Starting /dee2/code/volunteer_pipeline.sh SRR12917561 current disk space = 3089506062336 free memory = 1582549200 SRR12917561 SRAfilesize 0fa7e8ea86fff72a6709904801aebbd0 SRR12917561.sra SRR12917561.sra file validated SRR12917561 is paired end SRR12917561 is conventional basespace SRR12917561 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917561_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5675 37.0 37.0 37.0 37.0 37.0 2 36.437 37.0 37.0 37.0 37.0 37.0 3 36.578 37.0 37.0 37.0 37.0 37.0 4 36.6595 37.0 37.0 37.0 37.0 37.0 5 36.6295 37.0 37.0 37.0 37.0 37.0 6 36.5945 37.0 37.0 37.0 37.0 37.0 7 36.5285 37.0 37.0 37.0 37.0 37.0 8 36.608 37.0 37.0 37.0 37.0 37.0 9 36.631 37.0 37.0 37.0 37.0 37.0 10-14 36.632999999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6119 37.0 37.0 37.0 37.0 37.0 20-24 36.566599999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.4812 37.0 37.0 37.0 37.0 37.0 30-34 36.499900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.5197 37.0 37.0 37.0 37.0 37.0 40-44 36.514799999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.4514 37.0 37.0 37.0 37.0 37.0 50-54 36.4437 37.0 37.0 37.0 37.0 37.0 55-59 36.409499999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.391099999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.3079 37.0 37.0 37.0 37.0 37.0 70-74 36.313 37.0 37.0 37.0 37.0 37.0 75-79 36.299299999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.3347 37.0 37.0 37.0 37.0 37.0 85-89 36.2708 37.0 37.0 37.0 37.0 37.0 90-94 36.232600000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.180600000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.1614 37.0 37.0 37.0 37.0 37.0 105-109 36.1365 37.0 37.0 37.0 37.0 37.0 110-114 36.0597 37.0 37.0 37.0 37.0 37.0 115-119 36.030800000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.9996 37.0 37.0 37.0 37.0 37.0 125-129 35.958800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.8915 37.0 37.0 37.0 37.0 37.0 135-139 35.8239 37.0 37.0 37.0 37.0 37.0 140-144 35.7341 37.0 37.0 37.0 37.0 37.0 145-149 35.653499999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.432 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 3.0 23 3.0 24 1.0 25 2.0 26 1.0 27 3.0 28 9.0 29 18.0 30 23.0 31 27.0 32 45.0 33 75.0 34 120.0 35 316.0 36 3047.0 37 304.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.601300650325165 11.330665332666333 4.852426213106553 31.21560780390195 2 18.275 10.025 37.574999999999996 34.125 3 16.275000000000002 17.25 28.925 37.55 4 21.475 23.65 25.05 29.825000000000003 5 23.125 29.7 25.2 21.975 6 20.175 33.425 24.275 22.125 7 15.5 27.825 40.775 15.9 8 15.825 26.0 34.35 23.825 9 17.349999999999998 24.45 35.175 23.025000000000002 10-14 19.220000000000002 29.955 28.060000000000002 22.765 15-19 20.035 27.61 28.28 24.075 20-24 20.055 28.865000000000002 27.725 23.355 25-29 20.505000000000003 28.335 27.605 23.555 30-34 19.68 27.755000000000003 28.23 24.335 35-39 19.975 28.194999999999997 27.96 23.87 40-44 19.950000000000003 27.865000000000002 28.084999999999997 24.099999999999998 45-49 20.105 28.975 27.229999999999997 23.69 50-54 20.645 28.12 27.474999999999998 23.76 55-59 20.055 29.095 27.400000000000002 23.45 60-64 19.759999999999998 28.67 27.415 24.154999999999998 65-69 20.525 27.985 27.034999999999997 24.455 70-74 19.89 28.73 27.76 23.62 75-79 20.565 28.449999999999996 27.47 23.515 80-84 20.580000000000002 27.91 27.375 24.135 85-89 19.905 28.439999999999998 28.17 23.485 90-94 20.435 27.715 27.625 24.224999999999998 95-99 20.365 27.76 27.815 24.060000000000002 100-104 21.21 28.07 27.195000000000004 23.525 105-109 20.605 28.275 27.32 23.799999999999997 110-114 20.86 28.455000000000002 27.55 23.135 115-119 21.029999999999998 27.725 27.24 24.005000000000003 120-124 20.05 28.17 27.700000000000003 24.08 125-129 20.655 28.205000000000002 27.255000000000003 23.885 130-134 20.035 27.935 27.884999999999998 24.145 135-139 20.995 27.57 27.224999999999998 24.21 140-144 21.115000000000002 28.075 27.6 23.21 145-149 20.9 27.62 27.875 23.605 150-151 21.8875 27.950000000000003 26.687499999999996 23.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 2.5 25 2.5 26 4.5 27 8.0 28 12.0 29 12.0 30 14.0 31 20.0 32 29.0 33 36.0 34 37.0 35 64.0 36 81.5 37 88.5 38 124.5 39 166.0 40 184.0 41 194.5 42 221.0 43 260.0 44 276.0 45 271.5 46 270.0 47 276.0 48 248.0 49 204.5 50 184.0 51 161.0 52 130.0 53 92.0 54 79.5 55 63.5 56 46.5 57 38.5 58 23.0 59 17.0 60 16.5 61 9.5 62 5.5 63 4.5 64 4.0 65 3.0 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.3 #Duplication Level Percentage of deduplicated Percentage of total 1 91.53888280394304 83.575 2 7.584884994523549 13.850000000000001 3 0.7119386637458927 1.95 4 0.13691128148959475 0.5 5 0.027382256297918947 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.025 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.5125 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 2.9875 0.0 0.0 0.0 0.0 130-131 3.2874999999999996 0.0 0.0 0.0 0.0 132-133 3.6500000000000004 0.0 0.0 0.0 0.0 134-135 3.875 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138-139 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCATT 10 0.006830828 145.0 2 >>END_MODULE SRR12917561 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917561_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2525 37.0 37.0 37.0 37.0 37.0 2 36.2305 37.0 37.0 37.0 37.0 37.0 3 36.243 37.0 37.0 37.0 37.0 37.0 4 36.2395 37.0 37.0 37.0 37.0 37.0 5 36.303 37.0 37.0 37.0 37.0 37.0 6 36.2795 37.0 37.0 37.0 37.0 37.0 7 36.262 37.0 37.0 37.0 37.0 37.0 8 36.433 37.0 37.0 37.0 37.0 37.0 9 36.36 37.0 37.0 37.0 37.0 37.0 10-14 36.3094 37.0 37.0 37.0 37.0 37.0 15-19 36.2531 37.0 37.0 37.0 37.0 37.0 20-24 36.182900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.1764 37.0 37.0 37.0 37.0 37.0 30-34 36.0498 37.0 37.0 37.0 37.0 37.0 35-39 36.035700000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.0813 37.0 37.0 37.0 37.0 37.0 45-49 35.9386 37.0 37.0 37.0 37.0 37.0 50-54 35.9371 37.0 37.0 37.0 37.0 37.0 55-59 35.903999999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.9412 37.0 37.0 37.0 37.0 37.0 65-69 35.9168 37.0 37.0 37.0 37.0 37.0 70-74 35.8834 37.0 37.0 37.0 37.0 37.0 75-79 35.878699999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.8924 37.0 37.0 37.0 37.0 37.0 85-89 35.7656 37.0 37.0 37.0 37.0 37.0 90-94 35.8553 37.0 37.0 37.0 37.0 37.0 95-99 35.760200000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.7566 37.0 37.0 37.0 37.0 37.0 105-109 35.779199999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.714600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.679700000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.515499999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.4775 37.0 37.0 37.0 37.0 37.0 130-134 35.4258 37.0 37.0 37.0 34.6 37.0 135-139 35.459199999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.2266 37.0 37.0 37.0 27.4 37.0 145-149 35.2201 37.0 37.0 37.0 29.8 37.0 150-151 34.90975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 7.0 15 0.0 16 0.0 17 3.0 18 1.0 19 1.0 20 4.0 21 5.0 22 1.0 23 6.0 24 4.0 25 6.0 26 8.0 27 10.0 28 17.0 29 18.0 30 23.0 31 35.0 32 52.0 33 113.0 34 206.0 35 619.0 36 2657.0 37 201.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.574999999999996 26.325 7.025 22.075 2 29.349999999999998 25.775 29.375 15.5 3 19.825 28.575 33.975 17.625 4 24.9 33.35 22.625 19.125 5 25.55 37.425000000000004 20.575 16.45 6 21.025 38.65 21.25 19.075 7 20.825 22.2 38.550000000000004 18.425 8 20.225 26.3 29.2 24.275 9 20.974999999999998 25.324999999999996 30.475 23.225 10-14 23.419999999999998 29.875 25.765 20.94 15-19 23.575 28.24 27.515 20.669999999999998 20-24 24.04 28.43 27.54 19.99 25-29 23.064999999999998 28.455000000000002 27.16 21.32 30-34 23.205000000000002 28.610000000000003 27.275 20.91 35-39 23.625 28.115000000000002 27.48 20.78 40-44 23.080000000000002 27.884999999999998 27.87 21.165 45-49 23.25 29.175 26.745 20.830000000000002 50-54 23.02 27.955000000000002 27.85 21.175 55-59 23.200000000000003 27.755000000000003 27.725 21.32 60-64 23.155 27.625 27.62 21.6 65-69 23.07 27.750000000000004 27.650000000000002 21.529999999999998 70-74 23.555 28.405 27.189999999999998 20.849999999999998 75-79 24.005000000000003 27.76 27.27 20.965 80-84 22.919999999999998 28.065 27.57 21.445 85-89 23.044999999999998 27.150000000000002 27.98 21.825 90-94 23.155 28.249999999999996 27.615000000000002 20.979999999999997 95-99 23.14 28.335 27.515 21.01 100-104 23.655 28.24 26.87 21.235 105-109 24.005000000000003 28.189999999999998 27.450000000000003 20.355 110-114 23.565 28.265 27.315 20.855 115-119 23.935000000000002 28.625 26.265 21.175 120-124 23.845 28.04 27.595 20.52 125-129 23.465 27.74 28.134999999999998 20.66 130-134 24.88 27.334999999999997 27.089999999999996 20.695 135-139 24.099999999999998 27.91 27.26 20.73 140-144 23.695 27.439999999999998 27.465 21.4 145-149 25.040000000000003 27.88 26.93 20.150000000000002 150-151 25.3 27.750000000000004 27.037499999999998 19.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 2.5 24 3.5 25 4.5 26 5.0 27 4.5 28 5.0 29 9.0 30 12.5 31 15.0 32 25.5 33 35.0 34 48.0 35 68.5 36 79.5 37 106.0 38 139.5 39 150.0 40 190.5 41 238.0 42 250.0 43 272.5 44 268.5 45 252.5 46 265.5 47 258.5 48 232.0 49 202.0 50 172.0 51 146.5 52 129.5 53 96.5 54 66.0 55 55.5 56 43.0 57 39.0 58 28.0 59 14.0 60 11.0 61 11.0 62 8.5 63 6.0 64 4.0 65 2.5 66 2.5 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.5 73 1.0 74 0.5 75 0.5 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 1.0 92 0.5 93 0.0 94 0.0 95 1.0 96 1.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.75088773559136 83.975 2 7.402349084949468 13.55 3 0.6828735318219066 1.875 4 0.16388964763725758 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.3499999999999996 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.7875 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.3625 0.0 0.0 0.0 0.0 132-133 3.7249999999999996 0.0 0.0 0.0 0.0 134-135 3.9375 0.0 0.0 0.0 0.0 136-137 4.2 0.0 0.0 0.0 0.0 138-139 4.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCCATA 10 0.006830828 145.0 7 CCCATAA 10 0.006830828 145.0 8 >>END_MODULE Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818307 spots for SRR12917561.sra Written 818307 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra Read 818293 spots for SRR12917561.sra Written 818293 spots for SRR12917561.sra SRR ids: ['SRR12917561.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_deenw6q4 SRR12917561.sra spots: 16365874 blocks: [[1, 818293], [818294, 1636586], [1636587, 2454879], [2454880, 3273172], [3273173, 4091465], [4091466, 4909758], [4909759, 5728051], [5728052, 6546344], [6546345, 7364637], [7364638, 8182930], [8182931, 9001223], [9001224, 9819516], [9819517, 10637809], [10637810, 11456102], [11456103, 12274395], [12274396, 13092688], [13092689, 13910981], [13910982, 14729274], [14729275, 15547567], [15547568, 16365874]] SRR12917561 file size 5540139 SRR12917561 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917561 SRR12917561_1.fastq SRR12917561_2.fastq Input file: SRR12917561_1.fastq Paired file: SRR12917561_2.fastq trimmed: SRR12917561-trimmed-pair1.fastq, SRR12917561-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:40:34 2025 >> started Thu Feb 13 14:40:50 2025 >> done (16.793s) 16365874 read pairs processed; of these: 167 ( 0.00%) short read pairs filtered out after trimming by size control 5185 ( 0.03%) empty read pairs filtered out after trimming by size control 16360522 (99.97%) read pairs available; of these: 1253100 ( 7.66%) trimmed read pairs available after processing 15107422 (92.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 9 0.00% 21 17 0.00% 22 14 0.00% 23 26 0.00% 24 20 0.00% 25 23 0.00% 26 29 0.00% 27 12 0.00% 28 25 0.00% 29 29 0.00% 30 37 0.00% 31 28 0.00% 32 37 0.00% 33 28 0.00% 34 39 0.00% 35 37 0.00% 36 24 0.00% 37 39 0.00% 38 39 0.00% 39 38 0.00% 40 29 0.00% 41 41 0.00% 42 42 0.00% 43 36 0.00% 44 48 0.00% 45 48 0.00% 46 37 0.00% 47 45 0.00% 48 66 0.00% 49 76 0.00% 50 99 0.00% 51 92 0.00% 52 91 0.00% 53 100 0.00% 54 118 0.00% 55 141 0.00% 56 140 0.00% 57 187 0.00% 58 188 0.00% 59 215 0.00% 60 259 0.00% 61 268 0.00% 62 321 0.00% 63 348 0.00% 64 406 0.00% 65 456 0.00% 66 552 0.00% 67 557 0.00% 68 667 0.00% 69 685 0.00% 70 891 0.01% 71 985 0.01% 72 1150 0.01% 73 1267 0.01% 74 1448 0.01% 75 1541 0.01% 76 1653 0.01% 77 1780 0.01% 78 1998 0.01% 79 2142 0.01% 80 2375 0.01% 81 2571 0.02% 82 2995 0.02% 83 3162 0.02% 84 3532 0.02% 85 3756 0.02% 86 3942 0.02% 87 4123 0.03% 88 4512 0.03% 89 4727 0.03% 90 5171 0.03% 91 5239 0.03% 92 5654 0.03% 93 6163 0.04% 94 6569 0.04% 95 6982 0.04% 96 7422 0.05% 97 7820 0.05% 98 7888 0.05% 99 8369 0.05% 100 8520 0.05% 101 8970 0.05% 102 9277 0.06% 103 10113 0.06% 104 10403 0.06% 105 10835 0.07% 106 11617 0.07% 107 11928 0.07% 108 12077 0.07% 109 12759 0.08% 110 12657 0.08% 111 13146 0.08% 112 13807 0.08% 113 14459 0.09% 114 15056 0.09% 115 15669 0.10% 116 16275 0.10% 117 17208 0.11% 118 17678 0.11% 119 17958 0.11% 120 18388 0.11% 121 18928 0.12% 122 19363 0.12% 123 20397 0.12% 124 20605 0.13% 125 21082 0.13% 126 22226 0.14% 127 22627 0.14% 128 23570 0.14% 129 24462 0.15% 130 24702 0.15% 131 25206 0.15% 132 25788 0.16% 133 26349 0.16% 134 26813 0.16% 135 27968 0.17% 136 28510 0.17% 137 29100 0.18% 138 29947 0.18% 139 30872 0.19% 140 31153 0.19% 141 31732 0.19% 142 32402 0.20% 143 33118 0.20% 144 34022 0.21% 145 34542 0.21% 146 35453 0.22% 147 35705 0.22% 148 37167 0.23% 149 37199 0.23% 150 38550 0.24% 151 15107422 92.34% 16360522 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=18 prefix-density=0.52 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=21.33 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=5.3 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=27 prefix-density=0.66 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=75.02 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=3.7 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT SRR12917561 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:41:34 Started mapping on | Feb 13 14:41:34 Finished on | Feb 13 14:43:36 Mapping speed, Million of reads per hour | 482.77 Number of input reads | 16360522 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15151422 Uniquely mapped reads % | 92.61% Average mapped length | 296.64 Number of splices: Total | 15208858 Number of splices: Annotated (sjdb) | 14881234 Number of splices: GT/AG | 14914421 Number of splices: GC/AG | 235742 Number of splices: AT/AC | 10800 Number of splices: Non-canonical | 47895 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 466921 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 39988 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.14% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 742179 742179 742179 N_multimapping 466921 466921 466921 N_noFeature 370341 14982804 434361 N_ambiguous 244492 861 139633 UnstrandedReadsAssigned:14536589 PositiveStrandReadsAssigned:167757 NegativeStrandReadsAssigned:14577428 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917561 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917561-trimmed-pair1.fastq SRR12917561-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,360,522 reads, 14,611,703 reads pseudoaligned [quant] estimated average fragment length: 277.544 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,014 rounds 52401 SRR12917561.ke.tsv 34699 SRR12917561.se.tsv 87100 total ==> SRR12917561.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.46 909 35.0598 Potri.005G024800.1.v4.1 1035 758.456 669 59.2453 Potri.004G059700.1.v4.1 961 684.664 24 2.35446 Potri.007G009000.2.v4.1 1416 1139.46 0 0 Potri.003G141000.2.v4.1 2943 2666.46 1176.54 29.6368 Potri.016G087400.1.v4.1 270 79.2253 936.495 793.962 Potri.015G069301.1.v4.1 564 306.259 0 0 Potri.010G195200.1.v4.1 1773 1496.46 88 3.94982 Potri.012G127500.1.v4.1 977 700.533 437 41.8997 ==> SRR12917561.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 122 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 192 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12917561 completed mapping pipeline successfully