Starting /dee2/code/volunteer_pipeline.sh SRR12917570 current disk space = 3090016755712 free memory = 1408819648 SRR12917570 SRAfilesize e2903c059cb2c15092fdca8868eba3e5 SRR12917570.sra SRR12917570.sra file validated SRR12917570 is paired end SRR12917570 is conventional basespace SRR12917570 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917570_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.58725 37.0 37.0 37.0 37.0 37.0 2 36.5555 37.0 37.0 37.0 37.0 37.0 3 36.595 37.0 37.0 37.0 37.0 37.0 4 36.7175 37.0 37.0 37.0 37.0 37.0 5 36.6115 37.0 37.0 37.0 37.0 37.0 6 36.676 37.0 37.0 37.0 37.0 37.0 7 36.582 37.0 37.0 37.0 37.0 37.0 8 36.611 37.0 37.0 37.0 37.0 37.0 9 36.6665 37.0 37.0 37.0 37.0 37.0 10-14 36.6297 37.0 37.0 37.0 37.0 37.0 15-19 36.6435 37.0 37.0 37.0 37.0 37.0 20-24 36.5848 37.0 37.0 37.0 37.0 37.0 25-29 36.5592 37.0 37.0 37.0 37.0 37.0 30-34 36.500600000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.5213 37.0 37.0 37.0 37.0 37.0 40-44 36.522400000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.424400000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.4859 37.0 37.0 37.0 37.0 37.0 55-59 36.452299999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.3903 37.0 37.0 37.0 37.0 37.0 65-69 36.2945 37.0 37.0 37.0 37.0 37.0 70-74 36.367 37.0 37.0 37.0 37.0 37.0 75-79 36.344500000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3337 37.0 37.0 37.0 37.0 37.0 85-89 36.3173 37.0 37.0 37.0 37.0 37.0 90-94 36.3176 37.0 37.0 37.0 37.0 37.0 95-99 36.2223 37.0 37.0 37.0 37.0 37.0 100-104 36.22099999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.1368 37.0 37.0 37.0 37.0 37.0 110-114 36.1062 37.0 37.0 37.0 37.0 37.0 115-119 36.066 37.0 37.0 37.0 37.0 37.0 120-124 36.118399999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.9713 37.0 37.0 37.0 37.0 37.0 130-134 35.9627 37.0 37.0 37.0 37.0 37.0 135-139 35.887600000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.7927 37.0 37.0 37.0 37.0 37.0 145-149 35.701499999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.543499999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 1.0 24 1.0 25 2.0 26 2.0 27 5.0 28 12.0 29 13.0 30 25.0 31 25.0 32 39.0 33 64.0 34 107.0 35 313.0 36 3076.0 37 313.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.87765824368276 12.859644733550162 6.00450337753315 44.25819364523392 2 17.925 11.600000000000001 39.75 30.725 3 16.475 15.4 27.725 40.400000000000006 4 21.3 22.825 24.2 31.674999999999997 5 24.2 30.55 24.875 20.375 6 20.05 32.875 24.425 22.650000000000002 7 15.275 28.9 38.925 16.900000000000002 8 17.25 26.1 33.975 22.675 9 16.875 23.799999999999997 35.75 23.575 10-14 19.365 30.915 27.650000000000002 22.07 15-19 19.74 28.144999999999996 27.765 24.349999999999998 20-24 19.655 28.835 27.865000000000002 23.645 25-29 19.915 28.865000000000002 28.105000000000004 23.115 30-34 19.485 28.925 27.575 24.015 35-39 19.68 28.499999999999996 28.315 23.505000000000003 40-44 19.64 28.825 27.785 23.75 45-49 19.33 29.054999999999996 28.38 23.235 50-54 19.89 28.43 27.54 24.14 55-59 20.135 27.900000000000002 27.82 24.145 60-64 19.495 28.775000000000002 28.075 23.655 65-69 19.645000000000003 28.29 27.815 24.25 70-74 20.4 28.82 27.1 23.68 75-79 19.115 28.494999999999997 28.34 24.05 80-84 20.424999999999997 28.775000000000002 27.35 23.45 85-89 20.14 28.93 27.505000000000003 23.425 90-94 20.53 28.410000000000004 27.500000000000004 23.56 95-99 20.19 28.794999999999998 27.445000000000004 23.57 100-104 20.5 28.12 27.855 23.525 105-109 20.805 28.335 27.115000000000002 23.745 110-114 20.885 28.144999999999996 27.38 23.59 115-119 20.53 27.92 27.97 23.580000000000002 120-124 20.615 28.26 27.42 23.705000000000002 125-129 20.835 27.415 27.875 23.875 130-134 20.95 28.095 26.855 24.099999999999998 135-139 20.794999999999998 28.62 26.815 23.77 140-144 21.0 27.455000000000002 27.935 23.61 145-149 20.54 27.750000000000004 27.24 24.47 150-151 21.0125 27.437499999999996 27.325 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 2.0 24 2.5 25 3.0 26 4.0 27 4.0 28 6.5 29 11.0 30 25.5 31 31.0 32 31.0 33 50.0 34 65.5 35 78.0 36 95.0 37 131.5 38 156.0 39 165.0 40 174.0 41 192.5 42 226.0 43 256.0 44 268.5 45 265.0 46 255.0 47 244.0 48 231.5 49 198.5 50 167.5 51 145.5 52 120.5 53 91.5 54 81.5 55 68.5 56 40.5 57 32.5 58 27.0 59 18.0 60 13.0 61 7.0 62 3.0 63 1.0 64 1.5 65 2.0 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.525 #Duplication Level Percentage of deduplicated Percentage of total 1 90.05864283719632 80.625 2 8.461323652611002 15.15 3 1.2566322256352975 3.375 4 0.16755096341803966 0.6 5 0.05585032113934655 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCCGATAACCTCATGTATCCGTACGATGTTAGGGTGATGGAGGAGTTTC 5 0.125 No Hit CAATCCACCAGTGGCAAATTTAAGTAGCAAGCAAGCAACAACAGATCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.0875000000000004 0.0 0.0 0.0 0.0 118-119 2.275 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.8625 0.0 0.0 0.0 0.0 132-133 4.324999999999999 0.0 0.0 0.0 0.0 134-135 4.7875 0.0 0.0 0.0 0.0 136-137 5.175000000000001 0.0 0.0 0.0 0.0 138-139 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCAA 10 0.006830828 145.0 2 GACAACA 10 0.006830828 145.0 4 >>END_MODULE SRR12917570 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917570_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36775 37.0 37.0 37.0 37.0 37.0 2 36.3055 37.0 37.0 37.0 37.0 37.0 3 36.2195 37.0 37.0 37.0 37.0 37.0 4 36.3905 37.0 37.0 37.0 37.0 37.0 5 36.4855 37.0 37.0 37.0 37.0 37.0 6 36.341 37.0 37.0 37.0 37.0 37.0 7 36.408 37.0 37.0 37.0 37.0 37.0 8 36.4075 37.0 37.0 37.0 37.0 37.0 9 36.377 37.0 37.0 37.0 37.0 37.0 10-14 36.4317 37.0 37.0 37.0 37.0 37.0 15-19 36.3778 37.0 37.0 37.0 37.0 37.0 20-24 36.3815 37.0 37.0 37.0 37.0 37.0 25-29 36.2575 37.0 37.0 37.0 37.0 37.0 30-34 36.2213 37.0 37.0 37.0 37.0 37.0 35-39 36.147800000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1825 37.0 37.0 37.0 37.0 37.0 45-49 36.111900000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.0336 37.0 37.0 37.0 37.0 37.0 55-59 36.1087 37.0 37.0 37.0 37.0 37.0 60-64 36.06699999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.077 37.0 37.0 37.0 37.0 37.0 70-74 35.97330000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.942 37.0 37.0 37.0 37.0 37.0 80-84 35.968599999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0038 37.0 37.0 37.0 37.0 37.0 90-94 36.0133 37.0 37.0 37.0 37.0 37.0 95-99 35.9206 37.0 37.0 37.0 37.0 37.0 100-104 35.9017 37.0 37.0 37.0 37.0 37.0 105-109 35.806599999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.8361 37.0 37.0 37.0 37.0 37.0 115-119 35.7784 37.0 37.0 37.0 37.0 37.0 120-124 35.717200000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.674899999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.574799999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.510299999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.3469 37.0 37.0 37.0 32.2 37.0 145-149 35.2712 37.0 37.0 37.0 29.8 37.0 150-151 34.813500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 2.0 16 1.0 17 2.0 18 1.0 19 0.0 20 3.0 21 2.0 22 6.0 23 3.0 24 5.0 25 5.0 26 5.0 27 9.0 28 7.0 29 14.0 30 21.0 31 37.0 32 60.0 33 82.0 34 187.0 35 564.0 36 2799.0 37 182.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.80845211302826 24.981245311327832 12.003000750187546 29.207301825456366 2 28.299999999999997 23.974999999999998 31.075000000000003 16.650000000000002 3 20.05 27.3 33.324999999999996 19.325 4 23.05 32.85 23.775 20.325 5 25.5 36.375 21.475 16.650000000000002 6 20.275000000000002 39.15 22.0 18.575 7 22.400000000000002 22.25 37.25 18.099999999999998 8 19.400000000000002 24.875 29.875 25.85 9 19.975 24.275 30.975 24.775 10-14 23.724999999999998 29.26 26.05 20.965 15-19 22.975 27.810000000000002 27.85 21.365000000000002 20-24 23.235 28.375 27.41 20.979999999999997 25-29 22.63 27.744999999999997 28.144999999999996 21.48 30-34 22.595000000000002 27.98 27.74 21.685 35-39 23.080000000000002 28.105000000000004 27.41 21.404999999999998 40-44 22.735 27.889999999999997 27.944999999999997 21.43 45-49 22.235 27.900000000000002 28.265 21.6 50-54 22.805 27.99 28.165000000000003 21.04 55-59 23.385 28.055000000000003 27.500000000000004 21.060000000000002 60-64 23.145 27.425 27.815 21.615000000000002 65-69 22.925 27.77 28.194999999999997 21.11 70-74 23.77 27.634999999999998 27.54 21.055 75-79 23.23 27.74 27.925 21.105 80-84 23.24 28.29 26.935 21.535 85-89 23.724999999999998 28.16 27.295 20.82 90-94 23.575 27.889999999999997 27.36 21.175 95-99 23.474999999999998 28.68 27.16 20.685000000000002 100-104 23.87 27.83 27.365000000000002 20.935000000000002 105-109 23.95 28.03 27.48 20.54 110-114 23.765 28.13 27.750000000000004 20.355 115-119 24.2 27.595 27.46 20.745 120-124 23.74 28.71 26.99 20.560000000000002 125-129 24.34 27.435 27.27 20.955 130-134 24.455 27.775 27.339999999999996 20.43 135-139 23.94 27.67 27.79 20.599999999999998 140-144 25.180000000000003 27.33 27.589999999999996 19.900000000000002 145-149 25.145 27.27 27.82 19.765 150-151 24.837500000000002 27.9125 26.9625 20.2875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 3.0 25 1.5 26 1.5 27 4.5 28 10.0 29 15.5 30 20.0 31 26.5 32 27.0 33 30.0 34 49.5 35 70.0 36 83.0 37 102.5 38 127.5 39 155.0 40 195.0 41 223.5 42 241.0 43 272.5 44 272.0 45 255.0 46 258.0 47 259.5 48 238.0 49 201.5 50 175.5 51 143.0 52 110.0 53 91.5 54 72.5 55 55.5 56 45.5 57 35.0 58 27.0 59 22.5 60 15.5 61 8.5 62 9.5 63 10.5 64 5.5 65 2.5 66 3.5 67 3.0 68 1.5 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.575 #Duplication Level Percentage of deduplicated Percentage of total 1 90.23164945576333 80.825 2 8.289143176109405 14.85 3 1.2001116382919341 3.225 4 0.1674574379012001 0.6 5 0.11163829193413341 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCAAAATGCAAATCACATCCTTGTTAGTGTTGTTCGTGGGAGTAGTTG 5 0.125 No Hit CTTCGACTACTCCTTCTGGTCTAGTAGCTGCGGCACTGGCCCATGCATTC 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GTTGTTATTAGCTGAAGAAGAAGGAGAAAGGAGTCGATATTTTGTCATAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.0875 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.8375000000000004 0.0 0.0 0.0 0.0 132-133 4.300000000000001 0.0 0.0 0.0 0.0 134-135 4.7625 0.0 0.0 0.0 0.0 136-137 5.15 0.0 0.0 0.0 0.0 138-139 5.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824280 spots for SRR12917570.sra Written 824280 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra Read 824266 spots for SRR12917570.sra Written 824266 spots for SRR12917570.sra SRR ids: ['SRR12917570.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ewnag84 SRR12917570.sra spots: 16485334 blocks: [[1, 824266], [824267, 1648532], [1648533, 2472798], [2472799, 3297064], [3297065, 4121330], [4121331, 4945596], [4945597, 5769862], [5769863, 6594128], [6594129, 7418394], [7418395, 8242660], [8242661, 9066926], [9066927, 9891192], [9891193, 10715458], [10715459, 11539724], [11539725, 12363990], [12363991, 13188256], [13188257, 14012522], [14012523, 14836788], [14836789, 15661054], [15661055, 16485334]] SRR12917570 file size 5580737 SRR12917570 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917570 SRR12917570_1.fastq SRR12917570_2.fastq Input file: SRR12917570_1.fastq Paired file: SRR12917570_2.fastq trimmed: SRR12917570-trimmed-pair1.fastq, SRR12917570-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:17:15 2025 >> started Thu Feb 13 14:17:33 2025 >> done (17.644s) 16485334 read pairs processed; of these: 60 ( 0.00%) short read pairs filtered out after trimming by size control 2948 ( 0.02%) empty read pairs filtered out after trimming by size control 16482326 (99.98%) read pairs available; of these: 1187986 ( 7.21%) trimmed read pairs available after processing 15294340 (92.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 10 0.00% 21 13 0.00% 22 9 0.00% 23 9 0.00% 24 12 0.00% 25 11 0.00% 26 11 0.00% 27 18 0.00% 28 10 0.00% 29 32 0.00% 30 22 0.00% 31 21 0.00% 32 25 0.00% 33 16 0.00% 34 21 0.00% 35 23 0.00% 36 29 0.00% 37 38 0.00% 38 19 0.00% 39 21 0.00% 40 32 0.00% 41 28 0.00% 42 31 0.00% 43 40 0.00% 44 39 0.00% 45 31 0.00% 46 39 0.00% 47 44 0.00% 48 58 0.00% 49 87 0.00% 50 71 0.00% 51 116 0.00% 52 106 0.00% 53 120 0.00% 54 118 0.00% 55 125 0.00% 56 147 0.00% 57 179 0.00% 58 218 0.00% 59 224 0.00% 60 261 0.00% 61 313 0.00% 62 359 0.00% 63 372 0.00% 64 498 0.00% 65 486 0.00% 66 581 0.00% 67 616 0.00% 68 663 0.00% 69 790 0.00% 70 907 0.01% 71 1077 0.01% 72 1255 0.01% 73 1320 0.01% 74 1529 0.01% 75 1657 0.01% 76 1898 0.01% 77 1998 0.01% 78 2131 0.01% 79 2239 0.01% 80 2485 0.02% 81 2738 0.02% 82 3182 0.02% 83 3492 0.02% 84 3737 0.02% 85 4110 0.02% 86 4606 0.03% 87 4834 0.03% 88 4867 0.03% 89 5140 0.03% 90 5497 0.03% 91 5725 0.03% 92 6233 0.04% 93 6564 0.04% 94 7112 0.04% 95 7480 0.05% 96 8119 0.05% 97 8426 0.05% 98 8408 0.05% 99 8772 0.05% 100 9067 0.06% 101 9084 0.06% 102 9631 0.06% 103 10048 0.06% 104 10849 0.07% 105 10969 0.07% 106 11492 0.07% 107 11988 0.07% 108 12523 0.08% 109 12897 0.08% 110 13117 0.08% 111 13342 0.08% 112 13561 0.08% 113 13974 0.08% 114 14624 0.09% 115 15159 0.09% 116 15791 0.10% 117 16513 0.10% 118 17398 0.11% 119 17579 0.11% 120 17629 0.11% 121 18517 0.11% 122 18317 0.11% 123 18983 0.12% 124 19261 0.12% 125 19646 0.12% 126 20841 0.13% 127 21362 0.13% 128 22162 0.13% 129 22575 0.14% 130 23342 0.14% 131 23440 0.14% 132 23541 0.14% 133 24066 0.15% 134 24274 0.15% 135 24807 0.15% 136 25850 0.16% 137 26306 0.16% 138 27303 0.17% 139 28417 0.17% 140 28323 0.17% 141 29130 0.18% 142 29628 0.18% 143 29222 0.18% 144 30323 0.18% 145 30649 0.19% 146 31398 0.19% 147 31788 0.19% 148 33277 0.20% 149 33867 0.21% 150 35431 0.21% 151 15294340 92.79% 16482326 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.47 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=15.26 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.1 sequence=TCATAGCATTTTTATTCGAGTTTATTTAATTTAGTAGGCCAAACACAGTTCTGCTCATTTGAGTGCAATCGGTCATCGATCTCTTTCATAGCACTCAAACGACTCAGAAGCAGATACAAAATCCCATCACTCACAAGCCAGACGTGGCGTAGGAATTGACTCAATGAACTTGGCTGCGGCAAGGAAAGCATTGTAGGAGGCCAAGTAGC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=27 prefix-density=0.54 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=61.02 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.6 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACC SRR12917570 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:18:16 Started mapping on | Feb 13 14:18:17 Finished on | Feb 13 14:20:30 Mapping speed, Million of reads per hour | 446.14 Number of input reads | 16482326 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15526704 Uniquely mapped reads % | 94.20% Average mapped length | 297.08 Number of splices: Total | 15703336 Number of splices: Annotated (sjdb) | 15395907 Number of splices: GT/AG | 15390826 Number of splices: GC/AG | 257998 Number of splices: AT/AC | 9915 Number of splices: Non-canonical | 44597 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 501892 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 50141 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.33% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 453730 453730 453730 N_multimapping 501892 501892 501892 N_noFeature 479052 15311747 546164 N_ambiguous 256488 759 108284 UnstrandedReadsAssigned:14791164 PositiveStrandReadsAssigned:214198 NegativeStrandReadsAssigned:14872256 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917570 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917570-trimmed-pair1.fastq SRR12917570-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,482,326 reads, 15,000,083 reads pseudoaligned [quant] estimated average fragment length: 275.546 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR12917570.ke.tsv 34699 SRR12917570.se.tsv 87100 total ==> SRR12917570.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.45 416 13.5971 Potri.005G024800.1.v4.1 1035 760.454 516 38.6671 Potri.004G059700.1.v4.1 961 686.652 31 2.57271 Potri.007G009000.2.v4.1 1416 1141.45 0 0 Potri.003G141000.2.v4.1 2943 2668.45 587.388 12.5438 Potri.016G087400.1.v4.1 270 76.8389 1204 892.915 Potri.015G069301.1.v4.1 564 303.763 0 0 Potri.010G195200.1.v4.1 1773 1498.45 101 3.84099 Potri.012G127500.1.v4.1 977 702.519 1053 85.4152 ==> SRR12917570.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 148 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 208 Potri.001G212900.v4.1 73 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 21 SRR12917570 completed mapping pipeline successfully