Starting /dee2/code/volunteer_pipeline.sh SRR12917562 current disk space = 3089517809664 free memory = 1582537268 SRR12917562 SRAfilesize 32e3bc66e2e0f7247998a3f59b77bfcc SRR12917562.sra SRR12917562.sra file validated SRR12917562 is paired end SRR12917562 is conventional basespace SRR12917562 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917562_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6125 37.0 37.0 37.0 37.0 37.0 2 36.365 37.0 37.0 37.0 37.0 37.0 3 36.6715 37.0 37.0 37.0 37.0 37.0 4 36.596 37.0 37.0 37.0 37.0 37.0 5 36.657 37.0 37.0 37.0 37.0 37.0 6 36.6455 37.0 37.0 37.0 37.0 37.0 7 36.596 37.0 37.0 37.0 37.0 37.0 8 36.606 37.0 37.0 37.0 37.0 37.0 9 36.6255 37.0 37.0 37.0 37.0 37.0 10-14 36.622 37.0 37.0 37.0 37.0 37.0 15-19 36.616 37.0 37.0 37.0 37.0 37.0 20-24 36.5346 37.0 37.0 37.0 37.0 37.0 25-29 36.5253 37.0 37.0 37.0 37.0 37.0 30-34 36.4604 37.0 37.0 37.0 37.0 37.0 35-39 36.4731 37.0 37.0 37.0 37.0 37.0 40-44 36.4819 37.0 37.0 37.0 37.0 37.0 45-49 36.4305 37.0 37.0 37.0 37.0 37.0 50-54 36.4028 37.0 37.0 37.0 37.0 37.0 55-59 36.3399 37.0 37.0 37.0 37.0 37.0 60-64 36.3476 37.0 37.0 37.0 37.0 37.0 65-69 36.259299999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.307100000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.28959999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.272 37.0 37.0 37.0 37.0 37.0 85-89 36.281200000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.2582 37.0 37.0 37.0 37.0 37.0 95-99 36.1553 37.0 37.0 37.0 37.0 37.0 100-104 36.1317 37.0 37.0 37.0 37.0 37.0 105-109 36.0363 37.0 37.0 37.0 37.0 37.0 110-114 36.071999999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0231 37.0 37.0 37.0 37.0 37.0 120-124 36.0071 37.0 37.0 37.0 37.0 37.0 125-129 35.9277 37.0 37.0 37.0 37.0 37.0 130-134 35.8164 37.0 37.0 37.0 37.0 37.0 135-139 35.794200000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.5766 37.0 37.0 37.0 37.0 37.0 145-149 35.5012 37.0 37.0 37.0 37.0 37.0 150-151 35.255250000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 0.0 25 2.0 26 5.0 27 4.0 28 12.0 29 17.0 30 24.0 31 34.0 32 49.0 33 72.0 34 142.0 35 355.0 36 2959.0 37 320.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.975 12.625 4.5 32.9 2 18.75 11.200000000000001 40.150000000000006 29.9 3 15.625 17.575 30.075000000000003 36.725 4 20.9 25.25 25.5 28.349999999999998 5 24.325 31.1 24.0 20.575 6 20.1 33.775 23.275000000000002 22.85 7 16.150000000000002 28.675 39.525 15.65 8 16.1 27.725 33.775 22.400000000000002 9 18.3 22.85 35.825 23.025000000000002 10-14 19.525000000000002 31.22 27.165 22.09 15-19 19.445 28.970000000000002 27.55 24.035 20-24 19.794999999999998 28.76 27.725 23.72 25-29 19.165 28.93 28.335 23.57 30-34 19.495 29.409999999999997 27.36 23.735 35-39 20.044999999999998 28.895 27.339999999999996 23.72 40-44 19.37 29.080000000000002 27.810000000000002 23.74 45-49 19.71 28.389999999999997 28.205000000000002 23.695 50-54 19.945 28.58 28.005000000000003 23.47 55-59 20.200000000000003 28.87 27.560000000000002 23.369999999999997 60-64 19.405 29.020000000000003 27.93 23.645 65-69 19.11 28.765 28.005000000000003 24.12 70-74 20.04 28.449999999999996 27.894999999999996 23.615 75-79 20.24 28.76 27.265 23.735 80-84 20.115 28.4 27.61 23.875 85-89 20.200000000000003 29.07 27.42 23.31 90-94 20.115 28.825 27.325 23.735 95-99 20.565 28.754999999999995 27.205000000000002 23.474999999999998 100-104 19.99 28.815 27.305 23.89 105-109 20.05 28.285 27.47 24.195 110-114 20.474999999999998 28.825 27.0 23.7 115-119 20.665 28.860000000000003 27.12 23.355 120-124 20.435 29.304999999999996 27.005000000000003 23.255 125-129 20.25 28.249999999999996 27.644999999999996 23.855 130-134 20.94 28.294999999999998 26.905 23.86 135-139 20.65 28.435 26.855 24.060000000000002 140-144 20.93 28.544999999999998 27.505000000000003 23.02 145-149 21.435000000000002 28.804999999999996 25.990000000000002 23.77 150-151 21.1125 27.950000000000003 26.3625 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 1.5 20 1.0 21 1.5 22 2.5 23 2.5 24 3.5 25 3.0 26 3.5 27 6.5 28 8.5 29 19.0 30 24.5 31 25.5 32 30.0 33 33.0 34 54.0 35 74.0 36 84.5 37 99.5 38 137.5 39 173.5 40 204.0 41 236.5 42 255.5 43 267.0 44 266.5 45 269.0 46 260.5 47 241.0 48 224.5 49 197.5 50 172.0 51 144.5 52 108.0 53 90.0 54 75.0 55 58.0 56 43.5 57 29.5 58 21.5 59 13.0 60 7.0 61 6.0 62 6.0 63 4.0 64 1.0 65 0.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.45 #Duplication Level Percentage of deduplicated Percentage of total 1 92.86100594916171 85.85000000000001 2 6.3547863710113575 11.75 3 0.6219578150351541 1.725 4 0.1081665765278529 0.4 5 0.027041644131963225 0.125 6 0.027041644131963225 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGATCCAGCATGACAAACAGCACCAAACCCTCTTCCCGATTCCTTCCTC 6 0.15 No Hit GCCATATTTACTGAATGACTCCCTGTCTTGACATATACAATAGAAGAACC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.1375 0.0 0.0 0.0 0.0 94-95 1.3875000000000002 0.0 0.0 0.0 0.0 96-97 1.6749999999999998 0.0 0.0 0.0 0.0 98-99 2.0375 0.0 0.0 0.0 0.0 100-101 2.25 0.0 0.0 0.0 0.0 102-103 2.5 0.0 0.0 0.0 0.0 104-105 2.8499999999999996 0.0 0.0 0.0 0.0 106-107 3.1624999999999996 0.0 0.0 0.0 0.0 108-109 3.75 0.0 0.0 0.0 0.0 110-111 4.125 0.0 0.0 0.0 0.0 112-113 4.5125 0.0 0.0 0.0 0.0 114-115 5.0 0.0 0.0 0.0 0.0 116-117 5.45 0.0 0.0 0.0 0.0 118-119 5.8875 0.0 0.0 0.0 0.0 120-121 6.3875 0.0 0.0 0.0 0.0 122-123 7.050000000000001 0.0 0.0 0.0 0.0 124-125 7.5625 0.0 0.0 0.0 0.0 126-127 8.0375 0.0 0.0 0.0 0.0 128-129 8.575 0.0 0.0 0.0 0.0 130-131 9.0875 0.0 0.0 0.0 0.0 132-133 9.662500000000001 0.0 0.0 0.0 0.0 134-135 10.4875 0.0 0.0 0.0 0.0 136-137 11.275 0.0 0.0 0.0 0.0 138-139 12.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTAA 10 0.006830828 145.0 5 TCTAAAA 10 0.006830828 145.0 7 TTCTAAA 10 0.006830828 145.0 6 >>END_MODULE SRR12917562 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917562_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.355 37.0 37.0 37.0 37.0 37.0 2 36.277 37.0 37.0 37.0 37.0 37.0 3 36.3165 37.0 37.0 37.0 37.0 37.0 4 36.2805 37.0 37.0 37.0 37.0 37.0 5 36.3945 37.0 37.0 37.0 37.0 37.0 6 36.3255 37.0 37.0 37.0 37.0 37.0 7 36.3805 37.0 37.0 37.0 37.0 37.0 8 36.4165 37.0 37.0 37.0 37.0 37.0 9 36.434 37.0 37.0 37.0 37.0 37.0 10-14 36.35530000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.2917 37.0 37.0 37.0 37.0 37.0 20-24 36.288 37.0 37.0 37.0 37.0 37.0 25-29 36.1973 37.0 37.0 37.0 37.0 37.0 30-34 36.1387 37.0 37.0 37.0 37.0 37.0 35-39 36.1259 37.0 37.0 37.0 37.0 37.0 40-44 36.1301 37.0 37.0 37.0 37.0 37.0 45-49 35.98870000000001 37.0 37.0 37.0 37.0 37.0 50-54 35.9715 37.0 37.0 37.0 37.0 37.0 55-59 35.9128 37.0 37.0 37.0 37.0 37.0 60-64 36.0168 37.0 37.0 37.0 37.0 37.0 65-69 35.9898 37.0 37.0 37.0 37.0 37.0 70-74 35.880399999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.8551 37.0 37.0 37.0 37.0 37.0 80-84 35.9211 37.0 37.0 37.0 37.0 37.0 85-89 35.937799999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.918099999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.9054 37.0 37.0 37.0 37.0 37.0 100-104 35.7975 37.0 37.0 37.0 37.0 37.0 105-109 35.766000000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.679700000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.706 37.0 37.0 37.0 37.0 37.0 120-124 35.5111 37.0 37.0 37.0 37.0 37.0 125-129 35.485299999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.397000000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.3045 37.0 37.0 37.0 32.2 37.0 140-144 35.0793 37.0 37.0 37.0 25.0 37.0 145-149 34.9413 37.0 37.0 37.0 25.0 37.0 150-151 34.464749999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 4.0 16 2.0 17 4.0 18 0.0 19 0.0 20 3.0 21 1.0 22 3.0 23 6.0 24 3.0 25 9.0 26 6.0 27 10.0 28 13.0 29 16.0 30 25.0 31 36.0 32 63.0 33 98.0 34 257.0 35 605.0 36 2628.0 37 206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.0 26.1 7.8 22.1 2 28.125 23.724999999999998 32.05 16.1 3 21.575 26.825 34.775 16.825000000000003 4 22.675 34.025 25.525 17.775 5 25.424999999999997 37.05 20.974999999999998 16.55 6 20.875 40.45 22.25 16.425 7 20.599999999999998 22.400000000000002 39.574999999999996 17.424999999999997 8 19.675 25.2 29.125 26.0 9 21.325 25.324999999999996 29.425 23.925 10-14 23.255 29.575000000000003 26.55 20.62 15-19 23.794999999999998 28.17 27.389999999999997 20.645 20-24 23.669999999999998 28.345 27.560000000000002 20.424999999999997 25-29 23.335 27.884999999999998 28.134999999999998 20.645 30-34 23.465 27.48 28.544999999999998 20.51 35-39 23.255 28.384999999999998 28.000000000000004 20.36 40-44 23.845 28.499999999999996 27.295 20.36 45-49 23.385 27.875 28.225 20.515 50-54 22.99 28.444999999999997 27.91 20.655 55-59 23.845 27.99 28.15 20.015 60-64 23.674999999999997 27.884999999999998 28.7 19.74 65-69 23.419999999999998 27.939999999999998 28.275 20.365 70-74 23.9 27.735 28.27 20.095 75-79 23.835 27.58 28.134999999999998 20.45 80-84 24.275 27.57 27.655 20.5 85-89 23.95 27.985 27.735 20.330000000000002 90-94 23.669999999999998 28.265 27.905 20.16 95-99 23.835 28.24 27.685 20.24 100-104 24.295 28.055000000000003 27.794999999999998 19.855 105-109 23.97 27.744999999999997 27.63 20.655 110-114 23.785 28.15 28.04 20.025000000000002 115-119 24.775 27.91 27.889999999999997 19.425 120-124 24.785 28.29 27.139999999999997 19.785 125-129 25.165 28.000000000000004 27.155 19.68 130-134 25.505 28.175 27.24 19.08 135-139 26.334999999999997 27.944999999999997 27.189999999999998 18.529999999999998 140-144 27.200000000000003 27.860000000000003 26.479999999999997 18.459999999999997 145-149 26.99 27.815 26.325 18.87 150-151 27.987499999999997 27.8125 26.224999999999998 17.974999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.5 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 2.0 23 2.5 24 3.5 25 2.5 26 6.0 27 8.5 28 10.0 29 14.5 30 16.5 31 19.0 32 23.5 33 37.5 34 50.0 35 64.5 36 81.5 37 110.0 38 145.0 39 170.0 40 208.5 41 243.0 42 267.5 43 270.5 44 251.0 45 270.0 46 278.5 47 252.0 48 231.0 49 199.5 50 159.5 51 131.0 52 111.0 53 84.0 54 62.5 55 49.5 56 39.0 57 31.0 58 20.5 59 11.5 60 10.5 61 7.0 62 5.5 63 4.5 64 3.0 65 4.0 66 2.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 1.0 79 1.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.5 94 1.5 95 1.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 92.83783783783784 85.875 2 6.486486486486487 12.0 3 0.5135135135135135 1.425 4 0.10810810810810811 0.4 5 0.0 0.0 6 0.05405405405405406 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAGAGAGAGAGAGAGTGAGAGAGAGAGATGAGTATGCTGATATCTA 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.1375 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.7000000000000002 0.0 0.0 0.0 0.0 98-99 2.0875000000000004 0.0 0.0 0.0 0.0 100-101 2.325 0.0 0.0 0.0 0.0 102-103 2.575 0.0 0.0 0.0 0.0 104-105 2.925 0.0 0.0 0.0 0.0 106-107 3.2375 0.0 0.0 0.0 0.0 108-109 3.8375 0.0 0.0 0.0 0.0 110-111 4.199999999999999 0.0 0.0 0.0 0.0 112-113 4.5875 0.0 0.0 0.0 0.0 114-115 5.074999999999999 0.0 0.0 0.0 0.0 116-117 5.525 0.0 0.0 0.0 0.0 118-119 5.949999999999999 0.0 0.0 0.0 0.0 120-121 6.4375 0.0 0.0 0.0 0.0 122-123 7.1 0.0 0.0 0.0 0.0 124-125 7.6375 0.0 0.0 0.0 0.0 126-127 8.087499999999999 0.0 0.0 0.0 0.0 128-129 8.625 0.0 0.0 0.0 0.0 130-131 9.1375 0.0 0.0 0.0 0.0 132-133 9.6875 0.0 0.0 0.0 0.0 134-135 10.5125 0.0 0.0 0.0 0.0 136-137 11.25 0.0 0.0 0.0 0.0 138-139 12.100000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAATA 10 0.006830828 145.0 4 >>END_MODULE Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495883 spots for SRR12917562.sra Written 495883 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra Read 495871 spots for SRR12917562.sra Written 495871 spots for SRR12917562.sra SRR ids: ['SRR12917562.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wcm9n1qn SRR12917562.sra spots: 9917432 blocks: [[1, 495871], [495872, 991742], [991743, 1487613], [1487614, 1983484], [1983485, 2479355], [2479356, 2975226], [2975227, 3471097], [3471098, 3966968], [3966969, 4462839], [4462840, 4958710], [4958711, 5454581], [5454582, 5950452], [5950453, 6446323], [6446324, 6942194], [6942195, 7438065], [7438066, 7933936], [7933937, 8429807], [8429808, 8925678], [8925679, 9421549], [9421550, 9917432]] SRR12917562 file size 3348838 SRR12917562 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917562 SRR12917562_1.fastq SRR12917562_2.fastq Input file: SRR12917562_1.fastq Paired file: SRR12917562_2.fastq trimmed: SRR12917562-trimmed-pair1.fastq, SRR12917562-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:39:15 2025 >> started Thu Feb 13 14:39:25 2025 >> done (10.416s) 9917432 read pairs processed; of these: 120 ( 0.00%) short read pairs filtered out after trimming by size control 2263 ( 0.02%) empty read pairs filtered out after trimming by size control 9915049 (99.98%) read pairs available; of these: 1707458 (17.22%) trimmed read pairs available after processing 8207591 (82.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 12 0.00% 20 21 0.00% 21 9 0.00% 22 14 0.00% 23 25 0.00% 24 25 0.00% 25 34 0.00% 26 36 0.00% 27 47 0.00% 28 30 0.00% 29 42 0.00% 30 25 0.00% 31 26 0.00% 32 45 0.00% 33 30 0.00% 34 42 0.00% 35 41 0.00% 36 45 0.00% 37 49 0.00% 38 43 0.00% 39 52 0.00% 40 47 0.00% 41 40 0.00% 42 55 0.00% 43 59 0.00% 44 49 0.00% 45 52 0.00% 46 62 0.00% 47 69 0.00% 48 73 0.00% 49 85 0.00% 50 91 0.00% 51 138 0.00% 52 161 0.00% 53 138 0.00% 54 181 0.00% 55 199 0.00% 56 176 0.00% 57 234 0.00% 58 273 0.00% 59 351 0.00% 60 359 0.00% 61 484 0.00% 62 487 0.00% 63 655 0.01% 64 675 0.01% 65 775 0.01% 66 827 0.01% 67 926 0.01% 68 1069 0.01% 69 1221 0.01% 70 1443 0.01% 71 1719 0.02% 72 1857 0.02% 73 2259 0.02% 74 2532 0.03% 75 2690 0.03% 76 3076 0.03% 77 3217 0.03% 78 3586 0.04% 79 3852 0.04% 80 4333 0.04% 81 4783 0.05% 82 5446 0.05% 83 5959 0.06% 84 6485 0.07% 85 7187 0.07% 86 7604 0.08% 87 7831 0.08% 88 8184 0.08% 89 8824 0.09% 90 9035 0.09% 91 9904 0.10% 92 10687 0.11% 93 11542 0.12% 94 12192 0.12% 95 12970 0.13% 96 13600 0.14% 97 13959 0.14% 98 14682 0.15% 99 15022 0.15% 100 15178 0.15% 101 16023 0.16% 102 16800 0.17% 103 17736 0.18% 104 18493 0.19% 105 19506 0.20% 106 20074 0.20% 107 20431 0.21% 108 20951 0.21% 109 21522 0.22% 110 21167 0.21% 111 21903 0.22% 112 22624 0.23% 113 23273 0.23% 114 24342 0.25% 115 25140 0.25% 116 25947 0.26% 117 26374 0.27% 118 26904 0.27% 119 26875 0.27% 120 27459 0.28% 121 28234 0.28% 122 28262 0.29% 123 28789 0.29% 124 30145 0.30% 125 30055 0.30% 126 30838 0.31% 127 31372 0.32% 128 31860 0.32% 129 31898 0.32% 130 32689 0.33% 131 32323 0.33% 132 33361 0.34% 133 33179 0.33% 134 33746 0.34% 135 34549 0.35% 136 34551 0.35% 137 35123 0.35% 138 35337 0.36% 139 35786 0.36% 140 36441 0.37% 141 36064 0.36% 142 36140 0.36% 143 36400 0.37% 144 37563 0.38% 145 37225 0.38% 146 37197 0.38% 147 37808 0.38% 148 37878 0.38% 149 37964 0.38% 150 38784 0.39% 151 8207591 82.78% 9915049 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=26 prefix-density=0.44 prefix-fanout=2.1 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCCAGAGTCTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACA criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=28.32 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=6.9 sequence=TTCTTGTCAAACGTCATGGAGAAGGAATGAGTAAAGCCTTGTGTAAGCATCTCTGGGCCTTCAGAATCCTGCCCCCATTCAAAGGACTTGACAAGATCAACCTCTGAAACCAGCTTCTCCATCCCCTTTACAATATCCTCGA criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=28 prefix-density=0.49 prefix-fanout=2.0 sequence=CATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=59.71 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.5 sequence=CTCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATGAGGGTGTTGATGACCAAGCTGCCAAGGTTGTTGACATCGTTGACACATTTAGGCTCCAGGAGCAACCTCCATTTGACAAGAA SRR12917562 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:40:10 Started mapping on | Feb 13 14:40:10 Finished on | Feb 13 14:41:17 Mapping speed, Million of reads per hour | 532.75 Number of input reads | 9915049 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 9207381 Uniquely mapped reads % | 92.86% Average mapped length | 290.90 Number of splices: Total | 8521534 Number of splices: Annotated (sjdb) | 8328520 Number of splices: GT/AG | 8362481 Number of splices: GC/AG | 124125 Number of splices: AT/AC | 9181 Number of splices: Non-canonical | 25747 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.99 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262312 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 30153 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.94% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 445356 445356 445356 N_multimapping 262312 262312 262312 N_noFeature 352126 9084605 415153 N_ambiguous 117152 582 57026 UnstrandedReadsAssigned:8738103 PositiveStrandReadsAssigned:122194 NegativeStrandReadsAssigned:8735202 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917562 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917562-trimmed-pair1.fastq SRR12917562-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,915,049 reads, 8,782,800 reads pseudoaligned [quant] estimated average fragment length: 240.067 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52401 SRR12917562.ke.tsv 34699 SRR12917562.se.tsv 87100 total ==> SRR12917562.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.93 281 18.7939 Potri.005G024800.1.v4.1 1035 795.933 89 13.304 Potri.004G059700.1.v4.1 961 722.042 13 2.14215 Potri.007G009000.2.v4.1 1416 1176.93 0 0 Potri.003G141000.2.v4.1 2943 2703.93 279.339 12.2915 Potri.016G087400.1.v4.1 270 97.5783 589 718.178 Potri.015G069301.1.v4.1 564 339.692 0 0 Potri.010G195200.1.v4.1 1773 1533.93 25 1.93912 Potri.012G127500.1.v4.1 977 738.012 3161 509.602 ==> SRR12917562.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 74 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 138 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 24 SRR12917562 completed mapping pipeline successfully