Starting /dee2/code/volunteer_pipeline.sh SRR12917569 current disk space = 3089830432768 free memory = 1427143976 SRR12917569 SRAfilesize 8f1e5e4c36747cc7ca43ffa9d363bad6 SRR12917569.sra SRR12917569.sra file validated SRR12917569 is paired end SRR12917569 is conventional basespace SRR12917569 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917569_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5375 37.0 37.0 37.0 37.0 37.0 2 36.526 37.0 37.0 37.0 37.0 37.0 3 36.6145 37.0 37.0 37.0 37.0 37.0 4 36.6955 37.0 37.0 37.0 37.0 37.0 5 36.6715 37.0 37.0 37.0 37.0 37.0 6 36.6745 37.0 37.0 37.0 37.0 37.0 7 36.5105 37.0 37.0 37.0 37.0 37.0 8 36.584 37.0 37.0 37.0 37.0 37.0 9 36.6655 37.0 37.0 37.0 37.0 37.0 10-14 36.6111 37.0 37.0 37.0 37.0 37.0 15-19 36.6005 37.0 37.0 37.0 37.0 37.0 20-24 36.5872 37.0 37.0 37.0 37.0 37.0 25-29 36.5719 37.0 37.0 37.0 37.0 37.0 30-34 36.561899999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.5222 37.0 37.0 37.0 37.0 37.0 40-44 36.5086 37.0 37.0 37.0 37.0 37.0 45-49 36.461400000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.47690000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.400999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.4112 37.0 37.0 37.0 37.0 37.0 65-69 36.3021 37.0 37.0 37.0 37.0 37.0 70-74 36.3577 37.0 37.0 37.0 37.0 37.0 75-79 36.345800000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.315200000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.327 37.0 37.0 37.0 37.0 37.0 90-94 36.3409 37.0 37.0 37.0 37.0 37.0 95-99 36.2445 37.0 37.0 37.0 37.0 37.0 100-104 36.2178 37.0 37.0 37.0 37.0 37.0 105-109 36.147299999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.138600000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1267 37.0 37.0 37.0 37.0 37.0 120-124 36.1611 37.0 37.0 37.0 37.0 37.0 125-129 35.976600000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.951800000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.9467 37.0 37.0 37.0 37.0 37.0 140-144 35.7763 37.0 37.0 37.0 37.0 37.0 145-149 35.7538 37.0 37.0 37.0 37.0 37.0 150-151 35.585 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 0.0 22 1.0 23 0.0 24 1.0 25 1.0 26 3.0 27 4.0 28 13.0 29 12.0 30 19.0 31 30.0 32 35.0 33 64.0 34 119.0 35 324.0 36 3032.0 37 340.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.0 12.525 5.175 43.3 2 16.725 11.65 40.75 30.875000000000004 3 15.9 14.75 29.775000000000002 39.574999999999996 4 20.45 21.525 25.45 32.574999999999996 5 22.900000000000002 29.925 25.575 21.6 6 20.075000000000003 33.2 23.125 23.599999999999998 7 16.025 28.575 39.225 16.175 8 16.125 24.9 34.325 24.65 9 16.875 22.525000000000002 37.925 22.675 10-14 19.63 29.32 28.235 22.814999999999998 15-19 19.950000000000003 27.675 27.965 24.41 20-24 19.74 27.96 28.595 23.705000000000002 25-29 19.785 27.58 28.32 24.315 30-34 19.905 28.79 27.155 24.15 35-39 20.01 27.99 27.52 24.48 40-44 19.869999999999997 28.044999999999998 27.91 24.175 45-49 20.66 27.665 27.54 24.135 50-54 20.3 28.065 27.595 24.04 55-59 19.885 28.599999999999998 27.71 23.805 60-64 20.76 28.065 27.474999999999998 23.7 65-69 20.18 28.189999999999998 28.015 23.615 70-74 20.375 28.360000000000003 27.455000000000002 23.810000000000002 75-79 20.05 28.04 27.560000000000002 24.349999999999998 80-84 20.369999999999997 28.349999999999998 27.650000000000002 23.630000000000003 85-89 20.46 28.265 27.975 23.3 90-94 20.53 28.754999999999995 26.915 23.799999999999997 95-99 20.515 28.17 27.27 24.044999999999998 100-104 21.099999999999998 28.375 27.235 23.29 105-109 20.905 28.375 27.295 23.425 110-114 20.625 27.975 27.76 23.64 115-119 20.830000000000002 27.860000000000003 27.800000000000004 23.51 120-124 20.955 27.51 27.85 23.685000000000002 125-129 21.349999999999998 28.060000000000002 27.389999999999997 23.200000000000003 130-134 21.37 27.93 27.11 23.59 135-139 21.665 28.854999999999997 26.645000000000003 22.835 140-144 21.895 27.61 27.52 22.975 145-149 22.105 27.67 26.685 23.54 150-151 22.2 26.900000000000002 27.2625 23.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 0.5 21 0.5 22 0.5 23 1.0 24 5.0 25 6.0 26 4.5 27 8.5 28 8.0 29 9.0 30 14.0 31 26.0 32 35.0 33 37.0 34 51.0 35 64.0 36 68.0 37 90.0 38 127.5 39 155.0 40 191.5 41 209.5 42 227.0 43 253.0 44 270.0 45 262.5 46 258.5 47 254.0 48 230.5 49 206.0 50 180.0 51 163.0 52 128.5 53 101.0 54 84.0 55 71.5 56 55.5 57 38.5 58 28.0 59 24.5 60 16.0 61 4.0 62 6.5 63 7.5 64 4.0 65 3.0 66 2.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.25 #Duplication Level Percentage of deduplicated Percentage of total 1 91.67123287671232 83.65 2 7.397260273972603 13.5 3 0.684931506849315 1.875 4 0.1917808219178082 0.7000000000000001 5 0.0273972602739726 0.125 6 0.0273972602739726 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCATGTTACTCACCTGACTTTGCCATTGACTAAAACTATTTACGCTGAA 6 0.15 No Hit GCCCGACCCTTTATCGGTGACAACATAGGCAAAGATGATGAACCCTAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.7125 0.0 0.0 0.0 0.0 124-125 3.9625 0.0 0.0 0.0 0.0 126-127 4.449999999999999 0.0 0.0 0.0 0.0 128-129 4.875 0.0 0.0 0.0 0.0 130-131 5.325 0.0 0.0 0.0 0.0 132-133 5.775 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.6375 0.0 0.0 0.0 0.0 138-139 7.012499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGACA 10 0.006830828 145.0 2 >>END_MODULE SRR12917569 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917569_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4355 37.0 37.0 37.0 37.0 37.0 2 36.312 37.0 37.0 37.0 37.0 37.0 3 36.408 37.0 37.0 37.0 37.0 37.0 4 36.462 37.0 37.0 37.0 37.0 37.0 5 36.4765 37.0 37.0 37.0 37.0 37.0 6 36.355 37.0 37.0 37.0 37.0 37.0 7 36.3365 37.0 37.0 37.0 37.0 37.0 8 36.472 37.0 37.0 37.0 37.0 37.0 9 36.4655 37.0 37.0 37.0 37.0 37.0 10-14 36.4749 37.0 37.0 37.0 37.0 37.0 15-19 36.422900000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.4007 37.0 37.0 37.0 37.0 37.0 25-29 36.28339999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.24980000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.196600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.2024 37.0 37.0 37.0 37.0 37.0 45-49 36.1353 37.0 37.0 37.0 37.0 37.0 50-54 36.144600000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.1082 37.0 37.0 37.0 37.0 37.0 60-64 36.1036 37.0 37.0 37.0 37.0 37.0 65-69 36.0834 37.0 37.0 37.0 37.0 37.0 70-74 36.106700000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.993 37.0 37.0 37.0 37.0 37.0 80-84 36.0598 37.0 37.0 37.0 37.0 37.0 85-89 36.0393 37.0 37.0 37.0 37.0 37.0 90-94 36.0353 37.0 37.0 37.0 37.0 37.0 95-99 36.00840000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.8968 37.0 37.0 37.0 37.0 37.0 105-109 35.923500000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.9588 37.0 37.0 37.0 37.0 37.0 115-119 35.8591 37.0 37.0 37.0 37.0 37.0 120-124 35.76350000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.6977 37.0 37.0 37.0 37.0 37.0 130-134 35.6832 37.0 37.0 37.0 37.0 37.0 135-139 35.5722 37.0 37.0 37.0 37.0 37.0 140-144 35.3597 37.0 37.0 37.0 34.6 37.0 145-149 35.2829 37.0 37.0 37.0 32.2 37.0 150-151 34.932500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 2.0 17 1.0 18 1.0 19 0.0 20 2.0 21 0.0 22 4.0 23 1.0 24 5.0 25 3.0 26 4.0 27 9.0 28 12.0 29 16.0 30 14.0 31 32.0 32 59.0 33 97.0 34 173.0 35 543.0 36 2833.0 37 186.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.075 27.750000000000004 7.8 29.375 2 26.35 26.05 33.5 14.099999999999998 3 19.2 27.0 34.175 19.625 4 21.925 33.775 25.025 19.275000000000002 5 26.375 37.75 20.325 15.55 6 20.150000000000002 41.525 21.4 16.925 7 20.1 23.225 37.8 18.875 8 19.125 26.775 30.0 24.099999999999998 9 21.075 25.15 30.4 23.375 10-14 22.685 29.81 26.045 21.46 15-19 23.02 28.57 27.195000000000004 21.215 20-24 22.99 28.105000000000004 27.79 21.115000000000002 25-29 22.689999999999998 28.175 27.58 21.555 30-34 22.66 28.310000000000002 27.445000000000004 21.584999999999997 35-39 22.865 27.76 27.37 22.005 40-44 22.66 28.27 28.005000000000003 21.065 45-49 22.42 27.625 28.16 21.795 50-54 22.900000000000002 27.605 27.725 21.77 55-59 22.67 27.855 27.735 21.740000000000002 60-64 22.865 27.21 27.615000000000002 22.31 65-69 22.91 27.615000000000002 27.425 22.05 70-74 23.375 28.025 27.22 21.38 75-79 23.285 27.755000000000003 27.384999999999998 21.575 80-84 23.415 27.96 27.544999999999998 21.08 85-89 23.5 27.29 27.43 21.78 90-94 23.305 27.555000000000003 27.6 21.54 95-99 23.515 27.555000000000003 27.400000000000002 21.529999999999998 100-104 24.05 28.294999999999998 26.99 20.665 105-109 24.385 27.985 26.939999999999998 20.69 110-114 24.025 28.01 27.35 20.615 115-119 24.005000000000003 28.375 27.589999999999996 20.03 120-124 24.36 27.810000000000002 27.07 20.76 125-129 24.529999999999998 28.425 26.179999999999996 20.865000000000002 130-134 24.945 27.79 27.034999999999997 20.23 135-139 24.255 27.744999999999997 27.189999999999998 20.810000000000002 140-144 26.11 27.705000000000002 26.31 19.875 145-149 26.27 27.46 26.529999999999998 19.74 150-151 25.525 28.775000000000002 25.937500000000004 19.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 1.5 26 4.0 27 6.5 28 10.0 29 15.0 30 17.0 31 18.0 32 24.5 33 35.5 34 43.5 35 52.5 36 74.5 37 103.5 38 127.5 39 177.0 40 208.0 41 216.5 42 236.5 43 261.0 44 282.0 45 278.0 46 261.5 47 245.0 48 225.0 49 207.0 50 179.0 51 141.5 52 120.5 53 92.0 54 71.5 55 60.0 56 41.0 57 35.0 58 29.0 59 19.5 60 17.0 61 15.0 62 10.0 63 5.0 64 3.0 65 3.5 66 3.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.5 97 1.0 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.9 #Duplication Level Percentage of deduplicated Percentage of total 1 91.44664466446645 83.125 2 7.453245324532453 13.55 3 0.8525852585258527 2.325 4 0.16501650165016502 0.6 5 0.055005500550055 0.25 6 0.0275027502750275 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATGATTTATTTTTCTTTTATTTAGTCAACTTCTTGTGTGTTTCGTTGGC 6 0.15 No Hit AGAGAAACAGAGAAAGATCAACCATGAGATCTAGCAATCACTTGATAGGG 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 2.8 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.425000000000001 0.0 0.0 0.0 0.0 128-129 4.875 0.0 0.0 0.0 0.0 130-131 5.3 0.0 0.0 0.0 0.0 132-133 5.75 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.6375 0.0 0.0 0.0 0.0 138-139 7.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622408 spots for SRR12917569.sra Written 622408 spots for SRR12917569.sra Read 622409 spots for SRR12917569.sra Written 622409 spots for SRR12917569.sra SRR ids: ['SRR12917569.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2uj8ohh_ SRR12917569.sra spots: 12448161 blocks: [[1, 622408], [622409, 1244816], [1244817, 1867224], [1867225, 2489632], [2489633, 3112040], [3112041, 3734448], [3734449, 4356856], [4356857, 4979264], [4979265, 5601672], [5601673, 6224080], [6224081, 6846488], [6846489, 7468896], [7468897, 8091304], [8091305, 8713712], [8713713, 9336120], [9336121, 9958528], [9958529, 10580936], [10580937, 11203344], [11203345, 11825752], [11825753, 12448161]] SRR12917569 file size 4208729 SRR12917569 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917569 SRR12917569_1.fastq SRR12917569_2.fastq Input file: SRR12917569_1.fastq Paired file: SRR12917569_2.fastq trimmed: SRR12917569-trimmed-pair1.fastq, SRR12917569-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:25:17 2025 >> started Thu Feb 13 14:25:30 2025 >> done (13.231s) 12448161 read pairs processed; of these: 114 ( 0.00%) short read pairs filtered out after trimming by size control 416 ( 0.00%) empty read pairs filtered out after trimming by size control 12447631 (100.00%) read pairs available; of these: 1411677 (11.34%) trimmed read pairs available after processing 11035954 (88.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 12 0.00% 20 8 0.00% 21 8 0.00% 22 9 0.00% 23 15 0.00% 24 22 0.00% 25 12 0.00% 26 19 0.00% 27 13 0.00% 28 17 0.00% 29 17 0.00% 30 12 0.00% 31 23 0.00% 32 23 0.00% 33 22 0.00% 34 23 0.00% 35 16 0.00% 36 21 0.00% 37 28 0.00% 38 20 0.00% 39 22 0.00% 40 25 0.00% 41 22 0.00% 42 23 0.00% 43 29 0.00% 44 34 0.00% 45 26 0.00% 46 35 0.00% 47 34 0.00% 48 31 0.00% 49 57 0.00% 50 72 0.00% 51 60 0.00% 52 101 0.00% 53 71 0.00% 54 80 0.00% 55 99 0.00% 56 120 0.00% 57 123 0.00% 58 153 0.00% 59 183 0.00% 60 181 0.00% 61 221 0.00% 62 273 0.00% 63 286 0.00% 64 350 0.00% 65 373 0.00% 66 418 0.00% 67 479 0.00% 68 537 0.00% 69 581 0.00% 70 640 0.01% 71 819 0.01% 72 961 0.01% 73 1136 0.01% 74 1190 0.01% 75 1457 0.01% 76 1552 0.01% 77 1711 0.01% 78 1882 0.02% 79 2005 0.02% 80 2250 0.02% 81 2552 0.02% 82 2663 0.02% 83 3237 0.03% 84 3635 0.03% 85 3879 0.03% 86 4270 0.03% 87 4485 0.04% 88 4775 0.04% 89 4938 0.04% 90 5357 0.04% 91 5832 0.05% 92 6208 0.05% 93 6527 0.05% 94 7266 0.06% 95 7962 0.06% 96 8151 0.07% 97 8831 0.07% 98 9068 0.07% 99 9426 0.08% 100 9845 0.08% 101 10055 0.08% 102 10745 0.09% 103 11388 0.09% 104 12199 0.10% 105 12406 0.10% 106 13567 0.11% 107 13857 0.11% 108 14144 0.11% 109 14924 0.12% 110 15079 0.12% 111 15417 0.12% 112 16250 0.13% 113 16412 0.13% 114 17412 0.14% 115 18167 0.15% 116 18822 0.15% 117 19551 0.16% 118 20689 0.17% 119 21126 0.17% 120 21851 0.18% 121 22241 0.18% 122 22401 0.18% 123 23331 0.19% 124 23993 0.19% 125 24219 0.19% 126 25749 0.21% 127 26836 0.22% 128 27202 0.22% 129 28132 0.23% 130 28975 0.23% 131 29315 0.24% 132 29763 0.24% 133 30332 0.24% 134 30819 0.25% 135 31449 0.25% 136 32032 0.26% 137 32841 0.26% 138 33539 0.27% 139 35365 0.28% 140 35369 0.28% 141 35636 0.29% 142 36272 0.29% 143 36694 0.29% 144 37486 0.30% 145 37788 0.30% 146 38500 0.31% 147 38422 0.31% 148 40376 0.32% 149 40451 0.32% 150 42128 0.34% 151 11035954 88.66% 12447631 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.66 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=12.90 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=4.0 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=24 prefix-density=0.81 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=74.34 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.8 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR12917569 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:26:13 Started mapping on | Feb 13 14:26:13 Finished on | Feb 13 14:27:20 Mapping speed, Million of reads per hour | 668.83 Number of input reads | 12447631 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11892311 Uniquely mapped reads % | 95.54% Average mapped length | 295.33 Number of splices: Total | 11841535 Number of splices: Annotated (sjdb) | 11603629 Number of splices: GT/AG | 11589459 Number of splices: GC/AG | 210096 Number of splices: AT/AC | 8899 Number of splices: Non-canonical | 33081 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.02 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 301686 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 37284 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.62% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 253634 253634 253634 N_multimapping 301686 301686 301686 N_noFeature 399529 11745176 446996 N_ambiguous 169117 621 69122 UnstrandedReadsAssigned:11323665 PositiveStrandReadsAssigned:146514 NegativeStrandReadsAssigned:11376193 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917569 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917569-trimmed-pair1.fastq SRR12917569-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,447,631 reads, 11,374,198 reads pseudoaligned [quant] estimated average fragment length: 253.826 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR12917569.ke.tsv 34699 SRR12917569.se.tsv 87100 total ==> SRR12917569.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.17 219 10.0756 Potri.005G024800.1.v4.1 1035 782.174 127 13.186 Potri.004G059700.1.v4.1 961 708.291 61 6.99411 Potri.007G009000.2.v4.1 1416 1163.17 0 0 Potri.003G141000.2.v4.1 2943 2690.17 474 14.3091 Potri.016G087400.1.v4.1 270 85.5249 587.706 558.061 Potri.015G069301.1.v4.1 564 323.643 0 0 Potri.010G195200.1.v4.1 1773 1520.17 10 0.534221 Potri.012G127500.1.v4.1 977 724.23 389 43.6202 ==> SRR12917569.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 200 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 136 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12917569 completed mapping pipeline successfully