Starting /dee2/code/volunteer_pipeline.sh SRR12917564 current disk space = 3090101612544 free memory = 1445206844 SRR12917564 SRAfilesize aea211b42cd6f390a53a78e8dd8d381f SRR12917564.sra SRR12917564.sra file validated SRR12917564 is paired end SRR12917564 is conventional basespace SRR12917564 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917564_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6025 37.0 37.0 37.0 37.0 37.0 2 36.4845 37.0 37.0 37.0 37.0 37.0 3 36.57 37.0 37.0 37.0 37.0 37.0 4 36.6485 37.0 37.0 37.0 37.0 37.0 5 36.699 37.0 37.0 37.0 37.0 37.0 6 36.631 37.0 37.0 37.0 37.0 37.0 7 36.5545 37.0 37.0 37.0 37.0 37.0 8 36.551 37.0 37.0 37.0 37.0 37.0 9 36.6325 37.0 37.0 37.0 37.0 37.0 10-14 36.6017 37.0 37.0 37.0 37.0 37.0 15-19 36.5894 37.0 37.0 37.0 37.0 37.0 20-24 36.605599999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.5649 37.0 37.0 37.0 37.0 37.0 30-34 36.49640000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.49400000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.5064 37.0 37.0 37.0 37.0 37.0 45-49 36.4568 37.0 37.0 37.0 37.0 37.0 50-54 36.4048 37.0 37.0 37.0 37.0 37.0 55-59 36.408500000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.357899999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.2986 37.0 37.0 37.0 37.0 37.0 70-74 36.29430000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.3196 37.0 37.0 37.0 37.0 37.0 80-84 36.3301 37.0 37.0 37.0 37.0 37.0 85-89 36.257600000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.249700000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.15559999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.116099999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.0904 37.0 37.0 37.0 37.0 37.0 110-114 36.06419999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.022000000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.0245 37.0 37.0 37.0 37.0 37.0 125-129 35.916199999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.84589999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.85 37.0 37.0 37.0 37.0 37.0 140-144 35.6271 37.0 37.0 37.0 37.0 37.0 145-149 35.5756 37.0 37.0 37.0 37.0 37.0 150-151 35.27675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 0.0 26 7.0 27 5.0 28 16.0 29 18.0 30 17.0 31 32.0 32 45.0 33 82.0 34 100.0 35 388.0 36 2993.0 37 295.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.890890890890894 13.438438438438439 4.97997997997998 40.69069069069069 2 16.55 9.725 43.425000000000004 30.3 3 15.725 17.25 30.049999999999997 36.975 4 21.224999999999998 20.200000000000003 26.525 32.05 5 23.05 31.374999999999996 25.25 20.325 6 20.175 34.775 22.45 22.6 7 14.7 29.099999999999998 40.575 15.625 8 16.175 24.975 34.599999999999994 24.25 9 15.9 21.675 37.775 24.65 10-14 19.81 29.95 28.044999999999998 22.195 15-19 19.105 27.905 27.975 25.014999999999997 20-24 19.075 28.199999999999996 28.415000000000003 24.310000000000002 25-29 19.235 28.59 28.76 23.415 30-34 19.055 29.049999999999997 27.97 23.925 35-39 19.634999999999998 28.849999999999998 27.37 24.145 40-44 19.43 29.085 27.775 23.71 45-49 19.56 29.060000000000002 26.669999999999998 24.709999999999997 50-54 19.794999999999998 28.084999999999997 28.13 23.990000000000002 55-59 19.6 28.749999999999996 28.08 23.57 60-64 19.59 28.405 27.500000000000004 24.505 65-69 19.445 28.095 28.055000000000003 24.404999999999998 70-74 19.675 28.28 28.01 24.035 75-79 19.994999999999997 29.235 27.389999999999997 23.380000000000003 80-84 19.439999999999998 27.415 28.444999999999997 24.7 85-89 20.27 28.694999999999997 27.465 23.57 90-94 19.52 28.84 27.63 24.01 95-99 19.925 28.4 27.439999999999998 24.235 100-104 19.96 28.585 27.68 23.775 105-109 19.89 27.91 28.32 23.880000000000003 110-114 20.105 28.360000000000003 27.435 24.099999999999998 115-119 20.580000000000002 28.349999999999998 26.915 24.154999999999998 120-124 20.555 29.01 26.505000000000003 23.93 125-129 20.505000000000003 28.12 27.265 24.11 130-134 19.755 28.965000000000003 26.834999999999997 24.445 135-139 20.03 28.17 27.235 24.565 140-144 20.880000000000003 28.705000000000002 26.169999999999998 24.245 145-149 20.87 28.65 26.490000000000002 23.990000000000002 150-151 21.1625 28.212500000000002 27.5125 23.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 2.0 21 3.0 22 2.0 23 2.0 24 2.5 25 4.0 26 3.0 27 2.0 28 7.5 29 15.0 30 23.5 31 28.5 32 30.5 33 36.0 34 42.5 35 65.0 36 104.0 37 117.0 38 133.5 39 159.0 40 189.0 41 229.5 42 245.5 43 255.5 44 263.0 45 267.5 46 262.0 47 257.0 48 260.5 49 223.5 50 165.0 51 139.5 52 119.5 53 91.5 54 70.5 55 45.0 56 32.5 57 32.0 58 21.0 59 13.5 60 9.0 61 4.0 62 3.5 63 2.5 64 1.0 65 1.5 66 1.5 67 1.0 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 88.94601542416453 77.85 2 8.883176235361326 15.55 3 1.7137960582690661 4.5 4 0.2570694087403599 0.8999999999999999 5 0.057126535275635534 0.25 6 0.08568980291345331 0.44999999999999996 7 0.0 0.0 8 0.028563267637817767 0.2 9 0.0 0.0 >10 0.028563267637817767 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATATTTACTGAATGACTCCCTGTCTTGACATATACAATAGAAGAACC 12 0.3 No Hit GTGCGATTTTGCAGTTGCTTCTCTCGATTTCAGCAATGGGGTCTATCAAA 8 0.2 No Hit GTTTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGA 6 0.15 No Hit CTCCGATCCGAATTTCTTCCAGTTCCAAACTCCTGTGAAGGCAACAGCCT 6 0.15 No Hit GTCTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGA 6 0.15 No Hit CGTTAAGGAAGTCTCCGTAAGCTTTATTTCGAACGTAAAAATCAGAAGTA 5 0.125 No Hit GTCCCGCTATGGAACCTTCTGCCCGCAATGTCAACAGAAGAGTCTTCACT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.925 0.0 0.0 0.0 0.0 106-107 2.275 0.0 0.0 0.0 0.0 108-109 2.6500000000000004 0.0 0.0 0.0 0.0 110-111 2.9375 0.0 0.0 0.0 0.0 112-113 3.125 0.0 0.0 0.0 0.0 114-115 3.3125 0.0 0.0 0.0 0.0 116-117 3.6625 0.0 0.0 0.0 0.0 118-119 4.1 0.0 0.0 0.0 0.0 120-121 4.6375 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.6125 0.0 0.0 0.0 0.0 126-127 6.012499999999999 0.0 0.0 0.0 0.0 128-129 6.4375 0.0 0.0 0.0 0.0 130-131 7.025 0.0 0.0 0.0 0.0 132-133 7.675 0.0 0.0 0.0 0.0 134-135 8.1375 0.0 0.0 0.0 0.0 136-137 8.7375 0.0 0.0 0.0 0.0 138-139 9.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTGTC 10 0.006830828 145.0 7 >>END_MODULE SRR12917564 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917564_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36425 37.0 37.0 37.0 37.0 37.0 2 36.2745 37.0 37.0 37.0 37.0 37.0 3 36.2515 37.0 37.0 37.0 37.0 37.0 4 36.309 37.0 37.0 37.0 37.0 37.0 5 36.412 37.0 37.0 37.0 37.0 37.0 6 36.222 37.0 37.0 37.0 37.0 37.0 7 36.3245 37.0 37.0 37.0 37.0 37.0 8 36.3965 37.0 37.0 37.0 37.0 37.0 9 36.335 37.0 37.0 37.0 37.0 37.0 10-14 36.384899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.336 37.0 37.0 37.0 37.0 37.0 20-24 36.2418 37.0 37.0 37.0 37.0 37.0 25-29 36.2147 37.0 37.0 37.0 37.0 37.0 30-34 36.1654 37.0 37.0 37.0 37.0 37.0 35-39 36.0918 37.0 37.0 37.0 37.0 37.0 40-44 36.113800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.052800000000005 37.0 37.0 37.0 37.0 37.0 50-54 35.9987 37.0 37.0 37.0 37.0 37.0 55-59 36.0149 37.0 37.0 37.0 37.0 37.0 60-64 36.032799999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.9491 37.0 37.0 37.0 37.0 37.0 70-74 35.8996 37.0 37.0 37.0 37.0 37.0 75-79 35.8465 37.0 37.0 37.0 37.0 37.0 80-84 35.93390000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.8919 37.0 37.0 37.0 37.0 37.0 90-94 35.87949999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.869299999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.8348 37.0 37.0 37.0 37.0 37.0 105-109 35.702 37.0 37.0 37.0 37.0 37.0 110-114 35.6622 37.0 37.0 37.0 37.0 37.0 115-119 35.6471 37.0 37.0 37.0 37.0 37.0 120-124 35.53320000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.511900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.383 37.0 37.0 37.0 34.6 37.0 135-139 35.3369 37.0 37.0 37.0 34.6 37.0 140-144 35.0603 37.0 37.0 37.0 25.0 37.0 145-149 34.9404 37.0 37.0 37.0 25.0 37.0 150-151 34.50625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 5.0 16 5.0 17 4.0 18 2.0 19 3.0 20 7.0 21 5.0 22 1.0 23 6.0 24 3.0 25 5.0 26 7.0 27 8.0 28 8.0 29 18.0 30 20.0 31 52.0 32 54.0 33 95.0 34 201.0 35 561.0 36 2746.0 37 182.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.11052763190798 25.6064016004001 8.002000500125032 24.281070267566893 2 27.075 23.275000000000002 34.0 15.65 3 19.900000000000002 27.85 34.599999999999994 17.65 4 24.474999999999998 34.775 22.7 18.05 5 26.275 37.775 19.575 16.375 6 20.65 40.525 22.15 16.675 7 21.3 22.825 37.824999999999996 18.05 8 19.175 24.725 32.35 23.75 9 21.925 23.75 32.300000000000004 22.025 10-14 23.56 28.935 27.415 20.09 15-19 23.294999999999998 28.625 27.595 20.485 20-24 23.87 28.18 28.165000000000003 19.785 25-29 23.215 28.38 28.205000000000002 20.200000000000003 30-34 22.965 28.04 28.275 20.72 35-39 22.96 28.355000000000004 28.15 20.535 40-44 23.52 28.015 28.63 19.835 45-49 23.995 26.900000000000002 28.804999999999996 20.3 50-54 22.955000000000002 28.895 27.79 20.36 55-59 23.990000000000002 27.57 28.084999999999997 20.355 60-64 23.919999999999998 27.37 28.384999999999998 20.325 65-69 24.245 28.025 27.834999999999997 19.895 70-74 24.12 27.900000000000002 28.185 19.794999999999998 75-79 24.099999999999998 27.99 28.17 19.74 80-84 24.2 27.18 27.655 20.965 85-89 23.880000000000003 27.644999999999996 28.050000000000004 20.424999999999997 90-94 23.810000000000002 28.185 28.125 19.88 95-99 23.465 28.205000000000002 28.000000000000004 20.330000000000002 100-104 23.974999999999998 28.79 27.169999999999998 20.064999999999998 105-109 23.9 28.175 27.325 20.599999999999998 110-114 24.41 28.605000000000004 26.900000000000002 20.085 115-119 24.404999999999998 28.494999999999997 27.495000000000005 19.605 120-124 24.505 28.470000000000002 27.779999999999998 19.245 125-129 25.055 28.63 26.76 19.555 130-134 25.53 28.435 27.005000000000003 19.03 135-139 25.69 27.47 27.82 19.02 140-144 25.919999999999998 28.244999999999997 26.419999999999998 19.415 145-149 26.950000000000003 27.93 26.6 18.52 150-151 27.0625 28.262500000000003 26.0125 18.6625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 1.5 16 1.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 1.0 23 2.5 24 3.0 25 4.0 26 4.0 27 5.5 28 11.0 29 16.5 30 16.5 31 18.0 32 27.0 33 37.5 34 44.5 35 61.5 36 87.5 37 112.0 38 139.0 39 170.5 40 217.5 41 264.5 42 286.0 43 270.5 44 256.0 45 259.0 46 265.5 47 247.5 48 223.5 49 209.5 50 174.5 51 133.5 52 100.5 53 79.5 54 61.0 55 38.5 56 24.5 57 22.5 58 19.0 59 13.5 60 11.5 61 9.5 62 7.0 63 4.5 64 1.0 65 2.5 66 3.0 67 1.5 68 1.5 69 1.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.5 86 1.0 87 1.0 88 0.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 1.0 99 1.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.0 #Duplication Level Percentage of deduplicated Percentage of total 1 89.82954545454545 79.05 2 8.096590909090908 14.249999999999998 3 1.5909090909090908 4.2 4 0.2840909090909091 1.0 5 0.08522727272727272 0.375 6 0.028409090909090908 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.08522727272727272 0.975 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCAGTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTA 17 0.42500000000000004 No Hit GTTGCATTTATCTAAAGTATTCTCACTTTACTTAACACTTGAGCTACATA 12 0.3 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit GTTCTACTTCTGATTTTTACGTTCGAAATAAAGCTTACGGAGACTTCCTT 6 0.15 No Hit CTAAAGTATTCTCACTTTACTTAACACTTGAGCTACATAGAATGTCTACA 5 0.125 No Hit CTTTACTTAACACTTGAGCTACATAGAATGTCTACAGTCAATTTGGCAGC 5 0.125 No Hit TGAAGACTCTTCTGTTGACATTGCGGGCAGAAGGTTCCATAGCGGGACAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.0750000000000002 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 2.9875 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.3625 0.0 0.0 0.0 0.0 116-117 3.7375 0.0 0.0 0.0 0.0 118-119 4.175 0.0 0.0 0.0 0.0 120-121 4.6875 0.0 0.0 0.0 0.0 122-123 5.125 0.0 0.0 0.0 0.0 124-125 5.6375 0.0 0.0 0.0 0.0 126-127 6.0625 0.0 0.0 0.0 0.0 128-129 6.5 0.0 0.0 0.0 0.0 130-131 7.1 0.0 0.0 0.0 0.0 132-133 7.75 0.0 0.0 0.0 0.0 134-135 8.2375 0.0 0.0 0.0 0.0 136-137 8.8625 0.0 0.0 0.0 0.0 138-139 9.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748837 spots for SRR12917564.sra Written 748837 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra Read 748818 spots for SRR12917564.sra Written 748818 spots for SRR12917564.sra SRR ids: ['SRR12917564.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8gw13li2 SRR12917564.sra spots: 14976379 blocks: [[1, 748818], [748819, 1497636], [1497637, 2246454], [2246455, 2995272], [2995273, 3744090], [3744091, 4492908], [4492909, 5241726], [5241727, 5990544], [5990545, 6739362], [6739363, 7488180], [7488181, 8236998], [8236999, 8985816], [8985817, 9734634], [9734635, 10483452], [10483453, 11232270], [11232271, 11981088], [11981089, 12729906], [12729907, 13478724], [13478725, 14227542], [14227543, 14976379]] SRR12917564 file size 5067928 SRR12917564 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917564 SRR12917564_1.fastq SRR12917564_2.fastq Input file: SRR12917564_1.fastq Paired file: SRR12917564_2.fastq trimmed: SRR12917564-trimmed-pair1.fastq, SRR12917564-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:05:22 2025 >> started Thu Feb 13 14:05:39 2025 >> done (16.614s) 14976379 read pairs processed; of these: 130 ( 0.00%) short read pairs filtered out after trimming by size control 3170 ( 0.02%) empty read pairs filtered out after trimming by size control 14973079 (99.98%) read pairs available; of these: 2091260 (13.97%) trimmed read pairs available after processing 12881819 (86.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 14 0.00% 21 12 0.00% 22 19 0.00% 23 20 0.00% 24 15 0.00% 25 28 0.00% 26 27 0.00% 27 21 0.00% 28 22 0.00% 29 21 0.00% 30 33 0.00% 31 29 0.00% 32 33 0.00% 33 35 0.00% 34 45 0.00% 35 29 0.00% 36 35 0.00% 37 26 0.00% 38 56 0.00% 39 48 0.00% 40 40 0.00% 41 52 0.00% 42 51 0.00% 43 51 0.00% 44 46 0.00% 45 48 0.00% 46 68 0.00% 47 78 0.00% 48 87 0.00% 49 90 0.00% 50 112 0.00% 51 125 0.00% 52 140 0.00% 53 152 0.00% 54 143 0.00% 55 191 0.00% 56 199 0.00% 57 246 0.00% 58 258 0.00% 59 350 0.00% 60 400 0.00% 61 483 0.00% 62 550 0.00% 63 623 0.00% 64 680 0.00% 65 825 0.01% 66 944 0.01% 67 941 0.01% 68 1148 0.01% 69 1182 0.01% 70 1437 0.01% 71 1660 0.01% 72 1951 0.01% 73 2268 0.02% 74 2333 0.02% 75 2680 0.02% 76 3220 0.02% 77 3158 0.02% 78 3766 0.03% 79 3956 0.03% 80 4334 0.03% 81 4862 0.03% 82 5484 0.04% 83 5997 0.04% 84 6823 0.05% 85 7243 0.05% 86 7647 0.05% 87 8057 0.05% 88 8361 0.06% 89 8523 0.06% 90 9008 0.06% 91 9977 0.07% 92 10622 0.07% 93 11379 0.08% 94 12673 0.08% 95 13394 0.09% 96 14249 0.10% 97 14911 0.10% 98 15248 0.10% 99 15612 0.10% 100 15917 0.11% 101 16941 0.11% 102 17585 0.12% 103 18781 0.13% 104 20127 0.13% 105 21171 0.14% 106 22091 0.15% 107 23395 0.16% 108 23829 0.16% 109 23994 0.16% 110 23935 0.16% 111 24604 0.16% 112 25835 0.17% 113 26083 0.17% 114 27613 0.18% 115 29159 0.19% 116 29622 0.20% 117 30777 0.21% 118 32114 0.21% 119 31986 0.21% 120 32565 0.22% 121 33270 0.22% 122 32824 0.22% 123 33906 0.23% 124 36187 0.24% 125 37511 0.25% 126 38379 0.26% 127 38765 0.26% 128 39595 0.26% 129 40663 0.27% 130 41552 0.28% 131 41222 0.28% 132 42376 0.28% 133 42685 0.29% 134 41883 0.28% 135 44050 0.29% 136 44996 0.30% 137 47000 0.31% 138 47220 0.32% 139 48352 0.32% 140 49434 0.33% 141 51103 0.34% 142 50564 0.34% 143 49872 0.33% 144 52001 0.35% 145 51175 0.34% 146 52852 0.35% 147 52483 0.35% 148 52398 0.35% 149 52822 0.35% 150 54283 0.36% 151 12881819 86.03% 14973079 reads passed initial QC criterion=sequence-density sequence-density=1.62 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=23 prefix-density=1.64 prefix-fanout=2.1 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCC criterion=fanout-score sequence-density=0.29 sequence-density-rank=15 fanout-score=13.72 fanout-score-rank=1 prefix-density=1.78 prefix-fanout=2.2 sequence=TGAACTTGTTTTACCAGCTACAT criterion=sequence-density sequence-density=1.31 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=31 prefix-density=1.30 prefix-fanout=2.0 sequence=AAGCGCTCAAGGATATGAAGTTAAGAAAATGCTATTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=39.48 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=1.1 sequence=GTTGCATTTCTAAAGTACTATCCGTCTGCTCAATCCACTTCACACAATGTCGAGTATCAATTTGGCA SRR12917564 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:06:23 Started mapping on | Feb 13 14:06:23 Finished on | Feb 13 14:08:09 Mapping speed, Million of reads per hour | 508.52 Number of input reads | 14973079 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13968898 Uniquely mapped reads % | 93.29% Average mapped length | 293.34 Number of splices: Total | 13510326 Number of splices: Annotated (sjdb) | 13192177 Number of splices: GT/AG | 13279356 Number of splices: GC/AG | 178176 Number of splices: AT/AC | 11313 Number of splices: Non-canonical | 41481 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 421532 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 61570 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.30% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 582649 582649 582649 N_multimapping 421532 421532 421532 N_noFeature 517517 13812934 596637 N_ambiguous 218358 795 140996 UnstrandedReadsAssigned:13233023 PositiveStrandReadsAssigned:155169 NegativeStrandReadsAssigned:13231265 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917564 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917564-trimmed-pair1.fastq SRR12917564-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,973,079 reads, 13,221,079 reads pseudoaligned [quant] estimated average fragment length: 246.821 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 976 rounds 52401 SRR12917564.ke.tsv 34699 SRR12917564.se.tsv 87100 total ==> SRR12917564.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.18 466 21.212 Potri.005G024800.1.v4.1 1035 789.179 196 20.0347 Potri.004G059700.1.v4.1 961 715.322 9 1.01495 Potri.007G009000.2.v4.1 1416 1170.18 0 0 Potri.003G141000.2.v4.1 2943 2697.18 553.642 16.5586 Potri.016G087400.1.v4.1 270 91.7258 1015 892.642 Potri.015G069301.1.v4.1 564 332.36 0 0 Potri.010G195200.1.v4.1 1773 1527.18 80.9186 4.27427 Potri.012G127500.1.v4.1 977 731.254 759 83.7291 ==> SRR12917564.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 63 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 190 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 112 SRR12917564 completed mapping pipeline successfully