Starting /dee2/code/volunteer_pipeline.sh SRR12917566 current disk space = 3090106421248 free memory = 1382790884 SRR12917566 SRAfilesize ad53d2aeb0abeb1af3387b6978e5f29e SRR12917566.sra SRR12917566.sra file validated SRR12917566 is paired end SRR12917566 is conventional basespace SRR12917566 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917566_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.609 37.0 37.0 37.0 37.0 37.0 2 36.5765 37.0 37.0 37.0 37.0 37.0 3 36.6635 37.0 37.0 37.0 37.0 37.0 4 36.7175 37.0 37.0 37.0 37.0 37.0 5 36.6815 37.0 37.0 37.0 37.0 37.0 6 36.6995 37.0 37.0 37.0 37.0 37.0 7 36.596 37.0 37.0 37.0 37.0 37.0 8 36.62 37.0 37.0 37.0 37.0 37.0 9 36.701 37.0 37.0 37.0 37.0 37.0 10-14 36.6081 37.0 37.0 37.0 37.0 37.0 15-19 36.6168 37.0 37.0 37.0 37.0 37.0 20-24 36.5947 37.0 37.0 37.0 37.0 37.0 25-29 36.551500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4902 37.0 37.0 37.0 37.0 37.0 35-39 36.4728 37.0 37.0 37.0 37.0 37.0 40-44 36.5287 37.0 37.0 37.0 37.0 37.0 45-49 36.468 37.0 37.0 37.0 37.0 37.0 50-54 36.455400000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.4323 37.0 37.0 37.0 37.0 37.0 60-64 36.376799999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3168 37.0 37.0 37.0 37.0 37.0 70-74 36.336800000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.3412 37.0 37.0 37.0 37.0 37.0 80-84 36.3585 37.0 37.0 37.0 37.0 37.0 85-89 36.260400000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.2357 37.0 37.0 37.0 37.0 37.0 95-99 36.2389 37.0 37.0 37.0 37.0 37.0 100-104 36.1632 37.0 37.0 37.0 37.0 37.0 105-109 36.125299999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.0954 37.0 37.0 37.0 37.0 37.0 115-119 36.0757 37.0 37.0 37.0 37.0 37.0 120-124 36.003499999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.910700000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.8415 37.0 37.0 37.0 37.0 37.0 135-139 35.763999999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.542500000000004 37.0 37.0 37.0 34.6 37.0 145-149 35.3364 37.0 37.0 37.0 34.6 37.0 150-151 35.079499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 0.0 25 2.0 26 3.0 27 8.0 28 7.0 29 17.0 30 17.0 31 25.0 32 41.0 33 76.0 34 139.0 35 386.0 36 3001.0 37 275.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.431431431431434 10.535535535535535 7.382382382382382 50.650650650650654 2 17.5 11.375 40.6 30.525000000000002 3 16.425 16.275000000000002 26.85 40.45 4 22.275 22.775000000000002 23.925 31.025000000000002 5 24.8 28.575 26.375 20.25 6 19.775000000000002 32.375 24.8 23.05 7 14.975 27.0 40.25 17.775 8 16.950000000000003 25.6 33.800000000000004 23.65 9 16.925 23.95 35.725 23.400000000000002 10-14 19.67 29.57 27.88 22.88 15-19 19.82 28.410000000000004 27.815 23.955000000000002 20-24 19.869999999999997 27.584999999999997 28.860000000000003 23.685000000000002 25-29 20.025000000000002 28.754999999999995 27.655 23.565 30-34 19.81 28.255000000000003 27.855 24.08 35-39 20.349999999999998 28.615000000000002 27.095000000000002 23.94 40-44 20.055 28.59 27.939999999999998 23.415 45-49 20.47 27.495000000000005 27.939999999999998 24.095 50-54 19.55 28.57 27.93 23.95 55-59 20.24 28.615000000000002 27.224999999999998 23.919999999999998 60-64 20.43 28.804999999999996 27.015 23.75 65-69 19.77 28.685 27.77 23.775 70-74 20.330000000000002 28.310000000000002 27.61 23.75 75-79 20.445 28.389999999999997 27.48 23.685000000000002 80-84 20.32 28.599999999999998 27.834999999999997 23.244999999999997 85-89 20.59 29.054999999999996 27.284999999999997 23.07 90-94 20.560000000000002 27.93 27.48 24.03 95-99 21.834999999999997 28.189999999999998 26.924999999999997 23.05 100-104 21.34 28.515 26.25 23.895 105-109 21.15 28.084999999999997 27.27 23.494999999999997 110-114 20.945 28.89 26.615 23.549999999999997 115-119 21.2 28.51 26.695 23.595 120-124 20.655 28.96 26.334999999999997 24.05 125-129 20.635 27.534999999999997 27.145000000000003 24.685000000000002 130-134 20.935000000000002 27.48 26.56 25.025 135-139 20.79 27.715 27.1 24.395 140-144 21.404999999999998 26.865 26.405 25.324999999999996 145-149 21.58 27.27 26.02 25.130000000000003 150-151 22.125 26.3625 27.05 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 2.5 22 1.5 23 1.5 24 2.0 25 1.0 26 3.5 27 5.0 28 10.0 29 17.0 30 18.0 31 25.5 32 38.0 33 50.5 34 59.5 35 75.0 36 87.5 37 102.5 38 134.0 39 157.5 40 165.5 41 183.0 42 219.5 43 248.5 44 257.5 45 252.0 46 268.0 47 267.5 48 238.0 49 213.0 50 163.5 51 138.5 52 128.5 53 106.0 54 89.0 55 63.5 56 51.5 57 45.0 58 29.0 59 25.5 60 21.0 61 11.0 62 7.0 63 2.5 64 2.0 65 4.5 66 4.0 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.8 #Duplication Level Percentage of deduplicated Percentage of total 1 91.27202643171806 82.875 2 7.6266519823788546 13.850000000000001 3 0.8535242290748899 2.325 4 0.22026431718061676 0.8 5 0.0 0.0 6 0.027533039647577095 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.4875 0.0 0.0 0.0 0.0 76-77 0.6375 0.0 0.0 0.0 0.0 78-79 0.7749999999999999 0.0 0.0 0.0 0.0 80-81 0.9375 0.0 0.0 0.0 0.0 82-83 1.0625 0.0 0.0 0.0 0.0 84-85 1.1625 0.0 0.0 0.0 0.0 86-87 1.4 0.0 0.0 0.0 0.0 88-89 1.6124999999999998 0.0 0.0 0.0 0.0 90-91 1.9 0.0 0.0 0.0 0.0 92-93 2.2125 0.0 0.0 0.0 0.0 94-95 2.65 0.0 0.0 0.0 0.0 96-97 3.225 0.0 0.0 0.0 0.0 98-99 3.6375 0.0 0.0 0.0 0.0 100-101 4.050000000000001 0.0 0.0 0.0 0.0 102-103 4.5625 0.0 0.0 0.0 0.0 104-105 5.0375 0.0 0.0 0.0 0.0 106-107 5.7 0.0 0.0 0.0 0.0 108-109 6.2875 0.0 0.0 0.0 0.0 110-111 6.875 0.0 0.0 0.0 0.0 112-113 7.525 0.0 0.0 0.0 0.0 114-115 8.2 0.0 0.0 0.0 0.0 116-117 8.8625 0.0 0.0 0.0 0.0 118-119 9.55 0.0 0.0 0.0 0.0 120-121 10.1 0.0 0.0 0.0 0.0 122-123 10.75 0.0 0.0 0.0 0.0 124-125 11.3625 0.0 0.0 0.0 0.0 126-127 11.975000000000001 0.0 0.0 0.0 0.0 128-129 12.8125 0.0 0.0 0.0 0.0 130-131 13.537500000000001 0.0 0.0 0.0 0.0 132-133 14.2875 0.0 0.0 0.0 0.0 134-135 14.9 0.0 0.0 0.0 0.0 136-137 15.6 0.0 0.0 0.0 0.0 138-139 16.487499999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACACC 10 0.006830828 145.0 8 TGGAGGC 10 0.006830828 145.0 145 GTAAACA 10 0.006830828 145.0 6 AACACCG 10 0.006830828 145.0 9 >>END_MODULE SRR12917566 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917566_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4745 37.0 37.0 37.0 37.0 37.0 2 36.3835 37.0 37.0 37.0 37.0 37.0 3 36.3245 37.0 37.0 37.0 37.0 37.0 4 36.452 37.0 37.0 37.0 37.0 37.0 5 36.509 37.0 37.0 37.0 37.0 37.0 6 36.3405 37.0 37.0 37.0 37.0 37.0 7 36.408 37.0 37.0 37.0 37.0 37.0 8 36.4745 37.0 37.0 37.0 37.0 37.0 9 36.4015 37.0 37.0 37.0 37.0 37.0 10-14 36.443 37.0 37.0 37.0 37.0 37.0 15-19 36.4353 37.0 37.0 37.0 37.0 37.0 20-24 36.4124 37.0 37.0 37.0 37.0 37.0 25-29 36.345800000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.3043 37.0 37.0 37.0 37.0 37.0 35-39 36.1976 37.0 37.0 37.0 37.0 37.0 40-44 36.251999999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.2057 37.0 37.0 37.0 37.0 37.0 50-54 36.1766 37.0 37.0 37.0 37.0 37.0 55-59 36.2048 37.0 37.0 37.0 37.0 37.0 60-64 36.173700000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.145 37.0 37.0 37.0 37.0 37.0 70-74 36.103699999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0316 37.0 37.0 37.0 37.0 37.0 80-84 36.0565 37.0 37.0 37.0 37.0 37.0 85-89 36.097500000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.0729 37.0 37.0 37.0 37.0 37.0 95-99 36.0489 37.0 37.0 37.0 37.0 37.0 100-104 35.955400000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.8786 37.0 37.0 37.0 37.0 37.0 110-114 35.893600000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.7599 37.0 37.0 37.0 37.0 37.0 120-124 35.5471 37.0 37.0 37.0 37.0 37.0 125-129 35.5465 37.0 37.0 37.0 37.0 37.0 130-134 35.33 37.0 37.0 37.0 34.6 37.0 135-139 35.1539 37.0 37.0 37.0 27.4 37.0 140-144 34.8824 37.0 37.0 37.0 27.4 37.0 145-149 34.6367 37.0 37.0 37.0 25.0 37.0 150-151 34.1165 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 5.0 23 6.0 24 5.0 25 2.0 26 9.0 27 10.0 28 8.0 29 13.0 30 28.0 31 47.0 32 62.0 33 123.0 34 216.0 35 572.0 36 2661.0 37 231.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.55 21.75 13.125 34.575 2 25.724999999999998 24.275 33.975 16.025 3 18.525 27.700000000000003 33.050000000000004 20.724999999999998 4 23.25 33.725 24.099999999999998 18.925 5 25.674999999999997 37.175000000000004 22.125 15.024999999999999 6 20.925 38.574999999999996 22.55 17.95 7 19.075 22.075 38.324999999999996 20.525 8 19.925 25.1 31.5 23.474999999999998 9 21.475 23.599999999999998 31.45 23.474999999999998 10-14 23.155 28.7 27.02 21.125 15-19 22.39 28.21 28.389999999999997 21.01 20-24 22.915 29.054999999999996 27.29 20.74 25-29 22.715 27.875 28.299999999999997 21.11 30-34 22.85 28.265 27.834999999999997 21.05 35-39 23.044999999999998 27.76 27.794999999999998 21.4 40-44 23.43 27.87 27.955000000000002 20.745 45-49 22.185 28.005000000000003 28.315 21.495 50-54 23.025000000000002 28.165000000000003 27.810000000000002 21.0 55-59 22.0 28.310000000000002 28.37 21.32 60-64 23.325000000000003 27.165 28.134999999999998 21.375 65-69 23.075000000000003 27.779999999999998 27.91 21.235 70-74 23.810000000000002 27.405 27.525 21.26 75-79 23.665 27.82 27.79 20.724999999999998 80-84 23.544999999999998 28.035 27.54 20.880000000000003 85-89 23.57 28.025 27.42 20.985 90-94 24.05 27.98 27.125 20.845 95-99 23.794999999999998 28.115000000000002 27.52 20.57 100-104 24.610000000000003 27.884999999999998 26.965 20.54 105-109 24.595 28.144999999999996 26.900000000000002 20.36 110-114 24.765 27.295 27.644999999999996 20.294999999999998 115-119 24.884999999999998 27.6 26.96 20.555 120-124 25.779999999999998 28.389999999999997 26.265 19.564999999999998 125-129 25.990000000000002 27.495000000000005 26.325 20.19 130-134 25.840000000000003 27.060000000000002 26.779999999999998 20.32 135-139 26.3 26.735 27.18 19.785 140-144 26.35 27.02 26.790000000000003 19.84 145-149 27.279999999999998 26.22 27.505000000000003 18.995 150-151 27.474999999999998 25.924999999999997 26.924999999999997 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 2.0 22 1.5 23 0.5 24 1.5 25 2.0 26 6.0 27 8.0 28 8.0 29 15.5 30 21.0 31 18.0 32 22.5 33 43.0 34 54.5 35 58.0 36 85.0 37 107.5 38 124.0 39 166.5 40 191.5 41 224.5 42 272.0 43 276.0 44 269.0 45 275.0 46 257.0 47 238.0 48 225.0 49 188.5 50 173.0 51 144.0 52 103.5 53 91.0 54 73.5 55 60.0 56 49.5 57 34.0 58 23.5 59 22.5 60 18.0 61 11.5 62 8.0 63 4.5 64 4.0 65 2.0 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 1.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.26240352811466 82.775 2 7.552370452039692 13.700000000000001 3 0.8820286659316428 2.4 4 0.27563395810363833 1.0 5 0.027563395810363836 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.21250000000000002 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.4875 0.0 0.0 0.0 0.0 76-77 0.6375 0.0 0.0 0.0 0.0 78-79 0.7749999999999999 0.0 0.0 0.0 0.0 80-81 0.9375 0.0 0.0 0.0 0.0 82-83 1.0375 0.0 0.0 0.0 0.0 84-85 1.1375 0.0 0.0 0.0 0.0 86-87 1.375 0.0 0.0 0.0 0.0 88-89 1.6124999999999998 0.0 0.0 0.0 0.0 90-91 1.9 0.0 0.0 0.0 0.0 92-93 2.2125 0.0 0.0 0.0 0.0 94-95 2.6625 0.0 0.0 0.0 0.0 96-97 3.2375 0.0 0.0 0.0 0.0 98-99 3.6624999999999996 0.0 0.0 0.0 0.0 100-101 4.075 0.0 0.0 0.0 0.0 102-103 4.637499999999999 0.0 0.0 0.0 0.0 104-105 5.125 0.0 0.0 0.0 0.0 106-107 5.8375 0.0 0.0 0.0 0.0 108-109 6.4375 0.0 0.0 0.0 0.0 110-111 7.0375 0.0 0.0 0.0 0.0 112-113 7.699999999999999 0.0 0.0 0.0 0.0 114-115 8.375 0.0 0.0 0.0 0.0 116-117 9.0625 0.0 0.0 0.0 0.0 118-119 9.774999999999999 0.0 0.0 0.0 0.0 120-121 10.325 0.0 0.0 0.0 0.0 122-123 11.0 0.0 0.0 0.0 0.0 124-125 11.6875 0.0 0.0 0.0 0.0 126-127 12.325 0.0 0.0 0.0 0.0 128-129 13.2375 0.0 0.0 0.0 0.0 130-131 13.962499999999999 0.0 0.0 0.0 0.0 132-133 14.7125 0.0 0.0 0.0 0.0 134-135 15.3125 0.0 0.0 0.0 0.0 136-137 15.975000000000001 0.0 0.0 0.0 0.0 138-139 16.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGTCG 10 0.006830828 145.0 7 AAAGAAG 25 8.7132835E-4 87.0 2 >>END_MODULE Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635604 spots for SRR12917566.sra Written 635604 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra Read 635592 spots for SRR12917566.sra Written 635592 spots for SRR12917566.sra SRR ids: ['SRR12917566.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_voxwq9v1 SRR12917566.sra spots: 12711852 blocks: [[1, 635592], [635593, 1271184], [1271185, 1906776], [1906777, 2542368], [2542369, 3177960], [3177961, 3813552], [3813553, 4449144], [4449145, 5084736], [5084737, 5720328], [5720329, 6355920], [6355921, 6991512], [6991513, 7627104], [7627105, 8262696], [8262697, 8898288], [8898289, 9533880], [9533881, 10169472], [10169473, 10805064], [10805065, 11440656], [11440657, 12076248], [12076249, 12711852]] SRR12917566 file size 4298343 SRR12917566 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917566 SRR12917566_1.fastq SRR12917566_2.fastq Input file: SRR12917566_1.fastq Paired file: SRR12917566_2.fastq trimmed: SRR12917566-trimmed-pair1.fastq, SRR12917566-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:03:26 2025 >> started Thu Feb 13 14:03:41 2025 >> done (15.424s) 12711852 read pairs processed; of these: 67 ( 0.00%) short read pairs filtered out after trimming by size control 2110 ( 0.02%) empty read pairs filtered out after trimming by size control 12709675 (99.98%) read pairs available; of these: 2784506 (21.91%) trimmed read pairs available after processing 9925169 (78.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 4 0.00% 21 8 0.00% 22 9 0.00% 23 4 0.00% 24 8 0.00% 25 6 0.00% 26 10 0.00% 27 18 0.00% 28 12 0.00% 29 5 0.00% 30 11 0.00% 31 15 0.00% 32 14 0.00% 33 19 0.00% 34 28 0.00% 35 26 0.00% 36 25 0.00% 37 32 0.00% 38 41 0.00% 39 48 0.00% 40 60 0.00% 41 65 0.00% 42 78 0.00% 43 80 0.00% 44 79 0.00% 45 131 0.00% 46 116 0.00% 47 158 0.00% 48 222 0.00% 49 240 0.00% 50 290 0.00% 51 435 0.00% 52 407 0.00% 53 474 0.00% 54 524 0.00% 55 578 0.00% 56 653 0.01% 57 770 0.01% 58 852 0.01% 59 1043 0.01% 60 1274 0.01% 61 1459 0.01% 62 1788 0.01% 63 1951 0.02% 64 2237 0.02% 65 2407 0.02% 66 2619 0.02% 67 3043 0.02% 68 3427 0.03% 69 3751 0.03% 70 4527 0.04% 71 5034 0.04% 72 5811 0.05% 73 6649 0.05% 74 7273 0.06% 75 7803 0.06% 76 8521 0.07% 77 8945 0.07% 78 9569 0.08% 79 10611 0.08% 80 11386 0.09% 81 12392 0.10% 82 13628 0.11% 83 14745 0.12% 84 16044 0.13% 85 17255 0.14% 86 18056 0.14% 87 18658 0.15% 88 19551 0.15% 89 19969 0.16% 90 21103 0.17% 91 22156 0.17% 92 22642 0.18% 93 24089 0.19% 94 25663 0.20% 95 26984 0.21% 96 27562 0.22% 97 28917 0.23% 98 28967 0.23% 99 29423 0.23% 100 30182 0.24% 101 30587 0.24% 102 31228 0.25% 103 32377 0.25% 104 33115 0.26% 105 34388 0.27% 106 35584 0.28% 107 36219 0.28% 108 36757 0.29% 109 37302 0.29% 110 37065 0.29% 111 38001 0.30% 112 38342 0.30% 113 38461 0.30% 114 39005 0.31% 115 40697 0.32% 116 41564 0.33% 117 42413 0.33% 118 42854 0.34% 119 43459 0.34% 120 43876 0.35% 121 43733 0.34% 122 43751 0.34% 123 44574 0.35% 124 44893 0.35% 125 45276 0.36% 126 46677 0.37% 127 47707 0.38% 128 47603 0.37% 129 48392 0.38% 130 48758 0.38% 131 48165 0.38% 132 48142 0.38% 133 48718 0.38% 134 48265 0.38% 135 47996 0.38% 136 49620 0.39% 137 49437 0.39% 138 50800 0.40% 139 51906 0.41% 140 51607 0.41% 141 51653 0.41% 142 52013 0.41% 143 51023 0.40% 144 51381 0.40% 145 51640 0.41% 146 51562 0.41% 147 51593 0.41% 148 52018 0.41% 149 53069 0.42% 150 53561 0.42% 151 9925169 78.09% 12709675 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=21 prefix-density=0.60 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=77.98 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=9.1 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=28 prefix-density=0.77 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=38.69 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.3 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATT SRR12917566 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:04:21 Started mapping on | Feb 13 14:04:22 Finished on | Feb 13 14:06:04 Mapping speed, Million of reads per hour | 448.58 Number of input reads | 12709675 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 12052994 Uniquely mapped reads % | 94.83% Average mapped length | 287.04 Number of splices: Total | 11344144 Number of splices: Annotated (sjdb) | 11095181 Number of splices: GT/AG | 11095770 Number of splices: GC/AG | 204898 Number of splices: AT/AC | 8138 Number of splices: Non-canonical | 35338 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 334961 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 39840 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 321720 321720 321720 N_multimapping 334961 334961 334961 N_noFeature 451747 11903058 514946 N_ambiguous 159060 579 72009 UnstrandedReadsAssigned:11442187 PositiveStrandReadsAssigned:149357 NegativeStrandReadsAssigned:11466039 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR12917566 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917566-trimmed-pair1.fastq SRR12917566-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,709,675 reads, 11,485,573 reads pseudoaligned [quant] estimated average fragment length: 225.154 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR12917566.ke.tsv 34699 SRR12917566.se.tsv 87100 total ==> SRR12917566.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.85 277 14.0524 Potri.005G024800.1.v4.1 1035 810.846 74 8.3052 Potri.004G059700.1.v4.1 961 736.999 49 6.05042 Potri.007G009000.2.v4.1 1416 1191.85 0 0 Potri.003G141000.2.v4.1 2943 2718.85 496 16.6017 Potri.016G087400.1.v4.1 270 103.774 686 601.577 Potri.015G069301.1.v4.1 564 351.449 0 0 Potri.010G195200.1.v4.1 1773 1548.85 0 0 Potri.012G127500.1.v4.1 977 752.935 523 63.2122 ==> SRR12917566.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 244 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 121 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12917566 completed mapping pipeline successfully