Starting /dee2/code/volunteer_pipeline.sh SRR12917560 current disk space = 3090224480256 free memory = 1471426608 SRR12917560 SRAfilesize 4924e5e626d0d62cbbaec556e444d5b2 SRR12917560.sra SRR12917560.sra file validated SRR12917560 is paired end SRR12917560 is conventional basespace SRR12917560 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917560_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.567 37.0 37.0 37.0 37.0 37.0 2 36.49 37.0 37.0 37.0 37.0 37.0 3 36.4995 37.0 37.0 37.0 37.0 37.0 4 36.579 37.0 37.0 37.0 37.0 37.0 5 36.5745 37.0 37.0 37.0 37.0 37.0 6 36.669 37.0 37.0 37.0 37.0 37.0 7 36.504 37.0 37.0 37.0 37.0 37.0 8 36.5535 37.0 37.0 37.0 37.0 37.0 9 36.4865 37.0 37.0 37.0 37.0 37.0 10-14 36.5914 37.0 37.0 37.0 37.0 37.0 15-19 36.572199999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.523799999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.528999999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4423 37.0 37.0 37.0 37.0 37.0 35-39 36.4739 37.0 37.0 37.0 37.0 37.0 40-44 36.445 37.0 37.0 37.0 37.0 37.0 45-49 36.380700000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.40240000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.3709 37.0 37.0 37.0 37.0 37.0 60-64 36.3166 37.0 37.0 37.0 37.0 37.0 65-69 36.271699999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.2945 37.0 37.0 37.0 37.0 37.0 75-79 36.248900000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.2741 37.0 37.0 37.0 37.0 37.0 85-89 36.238099999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.27720000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1383 37.0 37.0 37.0 37.0 37.0 100-104 36.1297 37.0 37.0 37.0 37.0 37.0 105-109 36.1096 37.0 37.0 37.0 37.0 37.0 110-114 36.074200000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.009499999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.007600000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.932100000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.884100000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.8305 37.0 37.0 37.0 37.0 37.0 140-144 35.7431 37.0 37.0 37.0 37.0 37.0 145-149 35.647800000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.44625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 2.0 24 2.0 25 6.0 26 7.0 27 3.0 28 13.0 29 15.0 30 22.0 31 28.0 32 39.0 33 73.0 34 145.0 35 332.0 36 2983.0 37 328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.225 12.85 4.5 33.425 2 20.349999999999998 11.075 37.8 30.775000000000002 3 17.7 17.775 28.9 35.625 4 22.775000000000002 22.95 25.724999999999998 28.549999999999997 5 22.875 30.049999999999997 24.875 22.2 6 19.975 33.6 23.95 22.475 7 14.075 28.425 40.5 17.0 8 15.65 26.150000000000002 33.875 24.325 9 16.150000000000002 22.650000000000002 35.975 25.224999999999998 10-14 18.9 29.935000000000002 28.225 22.939999999999998 15-19 19.439999999999998 28.525 27.889999999999997 24.145 20-24 19.425 29.25 27.955000000000002 23.369999999999997 25-29 19.470000000000002 28.645 27.87 24.015 30-34 19.915 28.694999999999997 27.68 23.71 35-39 19.645000000000003 28.735 28.13 23.49 40-44 19.195 29.604999999999997 27.49 23.71 45-49 19.470000000000002 28.025 28.299999999999997 24.205 50-54 19.615 28.165000000000003 28.02 24.2 55-59 19.455 28.83 28.005000000000003 23.71 60-64 19.400000000000002 28.67 28.165000000000003 23.765 65-69 19.325 29.535 27.755000000000003 23.385 70-74 20.02 29.07 27.49 23.419999999999998 75-79 19.650000000000002 28.625 28.015 23.71 80-84 18.790000000000003 28.999999999999996 27.915 24.295 85-89 20.125 28.895 27.68 23.3 90-94 19.405 29.09 27.37 24.135 95-99 20.465 28.38 27.689999999999998 23.465 100-104 20.05 28.915000000000003 27.62 23.415 105-109 20.72 28.655 27.48 23.145 110-114 20.605 28.910000000000004 27.68 22.805 115-119 19.794999999999998 28.675 28.000000000000004 23.53 120-124 20.24 28.055000000000003 27.93 23.775 125-129 20.025000000000002 28.96 27.005000000000003 24.01 130-134 20.674999999999997 28.884999999999998 27.279999999999998 23.16 135-139 20.26 28.355000000000004 27.634999999999998 23.75 140-144 20.765 28.08 27.42 23.735 145-149 20.27 28.18 27.525 24.025 150-151 19.7125 28.4 27.1375 24.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 3.0 25 3.5 26 7.0 27 11.5 28 10.5 29 10.0 30 20.5 31 28.0 32 34.5 33 46.0 34 50.0 35 71.0 36 93.0 37 111.0 38 130.5 39 151.5 40 186.0 41 237.0 42 270.0 43 271.5 44 270.0 45 282.5 46 283.5 47 272.5 48 239.0 49 182.5 50 151.5 51 126.5 52 116.0 53 91.0 54 59.0 55 46.0 56 32.0 57 28.0 58 23.5 59 11.5 60 5.5 61 6.0 62 5.5 63 3.5 64 4.0 65 3.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.83951965065502 84.125 2 7.259825327510917 13.3 3 0.7914847161572052 2.175 4 0.10917030567685589 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.3875 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.6749999999999998 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.1875 0.0 0.0 0.0 0.0 124-125 2.425 0.0 0.0 0.0 0.0 126-127 2.6875 0.0 0.0 0.0 0.0 128-129 2.8875 0.0 0.0 0.0 0.0 130-131 3.1500000000000004 0.0 0.0 0.0 0.0 132-133 3.3875 0.0 0.0 0.0 0.0 134-135 3.5875 0.0 0.0 0.0 0.0 136-137 3.9625000000000004 0.0 0.0 0.0 0.0 138-139 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.00593511 29.0 75-79 >>END_MODULE SRR12917560 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917560_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2145 37.0 37.0 37.0 37.0 37.0 2 36.0915 37.0 37.0 37.0 37.0 37.0 3 36.1355 37.0 37.0 37.0 37.0 37.0 4 36.128 37.0 37.0 37.0 37.0 37.0 5 36.1585 37.0 37.0 37.0 37.0 37.0 6 36.078 37.0 37.0 37.0 37.0 37.0 7 36.205 37.0 37.0 37.0 37.0 37.0 8 36.1665 37.0 37.0 37.0 37.0 37.0 9 36.2535 37.0 37.0 37.0 37.0 37.0 10-14 36.1534 37.0 37.0 37.0 37.0 37.0 15-19 36.115300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.0514 37.0 37.0 37.0 37.0 37.0 25-29 35.9217 37.0 37.0 37.0 37.0 37.0 30-34 35.9015 37.0 37.0 37.0 37.0 37.0 35-39 35.839600000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.8317 37.0 37.0 37.0 37.0 37.0 45-49 35.698299999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.7238 37.0 37.0 37.0 37.0 37.0 55-59 35.7001 37.0 37.0 37.0 37.0 37.0 60-64 35.69010000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.65070000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.6353 37.0 37.0 37.0 37.0 37.0 75-79 35.5357 37.0 37.0 37.0 37.0 37.0 80-84 35.549099999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.5598 37.0 37.0 37.0 37.0 37.0 90-94 35.588100000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.4705 37.0 37.0 37.0 37.0 37.0 100-104 35.4313 37.0 37.0 37.0 37.0 37.0 105-109 35.3892 37.0 37.0 37.0 37.0 37.0 110-114 35.36129999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.293800000000005 37.0 37.0 37.0 32.2 37.0 120-124 35.301 37.0 37.0 37.0 37.0 37.0 125-129 35.1906 37.0 37.0 37.0 29.8 37.0 130-134 35.1614 37.0 37.0 37.0 27.4 37.0 135-139 35.0835 37.0 37.0 37.0 27.4 37.0 140-144 34.9981 37.0 37.0 37.0 25.0 37.0 145-149 34.861599999999996 37.0 37.0 37.0 25.0 37.0 150-151 34.533500000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 7.0 14 8.0 15 9.0 16 5.0 17 4.0 18 3.0 19 6.0 20 6.0 21 7.0 22 4.0 23 8.0 24 12.0 25 8.0 26 11.0 27 8.0 28 20.0 29 26.0 30 21.0 31 50.0 32 64.0 33 118.0 34 216.0 35 621.0 36 2574.0 37 184.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.65 25.474999999999998 7.675 21.2 2 28.999999999999996 24.825 31.25 14.924999999999999 3 21.625 27.224999999999998 33.95 17.2 4 25.3 31.55 24.55 18.6 5 25.575 37.15 20.225 17.05 6 21.15 40.35 20.9 17.599999999999998 7 21.925 23.625 37.0 17.45 8 20.325 25.15 30.075000000000003 24.45 9 22.275 24.725 29.975 23.025000000000002 10-14 24.27 28.854999999999997 26.419999999999998 20.455000000000002 15-19 24.13 28.575 26.884999999999998 20.41 20-24 23.325000000000003 28.28 28.189999999999998 20.205000000000002 25-29 23.215 27.565 28.49 20.73 30-34 23.69 28.115000000000002 27.87 20.325 35-39 23.82 28.125 27.665 20.39 40-44 23.595 28.345 27.435 20.625 45-49 23.815 28.025 27.884999999999998 20.275000000000002 50-54 24.0 27.955000000000002 27.12 20.925 55-59 23.7 29.345 27.295 19.66 60-64 23.655 28.07 27.51 20.765 65-69 23.51 28.07 27.935 20.485 70-74 23.48 28.634999999999998 27.985 19.900000000000002 75-79 24.11 28.16 27.389999999999997 20.34 80-84 23.855 28.46 27.715 19.97 85-89 24.005000000000003 28.444999999999997 27.500000000000004 20.05 90-94 23.775 27.994999999999997 28.07 20.16 95-99 23.73 28.244999999999997 27.57 20.455000000000002 100-104 23.565 28.22 28.18 20.035 105-109 23.65 29.160000000000004 27.185 20.005 110-114 24.255 28.67 27.555000000000003 19.52 115-119 24.765 28.249999999999996 27.250000000000004 19.735 120-124 24.325 28.749999999999996 27.13 19.794999999999998 125-129 24.365000000000002 28.235 27.639999999999997 19.759999999999998 130-134 24.740000000000002 27.79 27.950000000000003 19.52 135-139 24.529999999999998 28.325 27.455000000000002 19.689999999999998 140-144 24.535 28.43 27.51 19.525000000000002 145-149 25.174999999999997 28.610000000000003 26.905 19.31 150-151 25.9875 28.125 27.212500000000002 18.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.5 9 1.0 10 0.0 11 0.0 12 1.0 13 1.5 14 0.5 15 0.0 16 1.0 17 2.0 18 1.0 19 1.5 20 3.0 21 2.5 22 2.0 23 2.0 24 2.5 25 3.0 26 5.5 27 8.0 28 9.0 29 13.5 30 18.0 31 24.5 32 31.5 33 41.0 34 55.0 35 62.0 36 70.5 37 96.0 38 136.5 39 182.0 40 223.5 41 244.0 42 245.0 43 272.5 44 296.0 45 285.5 46 259.0 47 230.5 48 222.5 49 186.0 50 151.5 51 136.0 52 102.5 53 72.5 54 62.5 55 48.0 56 32.0 57 27.0 58 16.5 59 16.5 60 14.5 61 8.0 62 7.5 63 6.0 64 4.0 65 2.0 66 0.5 67 0.5 68 0.0 69 0.5 70 1.5 71 2.0 72 2.0 73 1.0 74 0.5 75 0.5 76 0.5 77 0.5 78 1.0 79 1.5 80 1.0 81 1.0 82 1.0 83 1.0 84 1.0 85 1.0 86 1.5 87 1.5 88 0.5 89 1.0 90 1.5 91 1.0 92 2.0 93 1.5 94 1.0 95 1.5 96 0.5 97 1.0 98 1.0 99 2.0 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 92.46930422919509 84.725 2 6.575716234652114 12.049999999999999 3 0.8185538881309686 2.25 4 0.10914051841746249 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027285129604365622 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 23 0.575 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.3875 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.6749999999999998 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.1624999999999996 0.0 0.0 0.0 0.0 124-125 2.4000000000000004 0.0 0.0 0.0 0.0 126-127 2.675 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.175 0.0 0.0 0.0 0.0 132-133 3.4125 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCAAT 10 0.006830828 145.0 6 AACACCA 10 0.006830828 145.0 7 >>END_MODULE Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593288 spots for SRR12917560.sra Written 593288 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra Read 593279 spots for SRR12917560.sra Written 593279 spots for SRR12917560.sra SRR ids: ['SRR12917560.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_by78rzj3 SRR12917560.sra spots: 11865589 blocks: [[1, 593279], [593280, 1186558], [1186559, 1779837], [1779838, 2373116], [2373117, 2966395], [2966396, 3559674], [3559675, 4152953], [4152954, 4746232], [4746233, 5339511], [5339512, 5932790], [5932791, 6526069], [6526070, 7119348], [7119349, 7712627], [7712628, 8305906], [8305907, 8899185], [8899186, 9492464], [9492465, 10085743], [10085744, 10679022], [10679023, 11272301], [11272302, 11865589]] SRR12917560 file size 4010745 SRR12917560 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917560 SRR12917560_1.fastq SRR12917560_2.fastq Input file: SRR12917560_1.fastq Paired file: SRR12917560_2.fastq trimmed: SRR12917560-trimmed-pair1.fastq, SRR12917560-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 13:59:36 2025 >> started Thu Feb 13 13:59:49 2025 >> done (12.880s) 11865589 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 4569 ( 0.04%) empty read pairs filtered out after trimming by size control 11860926 (99.96%) read pairs available; of these: 770826 ( 6.50%) trimmed read pairs available after processing 11090100 (93.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 16 0.00% 20 23 0.00% 21 23 0.00% 22 25 0.00% 23 20 0.00% 24 21 0.00% 25 28 0.00% 26 23 0.00% 27 19 0.00% 28 23 0.00% 29 22 0.00% 30 32 0.00% 31 37 0.00% 32 23 0.00% 33 33 0.00% 34 28 0.00% 35 35 0.00% 36 39 0.00% 37 28 0.00% 38 22 0.00% 39 20 0.00% 40 24 0.00% 41 28 0.00% 42 32 0.00% 43 28 0.00% 44 30 0.00% 45 32 0.00% 46 37 0.00% 47 46 0.00% 48 50 0.00% 49 58 0.00% 50 53 0.00% 51 57 0.00% 52 75 0.00% 53 71 0.00% 54 76 0.00% 55 75 0.00% 56 73 0.00% 57 113 0.00% 58 121 0.00% 59 123 0.00% 60 165 0.00% 61 189 0.00% 62 190 0.00% 63 254 0.00% 64 256 0.00% 65 294 0.00% 66 358 0.00% 67 352 0.00% 68 402 0.00% 69 428 0.00% 70 508 0.00% 71 582 0.00% 72 687 0.01% 73 756 0.01% 74 819 0.01% 75 943 0.01% 76 1061 0.01% 77 1102 0.01% 78 1187 0.01% 79 1288 0.01% 80 1388 0.01% 81 1543 0.01% 82 1796 0.02% 83 1926 0.02% 84 2236 0.02% 85 2338 0.02% 86 2399 0.02% 87 2601 0.02% 88 2661 0.02% 89 2811 0.02% 90 3048 0.03% 91 3238 0.03% 92 3356 0.03% 93 3861 0.03% 94 3984 0.03% 95 4388 0.04% 96 4533 0.04% 97 4784 0.04% 98 4842 0.04% 99 4950 0.04% 100 5085 0.04% 101 5367 0.05% 102 5659 0.05% 103 5929 0.05% 104 6343 0.05% 105 6619 0.06% 106 7044 0.06% 107 7201 0.06% 108 7634 0.06% 109 7530 0.06% 110 7807 0.07% 111 8054 0.07% 112 8588 0.07% 113 8642 0.07% 114 9192 0.08% 115 9353 0.08% 116 9782 0.08% 117 10463 0.09% 118 10703 0.09% 119 10774 0.09% 120 10877 0.09% 121 11074 0.09% 122 11638 0.10% 123 12133 0.10% 124 12871 0.11% 125 12940 0.11% 126 13735 0.12% 127 14081 0.12% 128 14445 0.12% 129 14837 0.13% 130 15140 0.13% 131 15375 0.13% 132 15937 0.13% 133 16292 0.14% 134 16674 0.14% 135 17173 0.14% 136 17761 0.15% 137 18158 0.15% 138 18717 0.16% 139 18961 0.16% 140 19224 0.16% 141 20009 0.17% 142 20242 0.17% 143 20052 0.17% 144 21435 0.18% 145 21678 0.18% 146 22070 0.19% 147 22606 0.19% 148 23066 0.19% 149 23588 0.20% 150 24016 0.20% 151 11090100 93.50% 11860926 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=27 prefix-density=0.22 prefix-fanout=2.8 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCCAGAGTCTGAACT criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=244.88 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=19.6 sequence=ATTTCATCAAAAAAGGAACGTACATGTGGATGATATACACCCAGTTTATTTAAATTAGGAGGCCATTTAT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=34 prefix-density=0.21 prefix-fanout=2.0 sequence=CATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=535.70 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=21.2 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAAGCTCTTATGCGTTCGTCATTGACATGCCGGGACTGAAATCAGGGGACATCAAGGTTCAAGTGGAGGATGACAATGTGCTGGTTATCAGTGGAGAGAGGAAGCGCG SRR12917560 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:00:32 Started mapping on | Feb 13 14:00:32 Finished on | Feb 13 14:01:55 Mapping speed, Million of reads per hour | 514.45 Number of input reads | 11860926 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 10913804 Uniquely mapped reads % | 92.01% Average mapped length | 297.25 Number of splices: Total | 10239384 Number of splices: Annotated (sjdb) | 9969718 Number of splices: GT/AG | 10047827 Number of splices: GC/AG | 148569 Number of splices: AT/AC | 12137 Number of splices: Non-canonical | 30851 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.03% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 292919 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 38505 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.86% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 654203 654203 654203 N_multimapping 292919 292919 292919 N_noFeature 443194 10783611 507284 N_ambiguous 141760 662 75282 UnstrandedReadsAssigned:10328850 PositiveStrandReadsAssigned:129531 NegativeStrandReadsAssigned:10331238 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917560 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917560-trimmed-pair1.fastq SRR12917560-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,860,926 reads, 10,418,968 reads pseudoaligned [quant] estimated average fragment length: 282.579 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR12917560.ke.tsv 34699 SRR12917560.se.tsv 87100 total ==> SRR12917560.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.42 508 29.1855 Potri.005G024800.1.v4.1 1035 753.421 129 17.0809 Potri.004G059700.1.v4.1 961 679.719 64 9.39309 Potri.007G009000.2.v4.1 1416 1134.42 0 0 Potri.003G141000.2.v4.1 2943 2661.42 348.525 13.0641 Potri.016G087400.1.v4.1 270 77.3173 726 936.738 Potri.015G069301.1.v4.1 564 302.252 0 0 Potri.010G195200.1.v4.1 1773 1491.42 33 2.20735 Potri.012G127500.1.v4.1 977 695.572 7130 1022.6 ==> SRR12917560.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 169 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 155 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 6 SRR12917560 completed mapping pipeline successfully