Starting /dee2/code/volunteer_pipeline.sh SRR12917565 current disk space = 3090141728768 free memory = 1417447192 SRR12917565 SRAfilesize b6be7fc8a3276b454c2cb88022f85224 SRR12917565.sra SRR12917565.sra file validated SRR12917565 is paired end SRR12917565 is conventional basespace SRR12917565 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917565_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.57575 37.0 37.0 37.0 37.0 37.0 2 36.5185 37.0 37.0 37.0 37.0 37.0 3 36.506 37.0 37.0 37.0 37.0 37.0 4 36.6675 37.0 37.0 37.0 37.0 37.0 5 36.649 37.0 37.0 37.0 37.0 37.0 6 36.654 37.0 37.0 37.0 37.0 37.0 7 36.544 37.0 37.0 37.0 37.0 37.0 8 36.5525 37.0 37.0 37.0 37.0 37.0 9 36.641 37.0 37.0 37.0 37.0 37.0 10-14 36.571400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6052 37.0 37.0 37.0 37.0 37.0 20-24 36.5516 37.0 37.0 37.0 37.0 37.0 25-29 36.5048 37.0 37.0 37.0 37.0 37.0 30-34 36.486 37.0 37.0 37.0 37.0 37.0 35-39 36.478 37.0 37.0 37.0 37.0 37.0 40-44 36.488800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4415 37.0 37.0 37.0 37.0 37.0 50-54 36.392900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3891 37.0 37.0 37.0 37.0 37.0 60-64 36.336400000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2883 37.0 37.0 37.0 37.0 37.0 70-74 36.32000000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.3278 37.0 37.0 37.0 37.0 37.0 80-84 36.333000000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.250099999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2761 37.0 37.0 37.0 37.0 37.0 95-99 36.2436 37.0 37.0 37.0 37.0 37.0 100-104 36.2174 37.0 37.0 37.0 37.0 37.0 105-109 36.1364 37.0 37.0 37.0 37.0 37.0 110-114 36.1516 37.0 37.0 37.0 37.0 37.0 115-119 36.0901 37.0 37.0 37.0 37.0 37.0 120-124 36.095299999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.0059 37.0 37.0 37.0 37.0 37.0 130-134 35.890499999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.8832 37.0 37.0 37.0 37.0 37.0 140-144 35.7818 37.0 37.0 37.0 37.0 37.0 145-149 35.71419999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.53125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 0.0 23 3.0 24 2.0 25 3.0 26 5.0 27 8.0 28 8.0 29 16.0 30 20.0 31 29.0 32 41.0 33 54.0 34 115.0 35 321.0 36 3088.0 37 285.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.81120280070017 12.328082020505127 4.251062765691422 38.60965241310328 2 19.525000000000002 12.325 40.2 27.950000000000003 3 17.2 17.575 29.325000000000003 35.9 4 22.05 23.95 25.5 28.499999999999996 5 23.625 30.125 24.6 21.65 6 20.175 35.425000000000004 22.375 22.025 7 14.249999999999998 29.525000000000002 40.9 15.325 8 16.400000000000002 25.275 33.475 24.85 9 17.299999999999997 23.0 36.7 23.0 10-14 19.485 30.04 27.775 22.7 15-19 20.669999999999998 27.29 27.68 24.36 20-24 20.265 28.04 28.21 23.485 25-29 19.825 29.060000000000002 27.250000000000004 23.865 30-34 20.07 28.470000000000002 27.544999999999998 23.915 35-39 20.16 28.294999999999998 27.91 23.635 40-44 20.25 28.73 27.905 23.115 45-49 20.235 28.67 27.205000000000002 23.89 50-54 20.89 28.115000000000002 27.73 23.265 55-59 20.47 27.975 27.589999999999996 23.965 60-64 20.275000000000002 28.355000000000004 26.945000000000004 24.425 65-69 20.205000000000002 27.955000000000002 28.044999999999998 23.794999999999998 70-74 20.32 28.38 27.01 24.29 75-79 20.465 27.650000000000002 27.92 23.965 80-84 20.544999999999998 28.225 27.665 23.565 85-89 20.435 28.22 27.345000000000002 24.0 90-94 20.674999999999997 27.750000000000004 27.505000000000003 24.07 95-99 20.945 28.055000000000003 27.644999999999996 23.355 100-104 20.78 28.49 27.544999999999998 23.185 105-109 21.33 28.15 27.16 23.36 110-114 20.349999999999998 28.54 27.395000000000003 23.715 115-119 20.775 28.345 27.16 23.72 120-124 20.724999999999998 29.03 26.424999999999997 23.82 125-129 21.055 28.435 26.705000000000002 23.805 130-134 21.05 29.099999999999998 26.36 23.49 135-139 21.475 27.47 27.13 23.925 140-144 21.154999999999998 28.23 26.555 24.060000000000002 145-149 21.315 28.285 26.575 23.825 150-151 22.1 27.224999999999998 26.275 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 3.0 21 3.0 22 2.0 23 3.5 24 2.5 25 0.5 26 3.0 27 6.5 28 8.0 29 15.5 30 20.5 31 23.5 32 30.0 33 39.0 34 61.0 35 71.5 36 79.0 37 92.5 38 121.0 39 147.5 40 166.5 41 208.0 42 229.0 43 236.0 44 266.5 45 280.0 46 259.5 47 250.0 48 235.0 49 213.0 50 188.5 51 146.0 52 121.5 53 107.0 54 86.0 55 64.5 56 51.5 57 38.5 58 32.5 59 37.0 60 22.5 61 7.0 62 3.5 63 3.5 64 4.0 65 3.0 66 1.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.2 #Duplication Level Percentage of deduplicated Percentage of total 1 92.51626898047722 85.3 2 6.643167028199566 12.25 3 0.7321041214750542 2.025 4 0.08134490238611713 0.3 5 0.027114967462039046 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTGCCTTTTATGAGCAGCTTACCCCTTCTGCTTACCCGGCTCTCCAATG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.8999999999999999 0.0 0.0 0.0 0.0 92-93 1.0499999999999998 0.0 0.0 0.0 0.0 94-95 1.275 0.0 0.0 0.0 0.0 96-97 1.4875 0.0 0.0 0.0 0.0 98-99 1.6375 0.0 0.0 0.0 0.0 100-101 1.75 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.3499999999999996 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 2.9375 0.0 0.0 0.0 0.0 110-111 3.3125 0.0 0.0 0.0 0.0 112-113 3.8375 0.0 0.0 0.0 0.0 114-115 4.175 0.0 0.0 0.0 0.0 116-117 4.6125 0.0 0.0 0.0 0.0 118-119 4.887499999999999 0.0 0.0 0.0 0.0 120-121 5.425 0.0 0.0 0.0 0.0 122-123 5.9375 0.0 0.0 0.0 0.0 124-125 6.425000000000001 0.0 0.0 0.0 0.0 126-127 7.075 0.0 0.0 0.0 0.0 128-129 7.637499999999999 0.0 0.0 0.0 0.0 130-131 8.100000000000001 0.0 0.0 0.0 0.0 132-133 8.6375 0.0 0.0 0.0 0.0 134-135 9.2625 0.0 0.0 0.0 0.0 136-137 9.8125 0.0 0.0 0.0 0.0 138-139 10.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917565 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917565_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4355 37.0 37.0 37.0 37.0 37.0 2 36.305 37.0 37.0 37.0 37.0 37.0 3 36.3695 37.0 37.0 37.0 37.0 37.0 4 36.406 37.0 37.0 37.0 37.0 37.0 5 36.5045 37.0 37.0 37.0 37.0 37.0 6 36.2905 37.0 37.0 37.0 37.0 37.0 7 36.453 37.0 37.0 37.0 37.0 37.0 8 36.4425 37.0 37.0 37.0 37.0 37.0 9 36.338 37.0 37.0 37.0 37.0 37.0 10-14 36.392999999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.3689 37.0 37.0 37.0 37.0 37.0 20-24 36.327299999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.269000000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2378 37.0 37.0 37.0 37.0 37.0 35-39 36.144 37.0 37.0 37.0 37.0 37.0 40-44 36.155199999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.1161 37.0 37.0 37.0 37.0 37.0 50-54 36.072 37.0 37.0 37.0 37.0 37.0 55-59 36.1346 37.0 37.0 37.0 37.0 37.0 60-64 36.079100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.086800000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0286 37.0 37.0 37.0 37.0 37.0 75-79 35.991699999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.0156 37.0 37.0 37.0 37.0 37.0 85-89 36.057300000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.0423 37.0 37.0 37.0 37.0 37.0 95-99 35.955299999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.9156 37.0 37.0 37.0 37.0 37.0 105-109 35.962799999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.859 37.0 37.0 37.0 37.0 37.0 115-119 35.842 37.0 37.0 37.0 37.0 37.0 120-124 35.718399999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.695499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.5749 37.0 37.0 37.0 37.0 37.0 135-139 35.5345 37.0 37.0 37.0 37.0 37.0 140-144 35.2757 37.0 37.0 37.0 32.2 37.0 145-149 35.174899999999994 37.0 37.0 37.0 29.8 37.0 150-151 34.7805 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 4.0 16 2.0 17 2.0 18 0.0 19 3.0 20 2.0 21 2.0 22 4.0 23 8.0 24 6.0 25 4.0 26 6.0 27 8.0 28 6.0 29 15.0 30 25.0 31 22.0 32 48.0 33 86.0 34 188.0 35 522.0 36 2790.0 37 243.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.375 25.624999999999996 8.025 24.975 2 26.325 24.925 33.5 15.25 3 19.85 27.800000000000004 35.5 16.85 4 24.075 34.449999999999996 22.425 19.05 5 25.1 38.625 19.675 16.6 6 20.1 39.6 21.85 18.45 7 20.825 21.8 39.45 17.925 8 19.575 25.174999999999997 29.525000000000002 25.724999999999998 9 21.15 24.55 30.825000000000003 23.474999999999998 10-14 23.26 28.720000000000002 27.605 20.415 15-19 23.79 28.095 27.025 21.09 20-24 23.01 29.13 27.134999999999998 20.724999999999998 25-29 22.715 27.825 27.875 21.584999999999997 30-34 22.41 28.444999999999997 27.71 21.435000000000002 35-39 22.689999999999998 28.42 27.805000000000003 21.085 40-44 22.830000000000002 28.494999999999997 27.35 21.325 45-49 23.03 27.639999999999997 28.310000000000002 21.02 50-54 22.455 27.889999999999997 28.095 21.560000000000002 55-59 22.400000000000002 28.075 27.57 21.955 60-64 23.494999999999997 27.67 27.665 21.17 65-69 23.025000000000002 27.04 28.299999999999997 21.634999999999998 70-74 23.015 27.950000000000003 27.345000000000002 21.69 75-79 23.585 27.97 27.775 20.669999999999998 80-84 23.98 27.675 27.145000000000003 21.2 85-89 23.150000000000002 27.779999999999998 27.334999999999997 21.735 90-94 23.71 28.499999999999996 26.855 20.935000000000002 95-99 23.51 27.705000000000002 27.810000000000002 20.974999999999998 100-104 23.465 27.82 27.685 21.029999999999998 105-109 24.04 27.994999999999997 27.21 20.755000000000003 110-114 22.825 28.17 27.37 21.634999999999998 115-119 24.075 28.775000000000002 26.36 20.79 120-124 23.965 28.185 27.474999999999998 20.375 125-129 24.555 27.97 26.63 20.845 130-134 25.255 27.834999999999997 26.305 20.605 135-139 25.509999999999998 27.68 26.83 19.98 140-144 26.115 27.26 26.555 20.07 145-149 26.605 27.685 26.02 19.689999999999998 150-151 27.1625 28.0625 25.0125 19.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.5 21 2.0 22 1.5 23 4.5 24 5.5 25 4.5 26 8.0 27 8.5 28 12.0 29 14.0 30 15.0 31 15.5 32 23.0 33 39.0 34 52.0 35 66.0 36 85.0 37 106.0 38 129.0 39 163.0 40 185.5 41 210.0 42 236.5 43 255.5 44 278.5 45 288.5 46 281.0 47 242.5 48 209.5 49 188.0 50 152.0 51 134.0 52 115.5 53 95.0 54 88.0 55 72.5 56 57.5 57 42.0 58 26.5 59 26.5 60 21.5 61 8.0 62 4.5 63 3.0 64 1.5 65 2.0 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.56738361012796 85.0 2 6.4524911516471555 11.85 3 0.6261911244214539 1.725 4 0.21780560849441874 0.8 5 0.1361285053090117 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCATCGGCAGCCGTTGCCACCGTCAACCGCACCCCGGCACAAGCCAATA 5 0.125 No Hit CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit AATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCG 5 0.125 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit TGGGATTTTTTTTATTGGAATTTTCTTTCTAATCAAACAGGTCAGAGGTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.8999999999999999 0.0 0.0 0.0 0.0 92-93 1.0499999999999998 0.0 0.0 0.0 0.0 94-95 1.275 0.0 0.0 0.0 0.0 96-97 1.4875 0.0 0.0 0.0 0.0 98-99 1.6375 0.0 0.0 0.0 0.0 100-101 1.7625000000000002 0.0 0.0 0.0 0.0 102-103 2.0374999999999996 0.0 0.0 0.0 0.0 104-105 2.375 0.0 0.0 0.0 0.0 106-107 2.6375 0.0 0.0 0.0 0.0 108-109 2.9625 0.0 0.0 0.0 0.0 110-111 3.3375000000000004 0.0 0.0 0.0 0.0 112-113 3.8625 0.0 0.0 0.0 0.0 114-115 4.2 0.0 0.0 0.0 0.0 116-117 4.6375 0.0 0.0 0.0 0.0 118-119 4.9125 0.0 0.0 0.0 0.0 120-121 5.4375 0.0 0.0 0.0 0.0 122-123 5.9375 0.0 0.0 0.0 0.0 124-125 6.425000000000001 0.0 0.0 0.0 0.0 126-127 7.1 0.0 0.0 0.0 0.0 128-129 7.6625 0.0 0.0 0.0 0.0 130-131 8.125 0.0 0.0 0.0 0.0 132-133 8.7 0.0 0.0 0.0 0.0 134-135 9.3625 0.0 0.0 0.0 0.0 136-137 9.9125 0.0 0.0 0.0 0.0 138-139 10.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.0035366106 20.714287 50-54 >>END_MODULE Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536054 spots for SRR12917565.sra Written 536054 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra Read 536051 spots for SRR12917565.sra Written 536051 spots for SRR12917565.sra SRR ids: ['SRR12917565.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zcu_0e_w SRR12917565.sra spots: 10721023 blocks: [[1, 536051], [536052, 1072102], [1072103, 1608153], [1608154, 2144204], [2144205, 2680255], [2680256, 3216306], [3216307, 3752357], [3752358, 4288408], [4288409, 4824459], [4824460, 5360510], [5360511, 5896561], [5896562, 6432612], [6432613, 6968663], [6968664, 7504714], [7504715, 8040765], [8040766, 8576816], [8576817, 9112867], [9112868, 9648918], [9648919, 10184969], [10184970, 10721023]] SRR12917565 file size 3621772 SRR12917565 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917565 SRR12917565_1.fastq SRR12917565_2.fastq Input file: SRR12917565_1.fastq Paired file: SRR12917565_2.fastq trimmed: SRR12917565-trimmed-pair1.fastq, SRR12917565-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:01:03 2025 >> started Thu Feb 13 14:01:15 2025 >> done (11.530s) 10721023 read pairs processed; of these: 122 ( 0.00%) short read pairs filtered out after trimming by size control 650 ( 0.01%) empty read pairs filtered out after trimming by size control 10720251 (99.99%) read pairs available; of these: 1655596 (15.44%) trimmed read pairs available after processing 9064655 (84.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 7 0.00% 21 14 0.00% 22 17 0.00% 23 18 0.00% 24 20 0.00% 25 17 0.00% 26 25 0.00% 27 14 0.00% 28 19 0.00% 29 25 0.00% 30 25 0.00% 31 15 0.00% 32 27 0.00% 33 21 0.00% 34 24 0.00% 35 22 0.00% 36 26 0.00% 37 25 0.00% 38 32 0.00% 39 23 0.00% 40 30 0.00% 41 24 0.00% 42 31 0.00% 43 34 0.00% 44 27 0.00% 45 44 0.00% 46 40 0.00% 47 57 0.00% 48 58 0.00% 49 74 0.00% 50 76 0.00% 51 103 0.00% 52 108 0.00% 53 104 0.00% 54 118 0.00% 55 136 0.00% 56 159 0.00% 57 164 0.00% 58 199 0.00% 59 230 0.00% 60 282 0.00% 61 345 0.00% 62 335 0.00% 63 439 0.00% 64 494 0.00% 65 550 0.01% 66 582 0.01% 67 703 0.01% 68 811 0.01% 69 934 0.01% 70 1100 0.01% 71 1200 0.01% 72 1417 0.01% 73 1648 0.02% 74 1892 0.02% 75 2168 0.02% 76 2306 0.02% 77 2484 0.02% 78 2710 0.03% 79 3085 0.03% 80 3374 0.03% 81 3947 0.04% 82 4314 0.04% 83 4755 0.04% 84 5340 0.05% 85 5932 0.06% 86 6230 0.06% 87 6576 0.06% 88 6862 0.06% 89 7346 0.07% 90 7907 0.07% 91 8327 0.08% 92 8958 0.08% 93 9858 0.09% 94 10562 0.10% 95 11544 0.11% 96 11887 0.11% 97 12538 0.12% 98 12907 0.12% 99 13409 0.13% 100 13867 0.13% 101 14124 0.13% 102 14950 0.14% 103 16002 0.15% 104 16543 0.15% 105 17511 0.16% 106 18156 0.17% 107 19114 0.18% 108 19658 0.18% 109 20101 0.19% 110 20144 0.19% 111 20809 0.19% 112 21308 0.20% 113 21489 0.20% 114 22558 0.21% 115 23756 0.22% 116 24458 0.23% 117 25604 0.24% 118 26334 0.25% 119 26356 0.25% 120 27218 0.25% 121 27280 0.25% 122 27368 0.26% 123 28074 0.26% 124 28911 0.27% 125 29010 0.27% 126 30748 0.29% 127 31249 0.29% 128 32007 0.30% 129 32449 0.30% 130 32494 0.30% 131 32669 0.30% 132 33116 0.31% 133 34069 0.32% 134 33788 0.32% 135 34244 0.32% 136 34779 0.32% 137 35532 0.33% 138 36465 0.34% 139 37405 0.35% 140 36719 0.34% 141 37277 0.35% 142 37736 0.35% 143 37264 0.35% 144 37811 0.35% 145 38596 0.36% 146 38225 0.36% 147 39114 0.36% 148 39866 0.37% 149 40049 0.37% 150 40918 0.38% 151 9064655 84.56% 10720251 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=0.71 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=15.32 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=4.0 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=24 prefix-density=0.92 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=62.64 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.1 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12917565 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:01:57 Started mapping on | Feb 13 14:01:57 Finished on | Feb 13 14:03:01 Mapping speed, Million of reads per hour | 603.01 Number of input reads | 10720251 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 10012515 Uniquely mapped reads % | 93.40% Average mapped length | 292.21 Number of splices: Total | 9806924 Number of splices: Annotated (sjdb) | 9603876 Number of splices: GT/AG | 9597370 Number of splices: GC/AG | 174577 Number of splices: AT/AC | 6051 Number of splices: Non-canonical | 28926 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256210 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 28035 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.83% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 451526 451526 451526 N_multimapping 256210 256210 256210 N_noFeature 341395 9892608 390197 N_ambiguous 129460 525 57992 UnstrandedReadsAssigned:9541660 PositiveStrandReadsAssigned:119382 NegativeStrandReadsAssigned:9564326 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917565 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917565-trimmed-pair1.fastq SRR12917565-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,720,251 reads, 9,624,303 reads pseudoaligned [quant] estimated average fragment length: 245.214 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,002 rounds 52401 SRR12917565.ke.tsv 34699 SRR12917565.se.tsv 87100 total ==> SRR12917565.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.79 254 15.3703 Potri.005G024800.1.v4.1 1035 790.786 147 19.953 Potri.004G059700.1.v4.1 961 716.91 15 2.24583 Potri.007G009000.2.v4.1 1416 1171.79 0 0 Potri.003G141000.2.v4.1 2943 2698.79 462.39 18.3904 Potri.016G087400.1.v4.1 270 94.025 624 712.347 Potri.015G069301.1.v4.1 564 334.349 0 0 Potri.010G195200.1.v4.1 1773 1528.79 6 0.421265 Potri.012G127500.1.v4.1 977 732.836 276 40.4252 ==> SRR12917565.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 168 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 83 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR12917565 completed mapping pipeline successfully