 2018 0.02% 80 2116 0.02% 81 2463 0.02% 82 2700 0.02% 83 3037 0.03% 84 3242 0.03% 85 3467 0.03% 86 3803 0.03% 87 3864 0.03% 88 4041 0.03% 89 4195 0.04% 90 4435 0.04% 91 4756 0.04% 92 4978 0.04% 93 5399 0.05% 94 5810 0.05% 95 5989 0.05% 96 6471 0.05% 97 6518 0.06% 98 6651 0.06% 99 7102 0.06% 100 7174 0.06% 101 7409 0.06% 102 7835 0.07% 103 8203 0.07% 104 8555 0.07% 105 9031 0.08% 106 9757 0.08% 107 9744 0.08% 108 10261 0.09% 109 10320 0.09% 110 10508 0.09% 111 10642 0.09% 112 11169 0.09% 113 11429 0.10% 114 12004 0.10% 115 12766 0.11% 116 13394 0.11% 117 13674 0.12% 118 14033 0.12% 119 14045 0.12% 120 14718 0.12% 121 14765 0.12% 122 14986 0.13% 123 15248 0.13% 124 15958 0.14% 125 16326 0.14% 126 17103 0.14% 127 17730 0.15% 128 18312 0.15% 129 18647 0.16% 130 18922 0.16% 131 19080 0.16% 132 19703 0.17% 133 20129 0.17% 134 19824 0.17% 135 21138 0.18% 136 21307 0.18% 137 22035 0.19% 138 22784 0.19% 139 23266 0.20% 140 23355 0.20% 141 23979 0.20% 142 24771 0.21% 143 24205 0.20% 144 25492 0.22% 145 25167 0.21% 146 26005 0.22% 147 26846 0.23% 148 27067 0.23% 149 27639 0.23% 150 28141 0.24% 151 10840837 91.72% 11819769 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=27 prefix-density=0.47 prefix-fanout=2.0 sequence=GCTTTATTTCGAACGTAAAAATCAGAAGTAGAACTCTTCGATCCAAAGACAACTTTGGGTTTTCCGGGCAGGCATT criterion=fanout-score sequence-density=0.14 sequence-density-rank=12 fanout-score=17.47 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=7.6 sequence=CATCTTCTCATCA criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=28 prefix-density=0.65 prefix-fanout=2.1 sequence=TCACTTTACTTAACACTTGAGCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=433.20 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=16.4 sequence=GAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12917559 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 13:54:21 Started mapping on | Feb 13 13:54:21 Finished on | Feb 13 13:55:36 Mapping speed, Million of reads per hour | 567.35 Number of input reads | 11819769 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10973841 Uniquely mapped reads % | 92.84% Average mapped length | 296.45 Number of splices: Total | 10678085 Number of splices: Annotated (sjdb) | 10479631 Number of splices: GT/AG | 10489643 Number of splices: GC/AG | 147394 Number of splices: AT/AC | 10087 Number of splices: Non-canonical | 30961 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 3.10 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280186 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 103276 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 565742 565742 565742 N_multimapping 280186 280186 280186 N_noFeature 266387 10859161 317897 N_ambiguous 127084 406 63704 UnstrandedReadsAssigned:10580370 PositiveStrandReadsAssigned:114274 NegativeStrandReadsAssigned:10592240 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917559 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917559-trimmed-pair1.fastq SRR12917559-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,819,769 reads, 10,681,642 reads pseudoaligned [quant] estimated average fragment length: 273.212 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR12917559.ke.tsv 34699 SRR12917559.se.tsv 87100 total ==> SRR12917559.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.79 367 20.2217 Potri.005G024800.1.v4.1 1035 762.788 200 25.2214 Potri.004G059700.1.v4.1 961 689.055 14 1.95442 Potri.007G009000.2.v4.1 1416 1143.79 0 0 Potri.003G141000.2.v4.1 2943 2670.79 501.227 18.0525 Potri.016G087400.1.v4.1 270 80.5751 856 1021.92 Potri.015G069301.1.v4.1 564 309.479 0 0 Potri.010G195200.1.v4.1 1773 1500.79 107 6.85815 Potri.012G127500.1.v4.1 977 704.942 5057 690.052 ==> SRR12917559.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 39 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 119 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 37 SRR12917559 completed mapping pipeline successfully