Starting /dee2/code/volunteer_pipeline.sh SRR12917567 current disk space = 3089348100096 free memory = 1572488616 SRR12917567 SRAfilesize 0bc88435f79b778ab455bd2a9c8c336c SRR12917567.sra SRR12917567.sra file validated SRR12917567 is paired end SRR12917567 is conventional basespace SRR12917567 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917567_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5865 37.0 37.0 37.0 37.0 37.0 2 36.5325 37.0 37.0 37.0 37.0 37.0 3 36.6075 37.0 37.0 37.0 37.0 37.0 4 36.663 37.0 37.0 37.0 37.0 37.0 5 36.653 37.0 37.0 37.0 37.0 37.0 6 36.6515 37.0 37.0 37.0 37.0 37.0 7 36.535 37.0 37.0 37.0 37.0 37.0 8 36.6625 37.0 37.0 37.0 37.0 37.0 9 36.694 37.0 37.0 37.0 37.0 37.0 10-14 36.6249 37.0 37.0 37.0 37.0 37.0 15-19 36.6393 37.0 37.0 37.0 37.0 37.0 20-24 36.5778 37.0 37.0 37.0 37.0 37.0 25-29 36.5634 37.0 37.0 37.0 37.0 37.0 30-34 36.5414 37.0 37.0 37.0 37.0 37.0 35-39 36.5125 37.0 37.0 37.0 37.0 37.0 40-44 36.5204 37.0 37.0 37.0 37.0 37.0 45-49 36.462 37.0 37.0 37.0 37.0 37.0 50-54 36.4526 37.0 37.0 37.0 37.0 37.0 55-59 36.453799999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.4445 37.0 37.0 37.0 37.0 37.0 65-69 36.2829 37.0 37.0 37.0 37.0 37.0 70-74 36.3914 37.0 37.0 37.0 37.0 37.0 75-79 36.3577 37.0 37.0 37.0 37.0 37.0 80-84 36.3491 37.0 37.0 37.0 37.0 37.0 85-89 36.3232 37.0 37.0 37.0 37.0 37.0 90-94 36.3117 37.0 37.0 37.0 37.0 37.0 95-99 36.2442 37.0 37.0 37.0 37.0 37.0 100-104 36.209199999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1399 37.0 37.0 37.0 37.0 37.0 110-114 36.2065 37.0 37.0 37.0 37.0 37.0 115-119 36.103899999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.07959999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.9736 37.0 37.0 37.0 37.0 37.0 130-134 35.8935 37.0 37.0 37.0 37.0 37.0 135-139 35.858799999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.7213 37.0 37.0 37.0 37.0 37.0 145-149 35.64790000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.34025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 1.0 25 0.0 26 4.0 27 2.0 28 14.0 29 8.0 30 30.0 31 27.0 32 43.0 33 72.0 34 114.0 35 333.0 36 3001.0 37 348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.467467467467465 12.362362362362363 6.481481481481481 38.688688688688686 2 20.325 13.25 36.225 30.2 3 18.0 16.2 26.950000000000003 38.85 4 22.575 22.625 24.099999999999998 30.7 5 24.2 28.7 25.1 22.0 6 22.175 34.25 22.525000000000002 21.05 7 14.975 27.750000000000004 40.725 16.55 8 17.349999999999998 25.2 34.225 23.225 9 17.65 23.849999999999998 34.925 23.575 10-14 19.91 29.885 27.389999999999997 22.814999999999998 15-19 20.005 28.144999999999996 27.815 24.035 20-24 20.005 27.925 28.065 24.005000000000003 25-29 20.09 28.134999999999998 27.71 24.065 30-34 20.36 28.249999999999996 27.825 23.565 35-39 21.085 28.025 27.450000000000003 23.44 40-44 20.14 28.744999999999997 26.955000000000002 24.16 45-49 20.775 27.939999999999998 27.54 23.745 50-54 20.61 27.77 28.08 23.54 55-59 20.555 27.815 27.865000000000002 23.765 60-64 20.41 28.560000000000002 27.474999999999998 23.555 65-69 20.925 28.025 27.395000000000003 23.655 70-74 21.2 28.389999999999997 27.084999999999997 23.325000000000003 75-79 21.305 27.200000000000003 28.005000000000003 23.49 80-84 20.945 27.96 27.91 23.185 85-89 20.455000000000002 28.34 27.555000000000003 23.65 90-94 21.245 28.000000000000004 26.865 23.89 95-99 21.195 28.095 27.61 23.1 100-104 21.925 28.175 26.56 23.34 105-109 21.175 28.355000000000004 27.205000000000002 23.265 110-114 20.465 28.689999999999998 26.805 24.04 115-119 20.880000000000003 28.73 26.584999999999997 23.805 120-124 21.065 28.18 26.179999999999996 24.575 125-129 21.015 28.110000000000003 26.845000000000002 24.03 130-134 21.235 28.475 26.455000000000002 23.835 135-139 21.740000000000002 27.87 25.845000000000002 24.545 140-144 21.895 28.08 25.88 24.145 145-149 21.555 27.705000000000002 26.27 24.47 150-151 21.3625 28.6375 25.662499999999998 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 3.5 25 4.5 26 6.5 27 10.0 28 11.0 29 12.5 30 14.0 31 16.5 32 20.0 33 34.5 34 55.5 35 69.0 36 82.0 37 97.0 38 129.0 39 160.5 40 181.5 41 198.5 42 215.5 43 238.0 44 253.0 45 246.5 46 245.0 47 251.0 48 235.5 49 214.0 50 191.5 51 167.5 52 124.5 53 99.5 54 95.0 55 71.5 56 59.0 57 54.5 58 36.0 59 26.0 60 26.0 61 16.0 62 7.5 63 3.5 64 1.5 65 2.5 66 2.5 67 2.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.9 #Duplication Level Percentage of deduplicated Percentage of total 1 93.21851453175456 86.6 2 6.135629709364909 11.4 3 0.5382131324004306 1.5 4 0.08073196986006459 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026910656620021525 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTTCAATAGAGAGGGTGCATATCTAGCTGCAGCAGTGGAAAGAACACCA 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.6625000000000001 0.0 0.0 0.0 0.0 82-83 0.875 0.0 0.0 0.0 0.0 84-85 1.0750000000000002 0.0 0.0 0.0 0.0 86-87 1.3125 0.0 0.0 0.0 0.0 88-89 1.6375000000000002 0.0 0.0 0.0 0.0 90-91 1.7875 0.0 0.0 0.0 0.0 92-93 1.9874999999999998 0.0 0.0 0.0 0.0 94-95 2.35 0.0 0.0 0.0 0.0 96-97 2.675 0.0 0.0 0.0 0.0 98-99 2.95 0.0 0.0 0.0 0.0 100-101 3.3625 0.0 0.0 0.0 0.0 102-103 3.75 0.0 0.0 0.0 0.0 104-105 4.0625 0.0 0.0 0.0 0.0 106-107 4.574999999999999 0.0 0.0 0.0 0.0 108-109 5.0625 0.0 0.0 0.0 0.0 110-111 5.5875 0.0 0.0 0.0 0.0 112-113 6.0625 0.0 0.0 0.0 0.0 114-115 6.525 0.0 0.0 0.0 0.0 116-117 6.987500000000001 0.0 0.0 0.0 0.0 118-119 7.625 0.0 0.0 0.0 0.0 120-121 8.175 0.0 0.0 0.0 0.0 122-123 8.7375 0.0 0.0 0.0 0.0 124-125 9.524999999999999 0.0 0.0 0.0 0.0 126-127 10.337499999999999 0.0 0.0 0.0 0.0 128-129 11.25 0.0125 0.0 0.0 0.0 130-131 11.875 0.025 0.0 0.0 0.0 132-133 12.7 0.025 0.0 0.0 0.0 134-135 13.725 0.025 0.0 0.0 0.0 136-137 14.5875 0.025 0.0 0.0 0.0 138-139 15.225000000000001 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCAAAG 10 0.006830828 145.0 2 AAAAAAA 40 0.0076550315 18.125 20-24 >>END_MODULE SRR12917567 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917567_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4665 37.0 37.0 37.0 37.0 37.0 2 36.2825 37.0 37.0 37.0 37.0 37.0 3 36.44 37.0 37.0 37.0 37.0 37.0 4 36.3905 37.0 37.0 37.0 37.0 37.0 5 36.452 37.0 37.0 37.0 37.0 37.0 6 36.425 37.0 37.0 37.0 37.0 37.0 7 36.408 37.0 37.0 37.0 37.0 37.0 8 36.601 37.0 37.0 37.0 37.0 37.0 9 36.4775 37.0 37.0 37.0 37.0 37.0 10-14 36.459199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.4529 37.0 37.0 37.0 37.0 37.0 20-24 36.388400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.2841 37.0 37.0 37.0 37.0 37.0 30-34 36.2376 37.0 37.0 37.0 37.0 37.0 35-39 36.1993 37.0 37.0 37.0 37.0 37.0 40-44 36.1831 37.0 37.0 37.0 37.0 37.0 45-49 36.1558 37.0 37.0 37.0 37.0 37.0 50-54 36.168099999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.158300000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.1556 37.0 37.0 37.0 37.0 37.0 65-69 36.1399 37.0 37.0 37.0 37.0 37.0 70-74 36.0769 37.0 37.0 37.0 37.0 37.0 75-79 36.0772 37.0 37.0 37.0 37.0 37.0 80-84 36.0182 37.0 37.0 37.0 37.0 37.0 85-89 36.0626 37.0 37.0 37.0 37.0 37.0 90-94 36.0531 37.0 37.0 37.0 37.0 37.0 95-99 36.0113 37.0 37.0 37.0 37.0 37.0 100-104 35.9736 37.0 37.0 37.0 37.0 37.0 105-109 35.907 37.0 37.0 37.0 37.0 37.0 110-114 35.88190000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.8352 37.0 37.0 37.0 37.0 37.0 120-124 35.74720000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.5742 37.0 37.0 37.0 37.0 37.0 130-134 35.4144 37.0 37.0 37.0 37.0 37.0 135-139 35.371 37.0 37.0 37.0 37.0 37.0 140-144 35.1097 37.0 37.0 37.0 27.4 37.0 145-149 34.9137 37.0 37.0 37.0 27.4 37.0 150-151 34.530249999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 4.0 16 2.0 17 0.0 18 3.0 19 2.0 20 1.0 21 8.0 22 2.0 23 3.0 24 2.0 25 5.0 26 2.0 27 10.0 28 9.0 29 12.0 30 22.0 31 34.0 32 58.0 33 96.0 34 202.0 35 491.0 36 2768.0 37 260.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.400000000000006 24.0 8.799999999999999 26.8 2 26.875 25.6 30.9 16.625 3 20.849999999999998 26.3 33.75 19.1 4 23.9 32.425 24.025 19.650000000000002 5 26.55 36.025 21.224999999999998 16.2 6 20.674999999999997 39.15 22.575 17.599999999999998 7 20.875 22.15 38.574999999999996 18.4 8 20.225 25.124999999999996 28.65 26.0 9 22.725 23.625 29.375 24.275 10-14 23.36 28.825 26.540000000000003 21.275 15-19 23.395 27.72 27.54 21.345 20-24 23.175 28.62 27.150000000000002 21.055 25-29 23.235 27.675 27.85 21.240000000000002 30-34 22.96 27.51 27.97 21.560000000000002 35-39 23.525 27.74 27.675 21.060000000000002 40-44 23.585 27.794999999999998 27.905 20.715 45-49 23.01 27.49 28.24 21.26 50-54 23.515 27.77 27.105 21.61 55-59 22.875 27.339999999999996 28.115000000000002 21.67 60-64 23.119999999999997 27.544999999999998 27.49 21.845 65-69 23.674999999999997 27.63 27.02 21.675 70-74 23.26 27.474999999999998 27.310000000000002 21.955 75-79 23.615 27.245 26.945000000000004 22.195 80-84 23.34 28.000000000000004 27.115000000000002 21.545 85-89 23.815 27.800000000000004 27.16 21.224999999999998 90-94 23.76 28.43 26.575 21.235 95-99 23.96 27.975 27.08 20.985 100-104 23.669999999999998 28.185 27.11 21.035 105-109 24.0 27.860000000000003 27.245 20.895 110-114 24.665 27.68 27.235 20.419999999999998 115-119 25.615 27.705000000000002 26.235000000000003 20.445 120-124 25.36 28.115000000000002 26.334999999999997 20.19 125-129 26.015 28.084999999999997 26.474999999999998 19.425 130-134 26.06 27.884999999999998 26.305 19.75 135-139 26.495 27.595 25.564999999999998 20.345 140-144 27.61 27.355 25.775 19.259999999999998 145-149 27.855 27.075 25.569999999999997 19.5 150-151 27.737499999999997 27.4125 25.837500000000002 19.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 0.5 22 0.0 23 2.5 24 3.0 25 1.5 26 1.5 27 2.0 28 7.0 29 12.0 30 11.5 31 14.5 32 23.0 33 26.5 34 38.5 35 59.5 36 73.5 37 96.5 38 127.5 39 144.0 40 171.5 41 199.5 42 241.5 43 266.5 44 267.0 45 287.5 46 291.5 47 260.0 48 230.5 49 212.0 50 172.5 51 145.5 52 129.5 53 112.5 54 94.5 55 68.5 56 50.5 57 34.5 58 27.0 59 25.0 60 16.0 61 11.5 62 9.0 63 5.0 64 0.5 65 0.5 66 0.5 67 0.5 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.5 96 1.0 97 0.5 98 1.0 99 1.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.425 #Duplication Level Percentage of deduplicated Percentage of total 1 93.29185826345686 86.225 2 5.977819853935624 11.05 3 0.4598322964565864 1.275 4 0.1352447930754666 0.5 5 0.027048958615093318 0.125 6 0.027048958615093318 0.15 7 0.0 0.0 8 0.027048958615093318 0.2 9 0.027048958615093318 0.22499999999999998 >10 0.027048958615093318 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit ATGATTACAAACCCTTCCCAGGGAAGCCAGAGGCCGATGTTGTTGTTATT 6 0.15 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.3125 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.6625000000000001 0.0 0.0 0.0 0.0 82-83 0.8875 0.0 0.0 0.0 0.0 84-85 1.1 0.0 0.0 0.0 0.0 86-87 1.3375 0.0 0.0 0.0 0.0 88-89 1.6625 0.0 0.0 0.0 0.0 90-91 1.8125 0.0 0.0 0.0 0.0 92-93 2.0125 0.0 0.0 0.0 0.0 94-95 2.375 0.0 0.0 0.0 0.0 96-97 2.7 0.0 0.0 0.0 0.0 98-99 2.9875 0.0 0.0 0.0 0.0 100-101 3.4124999999999996 0.0 0.0 0.0 0.0 102-103 3.8125 0.0 0.0 0.0 0.0 104-105 4.1375 0.0 0.0 0.0 0.0 106-107 4.65 0.0 0.0 0.0 0.0 108-109 5.1625 0.0 0.0 0.0 0.0 110-111 5.6875 0.0 0.0 0.0 0.0 112-113 6.1625 0.0 0.0 0.0 0.0 114-115 6.625 0.0 0.0 0.0 0.0 116-117 7.112500000000001 0.0 0.0 0.0 0.0 118-119 7.762499999999999 0.0 0.0 0.0 0.0 120-121 8.325 0.0 0.0 0.0 0.0 122-123 8.8875 0.0 0.0 0.0 0.0 124-125 9.675 0.0 0.0 0.0 0.0 126-127 10.4875 0.0 0.0 0.0 0.0 128-129 11.425 0.0 0.0 0.0 0.0 130-131 12.0625 0.0 0.0 0.0 0.0 132-133 12.875 0.0 0.0 0.0 0.0 134-135 13.9 0.0 0.0 0.0 0.0 136-137 14.7875 0.0 0.0 0.0 0.0 138-139 15.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGAGA 20 0.00593511 29.0 20-24 >>END_MODULE Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594865 spots for SRR12917567.sra Written 594865 spots for SRR12917567.sra Read 594879 spots for SRR12917567.sra Written 594879 spots for SRR12917567.sra SRR ids: ['SRR12917567.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_85h0ltlt SRR12917567.sra spots: 11897314 blocks: [[1, 594865], [594866, 1189730], [1189731, 1784595], [1784596, 2379460], [2379461, 2974325], [2974326, 3569190], [3569191, 4164055], [4164056, 4758920], [4758921, 5353785], [5353786, 5948650], [5948651, 6543515], [6543516, 7138380], [7138381, 7733245], [7733246, 8328110], [8328111, 8922975], [8922976, 9517840], [9517841, 10112705], [10112706, 10707570], [10707571, 11302435], [11302436, 11897314]] SRR12917567 file size 4021527 SRR12917567 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917567 SRR12917567_1.fastq SRR12917567_2.fastq Input file: SRR12917567_1.fastq Paired file: SRR12917567_2.fastq trimmed: SRR12917567-trimmed-pair1.fastq, SRR12917567-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:51:32 2025 >> started Thu Feb 13 14:51:45 2025 >> done (12.126s) 11897314 read pairs processed; of these: 76 ( 0.00%) short read pairs filtered out after trimming by size control 2772 ( 0.02%) empty read pairs filtered out after trimming by size control 11894466 (99.98%) read pairs available; of these: 2396059 (20.14%) trimmed read pairs available after processing 9498407 (79.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 6 0.00% 21 6 0.00% 22 9 0.00% 23 14 0.00% 24 13 0.00% 25 5 0.00% 26 13 0.00% 27 7 0.00% 28 9 0.00% 29 17 0.00% 30 9 0.00% 31 16 0.00% 32 10 0.00% 33 19 0.00% 34 16 0.00% 35 29 0.00% 36 21 0.00% 37 22 0.00% 38 27 0.00% 39 30 0.00% 40 21 0.00% 41 37 0.00% 42 32 0.00% 43 38 0.00% 44 48 0.00% 45 39 0.00% 46 62 0.00% 47 88 0.00% 48 87 0.00% 49 110 0.00% 50 125 0.00% 51 179 0.00% 52 186 0.00% 53 190 0.00% 54 211 0.00% 55 254 0.00% 56 322 0.00% 57 347 0.00% 58 409 0.00% 59 475 0.00% 60 583 0.00% 61 778 0.01% 62 856 0.01% 63 1033 0.01% 64 1128 0.01% 65 1284 0.01% 66 1475 0.01% 67 1660 0.01% 68 1736 0.01% 69 2165 0.02% 70 2362 0.02% 71 2724 0.02% 72 3310 0.03% 73 3726 0.03% 74 4178 0.04% 75 4686 0.04% 76 5031 0.04% 77 5526 0.05% 78 6052 0.05% 79 6541 0.05% 80 7042 0.06% 81 7948 0.07% 82 8731 0.07% 83 9466 0.08% 84 10549 0.09% 85 11424 0.10% 86 12084 0.10% 87 12801 0.11% 88 13498 0.11% 89 13770 0.12% 90 14734 0.12% 91 15349 0.13% 92 16169 0.14% 93 17431 0.15% 94 18423 0.15% 95 20048 0.17% 96 20692 0.17% 97 22025 0.19% 98 22152 0.19% 99 22496 0.19% 100 23315 0.20% 101 23815 0.20% 102 24865 0.21% 103 25746 0.22% 104 26523 0.22% 105 27742 0.23% 106 28534 0.24% 107 29637 0.25% 108 30377 0.26% 109 30869 0.26% 110 30824 0.26% 111 31751 0.27% 112 32373 0.27% 113 32227 0.27% 114 33907 0.29% 115 34940 0.29% 116 36154 0.30% 117 37741 0.32% 118 37914 0.32% 119 38388 0.32% 120 39135 0.33% 121 39326 0.33% 122 39432 0.33% 123 39449 0.33% 124 40701 0.34% 125 40608 0.34% 126 42943 0.36% 127 43609 0.37% 128 43627 0.37% 129 44766 0.38% 130 44790 0.38% 131 44554 0.37% 132 44905 0.38% 133 45258 0.38% 134 45224 0.38% 135 45913 0.39% 136 46556 0.39% 137 46277 0.39% 138 47889 0.40% 139 49262 0.41% 140 48676 0.41% 141 48995 0.41% 142 48938 0.41% 143 48579 0.41% 144 49604 0.42% 145 49327 0.41% 146 49303 0.41% 147 50020 0.42% 148 50860 0.43% 149 50648 0.43% 150 52004 0.44% 151 9498407 79.86% 11894466 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=16 prefix-density=0.69 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=109.36 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=10.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=22 prefix-density=0.76 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=68.89 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=2.6 sequence=AGGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12917567 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:52:25 Started mapping on | Feb 13 14:52:25 Finished on | Feb 13 14:53:47 Mapping speed, Million of reads per hour | 522.20 Number of input reads | 11894466 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11214098 Uniquely mapped reads % | 94.28% Average mapped length | 289.04 Number of splices: Total | 10824182 Number of splices: Annotated (sjdb) | 10591164 Number of splices: GT/AG | 10588413 Number of splices: GC/AG | 187754 Number of splices: AT/AC | 7697 Number of splices: Non-canonical | 40318 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269343 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 48507 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 411025 411025 411025 N_multimapping 269343 269343 269343 N_noFeature 389189 11015877 464066 N_ambiguous 189573 725 65811 UnstrandedReadsAssigned:10635336 PositiveStrandReadsAssigned:197496 NegativeStrandReadsAssigned:10684221 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917567 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917567-trimmed-pair1.fastq SRR12917567-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,894,466 reads, 10,695,764 reads pseudoaligned [quant] estimated average fragment length: 229.657 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,007 rounds 52401 SRR12917567.ke.tsv 34699 SRR12917567.se.tsv 87100 total ==> SRR12917567.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.34 184 8.28802 Potri.005G024800.1.v4.1 1035 806.343 148 14.7934 Potri.004G059700.1.v4.1 961 732.454 28 3.08109 Potri.007G009000.2.v4.1 1416 1187.34 0 0 Potri.003G141000.2.v4.1 2943 2714.34 550 16.3314 Potri.016G087400.1.v4.1 270 100.427 520 417.329 Potri.015G069301.1.v4.1 564 346.781 0 0 Potri.010G195200.1.v4.1 1773 1544.34 23 1.20036 Potri.012G127500.1.v4.1 977 748.394 129 13.8927 ==> SRR12917567.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 105 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 140 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR12917567 completed mapping pipeline successfully