Starting /dee2/code/volunteer_pipeline.sh SRR12917563 current disk space = 3089463619584 free memory = 1582525648 SRR12917563 SRAfilesize 7151c902fd5f897d70f61873df12b27b SRR12917563.sra SRR12917563.sra file validated SRR12917563 is paired end SRR12917563 is conventional basespace SRR12917563 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917563_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.644 37.0 37.0 37.0 37.0 37.0 2 36.4195 37.0 37.0 37.0 37.0 37.0 3 36.6155 37.0 37.0 37.0 37.0 37.0 4 36.6995 37.0 37.0 37.0 37.0 37.0 5 36.6585 37.0 37.0 37.0 37.0 37.0 6 36.678 37.0 37.0 37.0 37.0 37.0 7 36.442 37.0 37.0 37.0 37.0 37.0 8 36.5415 37.0 37.0 37.0 37.0 37.0 9 36.6885 37.0 37.0 37.0 37.0 37.0 10-14 36.64639999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.625699999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5833 37.0 37.0 37.0 37.0 37.0 25-29 36.5545 37.0 37.0 37.0 37.0 37.0 30-34 36.505599999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.4736 37.0 37.0 37.0 37.0 37.0 40-44 36.511900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.4308 37.0 37.0 37.0 37.0 37.0 50-54 36.475 37.0 37.0 37.0 37.0 37.0 55-59 36.414300000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3543 37.0 37.0 37.0 37.0 37.0 65-69 36.2549 37.0 37.0 37.0 37.0 37.0 70-74 36.3528 37.0 37.0 37.0 37.0 37.0 75-79 36.3476 37.0 37.0 37.0 37.0 37.0 80-84 36.326 37.0 37.0 37.0 37.0 37.0 85-89 36.2795 37.0 37.0 37.0 37.0 37.0 90-94 36.277499999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.2242 37.0 37.0 37.0 37.0 37.0 100-104 36.182100000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1254 37.0 37.0 37.0 37.0 37.0 110-114 36.0763 37.0 37.0 37.0 37.0 37.0 115-119 36.096500000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.091499999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0289 37.0 37.0 37.0 37.0 37.0 130-134 35.935500000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.813700000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.6414 37.0 37.0 37.0 37.0 37.0 145-149 35.648900000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.34175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 4.0 25 1.0 26 5.0 27 2.0 28 14.0 29 16.0 30 25.0 31 31.0 32 34.0 33 72.0 34 102.0 35 335.0 36 3046.0 37 312.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.875 11.675 4.45 41.0 2 18.7 10.525 41.349999999999994 29.425 3 17.125 15.9 27.650000000000002 39.324999999999996 4 22.525000000000002 21.6 24.224999999999998 31.65 5 23.674999999999997 28.875 24.875 22.575 6 19.925 34.875 22.3 22.900000000000002 7 14.475 27.500000000000004 41.3 16.725 8 15.875 25.825 33.975 24.325 9 17.599999999999998 23.474999999999998 35.5 23.425 10-14 20.435 29.154999999999998 27.700000000000003 22.71 15-19 20.275000000000002 27.310000000000002 28.249999999999996 24.165 20-24 20.225 29.2 27.250000000000004 23.325000000000003 25-29 20.025000000000002 28.365000000000002 27.875 23.735 30-34 19.96 28.555000000000003 27.565 23.919999999999998 35-39 20.21 27.439999999999998 27.939999999999998 24.41 40-44 20.355 28.07 27.975 23.599999999999998 45-49 20.53 28.09 27.485 23.895 50-54 20.26 28.49 27.68 23.57 55-59 19.975 28.110000000000003 27.935 23.98 60-64 20.474999999999998 28.62 27.279999999999998 23.625 65-69 20.365 28.15 28.360000000000003 23.125 70-74 20.52 28.605000000000004 27.189999999999998 23.685000000000002 75-79 20.815 28.285 27.279999999999998 23.62 80-84 21.154999999999998 28.18 27.705000000000002 22.96 85-89 20.45 28.42 27.195000000000004 23.935000000000002 90-94 20.96 27.534999999999997 27.63 23.875 95-99 20.965 28.139999999999997 27.49 23.405 100-104 20.345 28.88 27.095000000000002 23.68 105-109 20.7 27.965 28.225 23.11 110-114 20.31 28.375 27.525 23.79 115-119 21.245 28.17 27.43 23.155 120-124 21.035 28.294999999999998 27.165 23.505000000000003 125-129 21.759999999999998 27.575 26.905 23.76 130-134 21.465 28.095 26.96 23.48 135-139 21.535 28.01 27.015 23.44 140-144 21.5 27.805000000000003 26.3 24.395 145-149 21.59 27.43 26.775 24.205 150-151 21.275 27.6625 26.5875 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.5 24 2.0 25 2.0 26 2.5 27 6.5 28 11.5 29 16.0 30 15.5 31 16.0 32 30.0 33 44.5 34 48.5 35 60.0 36 88.5 37 117.0 38 131.0 39 151.0 40 181.0 41 207.5 42 209.0 43 227.0 44 250.5 45 262.5 46 265.5 47 250.0 48 234.5 49 217.5 50 192.0 51 159.0 52 133.5 53 100.0 54 89.5 55 72.5 56 52.0 57 43.5 58 30.5 59 26.0 60 18.0 61 10.0 62 5.5 63 3.5 64 3.5 65 3.5 66 1.5 67 0.0 68 0.5 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.875 #Duplication Level Percentage of deduplicated Percentage of total 1 90.12517385257301 81.0 2 8.650904033379694 15.55 3 1.0848400556328233 2.9250000000000003 4 0.11126564673157163 0.4 5 0.027816411682892908 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGTAGAGAGAGGGGGTAGAAACATAAACGAGGGTGATTATAGGGTCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.8375 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.125 0.0 0.0 0.0 0.0 94-95 1.325 0.0 0.0 0.0 0.0 96-97 1.6 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.15 0.0 0.0 0.0 0.0 102-103 2.4875 0.0 0.0 0.0 0.0 104-105 2.7 0.0 0.0 0.0 0.0 106-107 3.0250000000000004 0.0 0.0 0.0 0.0 108-109 3.3499999999999996 0.0 0.0 0.0 0.0 110-111 3.6875 0.0 0.0 0.0 0.0 112-113 3.9625000000000004 0.0 0.0 0.0 0.0 114-115 4.5875 0.0 0.0 0.0 0.0 116-117 5.050000000000001 0.0 0.0 0.0 0.0 118-119 5.5 0.0 0.0 0.0 0.0 120-121 5.875 0.0 0.0 0.0 0.0 122-123 6.4 0.0 0.0 0.0 0.0 124-125 6.8875 0.0 0.0 0.0 0.0 126-127 7.4625 0.0 0.0 0.0 0.0 128-129 8.2125 0.0 0.0 0.0 0.0 130-131 8.75 0.0 0.0 0.0 0.0 132-133 9.325 0.0 0.0 0.0 0.0 134-135 9.925 0.0 0.0 0.0 0.0 136-137 10.525 0.0 0.0 0.0 0.0 138-139 11.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCTTT 10 0.006830828 145.0 4 TCTCTTT 10 0.006830828 145.0 7 AGCAAAA 10 0.006830828 145.0 2 GTTAAAA 10 0.006830828 145.0 1 >>END_MODULE SRR12917563 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917563_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4625 37.0 37.0 37.0 37.0 37.0 2 36.297 37.0 37.0 37.0 37.0 37.0 3 36.3755 37.0 37.0 37.0 37.0 37.0 4 36.506 37.0 37.0 37.0 37.0 37.0 5 36.482 37.0 37.0 37.0 37.0 37.0 6 36.341 37.0 37.0 37.0 37.0 37.0 7 36.4115 37.0 37.0 37.0 37.0 37.0 8 36.4675 37.0 37.0 37.0 37.0 37.0 9 36.461 37.0 37.0 37.0 37.0 37.0 10-14 36.45700000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.4089 37.0 37.0 37.0 37.0 37.0 20-24 36.3586 37.0 37.0 37.0 37.0 37.0 25-29 36.2895 37.0 37.0 37.0 37.0 37.0 30-34 36.2774 37.0 37.0 37.0 37.0 37.0 35-39 36.2008 37.0 37.0 37.0 37.0 37.0 40-44 36.2519 37.0 37.0 37.0 37.0 37.0 45-49 36.1593 37.0 37.0 37.0 37.0 37.0 50-54 36.1101 37.0 37.0 37.0 37.0 37.0 55-59 36.14 37.0 37.0 37.0 37.0 37.0 60-64 36.1005 37.0 37.0 37.0 37.0 37.0 65-69 36.1569 37.0 37.0 37.0 37.0 37.0 70-74 36.1082 37.0 37.0 37.0 37.0 37.0 75-79 36.0212 37.0 37.0 37.0 37.0 37.0 80-84 36.0274 37.0 37.0 37.0 37.0 37.0 85-89 36.0489 37.0 37.0 37.0 37.0 37.0 90-94 35.994800000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.9879 37.0 37.0 37.0 37.0 37.0 100-104 35.9394 37.0 37.0 37.0 37.0 37.0 105-109 35.9336 37.0 37.0 37.0 37.0 37.0 110-114 35.8661 37.0 37.0 37.0 37.0 37.0 115-119 35.8262 37.0 37.0 37.0 37.0 37.0 120-124 35.7166 37.0 37.0 37.0 37.0 37.0 125-129 35.6084 37.0 37.0 37.0 37.0 37.0 130-134 35.563199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.4989 37.0 37.0 37.0 37.0 37.0 140-144 35.3789 37.0 37.0 37.0 34.6 37.0 145-149 35.1956 37.0 37.0 37.0 29.8 37.0 150-151 34.732749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 3.0 15 1.0 16 2.0 17 0.0 18 0.0 19 1.0 20 0.0 21 1.0 22 5.0 23 2.0 24 2.0 25 3.0 26 8.0 27 11.0 28 11.0 29 10.0 30 17.0 31 32.0 32 60.0 33 75.0 34 178.0 35 623.0 36 2731.0 37 222.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.6 26.5 8.7 28.199999999999996 2 25.15 26.724999999999998 32.5 15.625 3 19.900000000000002 25.900000000000002 35.5 18.7 4 22.725 33.525 24.05 19.7 5 26.875 36.825 21.0 15.299999999999999 6 18.9 42.525 20.95 17.625 7 20.3 23.400000000000002 37.175000000000004 19.125 8 19.225 25.174999999999997 31.7 23.9 9 20.724999999999998 24.7 29.5 25.074999999999996 10-14 22.689999999999998 29.95 26.05 21.310000000000002 15-19 22.919999999999998 28.515 27.46 21.105 20-24 22.884999999999998 29.15 26.924999999999997 21.04 25-29 22.275 27.93 28.27 21.525 30-34 22.695 28.349999999999998 27.6 21.355 35-39 22.915 27.250000000000004 27.785 22.05 40-44 22.33 28.78 27.700000000000003 21.19 45-49 22.665 27.834999999999997 27.500000000000004 22.0 50-54 22.43 28.685 27.68 21.205 55-59 22.939999999999998 28.305000000000003 27.655 21.099999999999998 60-64 22.634999999999998 28.294999999999998 27.855 21.215 65-69 23.325000000000003 27.439999999999998 28.255000000000003 20.979999999999997 70-74 22.994999999999997 27.33 27.805000000000003 21.87 75-79 23.32 27.515 27.625 21.54 80-84 23.13 27.939999999999998 27.16 21.77 85-89 23.28 27.915 27.134999999999998 21.67 90-94 23.7 28.060000000000002 27.155 21.085 95-99 23.52 27.755000000000003 27.450000000000003 21.275 100-104 23.375 28.055000000000003 27.26 21.310000000000002 105-109 23.810000000000002 28.144999999999996 27.665 20.380000000000003 110-114 24.345 28.345 26.974999999999998 20.335 115-119 24.48 27.555000000000003 27.089999999999996 20.875 120-124 24.725 28.65 26.435 20.19 125-129 24.725 28.74 26.505000000000003 20.03 130-134 25.21 26.955000000000002 27.005000000000003 20.830000000000002 135-139 25.929999999999996 27.834999999999997 26.395000000000003 19.84 140-144 26.77 27.500000000000004 25.705 20.025000000000002 145-149 27.700000000000003 26.484999999999996 26.400000000000002 19.415 150-151 28.037499999999998 27.3625 25.324999999999996 19.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.0 23 1.5 24 3.5 25 4.0 26 5.0 27 5.0 28 8.5 29 10.5 30 11.5 31 21.5 32 22.5 33 28.5 34 47.5 35 65.0 36 83.0 37 118.5 38 154.0 39 174.0 40 195.0 41 226.0 42 249.0 43 253.5 44 266.0 45 271.5 46 270.0 47 242.0 48 211.5 49 198.0 50 167.5 51 147.0 52 116.5 53 85.0 54 78.0 55 62.5 56 49.0 57 36.0 58 21.5 59 19.5 60 19.0 61 14.5 62 8.0 63 4.0 64 3.5 65 2.5 66 0.5 67 0.5 68 1.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.525 #Duplication Level Percentage of deduplicated Percentage of total 1 90.22619380061435 80.77499999999999 2 8.349623010332309 14.95 3 1.0890812622172577 2.9250000000000003 4 0.2234012845573862 0.8 5 0.05585032113934655 0.25 6 0.05585032113934655 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 5 0.125 No Hit GGGCTCTCATCAGTGATCTTTTTATTTCTTTCTTTACCTAGTTATAAATG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.3 0.0 0.0 0.0 0.0 96-97 1.575 0.0 0.0 0.0 0.0 98-99 1.7875 0.0 0.0 0.0 0.0 100-101 2.1 0.0 0.0 0.0 0.0 102-103 2.4375 0.0 0.0 0.0 0.0 104-105 2.6500000000000004 0.0 0.0 0.0 0.0 106-107 2.9749999999999996 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 3.6375 0.0 0.0 0.0 0.0 112-113 3.9125 0.0 0.0 0.0 0.0 114-115 4.5375 0.0 0.0 0.0 0.0 116-117 5.0 0.0 0.0 0.0 0.0 118-119 5.449999999999999 0.0 0.0 0.0 0.0 120-121 5.825 0.0 0.0 0.0 0.0 122-123 6.35 0.0 0.0 0.0 0.0 124-125 6.8375 0.0 0.0 0.0 0.0 126-127 7.4125 0.0 0.0 0.0 0.0 128-129 8.1625 0.0 0.0 0.0 0.0 130-131 8.7 0.0 0.0 0.0 0.0 132-133 9.25 0.0 0.0 0.0 0.0 134-135 9.8625 0.0 0.0 0.0 0.0 136-137 10.5 0.0 0.0 0.0 0.0 138-139 11.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAGGC 10 0.006830828 145.0 1 GGCTATG 10 0.006830828 145.0 9 TTGGCTA 10 0.006830828 145.0 7 TGGCTAT 10 0.006830828 145.0 8 >>END_MODULE Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669525 spots for SRR12917563.sra Written 669525 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra Read 669514 spots for SRR12917563.sra Written 669514 spots for SRR12917563.sra SRR ids: ['SRR12917563.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h7_n2xsl SRR12917563.sra spots: 13390291 blocks: [[1, 669514], [669515, 1339028], [1339029, 2008542], [2008543, 2678056], [2678057, 3347570], [3347571, 4017084], [4017085, 4686598], [4686599, 5356112], [5356113, 6025626], [6025627, 6695140], [6695141, 7364654], [7364655, 8034168], [8034169, 8703682], [8703683, 9373196], [9373197, 10042710], [10042711, 10712224], [10712225, 11381738], [11381739, 12051252], [12051253, 12720766], [12720767, 13390291]] SRR12917563 file size 4528906 SRR12917563 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917563 SRR12917563_1.fastq SRR12917563_2.fastq Input file: SRR12917563_1.fastq Paired file: SRR12917563_2.fastq trimmed: SRR12917563-trimmed-pair1.fastq, SRR12917563-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:41:22 2025 >> started Thu Feb 13 14:41:36 2025 >> done (14.132s) 13390291 read pairs processed; of these: 162 ( 0.00%) short read pairs filtered out after trimming by size control 1113 ( 0.01%) empty read pairs filtered out after trimming by size control 13389016 (99.99%) read pairs available; of these: 2043563 (15.26%) trimmed read pairs available after processing 11345453 (84.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 20 0.00% 20 4 0.00% 21 16 0.00% 22 10 0.00% 23 11 0.00% 24 8 0.00% 25 16 0.00% 26 11 0.00% 27 15 0.00% 28 10 0.00% 29 17 0.00% 30 16 0.00% 31 18 0.00% 32 25 0.00% 33 29 0.00% 34 17 0.00% 35 30 0.00% 36 26 0.00% 37 23 0.00% 38 20 0.00% 39 18 0.00% 40 25 0.00% 41 31 0.00% 42 35 0.00% 43 26 0.00% 44 31 0.00% 45 41 0.00% 46 43 0.00% 47 41 0.00% 48 52 0.00% 49 74 0.00% 50 85 0.00% 51 107 0.00% 52 85 0.00% 53 128 0.00% 54 117 0.00% 55 136 0.00% 56 148 0.00% 57 165 0.00% 58 196 0.00% 59 259 0.00% 60 299 0.00% 61 327 0.00% 62 378 0.00% 63 444 0.00% 64 513 0.00% 65 565 0.00% 66 665 0.00% 67 748 0.01% 68 804 0.01% 69 975 0.01% 70 1137 0.01% 71 1223 0.01% 72 1441 0.01% 73 1729 0.01% 74 1993 0.01% 75 2266 0.02% 76 2517 0.02% 77 2586 0.02% 78 3032 0.02% 79 3311 0.02% 80 3548 0.03% 81 4056 0.03% 82 4777 0.04% 83 5124 0.04% 84 5713 0.04% 85 6339 0.05% 86 6830 0.05% 87 7517 0.06% 88 7873 0.06% 89 8715 0.07% 90 8857 0.07% 91 9746 0.07% 92 10609 0.08% 93 11346 0.08% 94 12193 0.09% 95 13296 0.10% 96 13745 0.10% 97 15017 0.11% 98 15386 0.11% 99 15881 0.12% 100 16725 0.12% 101 17078 0.13% 102 18013 0.13% 103 18916 0.14% 104 19868 0.15% 105 21044 0.16% 106 21873 0.16% 107 22915 0.17% 108 23813 0.18% 109 24259 0.18% 110 24616 0.18% 111 25421 0.19% 112 25751 0.19% 113 26328 0.20% 114 27456 0.21% 115 28828 0.22% 116 29825 0.22% 117 31025 0.23% 118 31818 0.24% 119 32480 0.24% 120 33655 0.25% 121 33887 0.25% 122 34531 0.26% 123 34719 0.26% 124 36054 0.27% 125 36021 0.27% 126 37787 0.28% 127 38906 0.29% 128 39344 0.29% 129 40356 0.30% 130 41369 0.31% 131 41065 0.31% 132 41558 0.31% 133 42278 0.32% 134 42122 0.31% 135 42973 0.32% 136 44213 0.33% 137 44447 0.33% 138 45567 0.34% 139 47075 0.35% 140 47066 0.35% 141 47573 0.36% 142 47728 0.36% 143 47955 0.36% 144 48816 0.36% 145 49608 0.37% 146 49034 0.37% 147 49955 0.37% 148 50672 0.38% 149 51115 0.38% 150 52341 0.39% 151 11345453 84.74% 13389016 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=0.70 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=12.56 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=3.3 sequence=GAGCTTCACCGTGTATGCTGCCATTGCT criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=29 prefix-density=0.95 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=84.85 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=2.7 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12917563 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:42:16 Started mapping on | Feb 13 14:42:16 Finished on | Feb 13 14:43:54 Mapping speed, Million of reads per hour | 491.84 Number of input reads | 13389016 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12705649 Uniquely mapped reads % | 94.90% Average mapped length | 292.81 Number of splices: Total | 12482879 Number of splices: Annotated (sjdb) | 12222007 Number of splices: GT/AG | 12214205 Number of splices: GC/AG | 219611 Number of splices: AT/AC | 8221 Number of splices: Non-canonical | 40842 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305032 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 43915 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.33% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 378335 378335 378335 N_multimapping 305032 305032 305032 N_noFeature 445693 12548918 500174 N_ambiguous 175918 631 73318 UnstrandedReadsAssigned:12084038 PositiveStrandReadsAssigned:156100 NegativeStrandReadsAssigned:12132157 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917563 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917563-trimmed-pair1.fastq SRR12917563-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,389,016 reads, 12,131,590 reads pseudoaligned [quant] estimated average fragment length: 244.976 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR12917563.ke.tsv 34699 SRR12917563.se.tsv 87100 total ==> SRR12917563.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.02 276 12.3465 Potri.005G024800.1.v4.1 1035 791.024 186 18.6603 Potri.004G059700.1.v4.1 961 717.212 15 1.65974 Potri.007G009000.2.v4.1 1416 1172.02 0 0 Potri.003G141000.2.v4.1 2943 2699.02 572.426 16.8309 Potri.016G087400.1.v4.1 270 92.9582 586 500.271 Potri.015G069301.1.v4.1 564 334.512 0 0 Potri.010G195200.1.v4.1 1773 1529.02 13 0.674722 Potri.012G127500.1.v4.1 977 733.141 719 77.8282 ==> SRR12917563.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 259 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 103 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR12917563 completed mapping pipeline successfully