Starting /dee2/code/volunteer_pipeline.sh SRR12917571 current disk space = 3089962405888 free memory = 1441048212 SRR12917571 SRAfilesize 580b58ba3b58e3956c901aaac7c58ff5 SRR12917571.sra SRR12917571.sra file validated SRR12917571 is paired end SRR12917571 is conventional basespace SRR12917571 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917571_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.67725 37.0 37.0 37.0 37.0 37.0 2 36.407 37.0 37.0 37.0 37.0 37.0 3 36.5355 37.0 37.0 37.0 37.0 37.0 4 36.6465 37.0 37.0 37.0 37.0 37.0 5 36.6615 37.0 37.0 37.0 37.0 37.0 6 36.607 37.0 37.0 37.0 37.0 37.0 7 36.556 37.0 37.0 37.0 37.0 37.0 8 36.5965 37.0 37.0 37.0 37.0 37.0 9 36.636 37.0 37.0 37.0 37.0 37.0 10-14 36.633799999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.6164 37.0 37.0 37.0 37.0 37.0 20-24 36.5686 37.0 37.0 37.0 37.0 37.0 25-29 36.5512 37.0 37.0 37.0 37.0 37.0 30-34 36.481700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.445100000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.5192 37.0 37.0 37.0 37.0 37.0 45-49 36.4404 37.0 37.0 37.0 37.0 37.0 50-54 36.441700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.4375 37.0 37.0 37.0 37.0 37.0 60-64 36.3821 37.0 37.0 37.0 37.0 37.0 65-69 36.3197 37.0 37.0 37.0 37.0 37.0 70-74 36.3212 37.0 37.0 37.0 37.0 37.0 75-79 36.340199999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.356500000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.3142 37.0 37.0 37.0 37.0 37.0 90-94 36.306999999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.230000000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.16180000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.147200000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.164 37.0 37.0 37.0 37.0 37.0 115-119 36.12070000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.0766 37.0 37.0 37.0 37.0 37.0 125-129 35.979 37.0 37.0 37.0 37.0 37.0 130-134 36.0274 37.0 37.0 37.0 37.0 37.0 135-139 35.9268 37.0 37.0 37.0 37.0 37.0 140-144 35.8206 37.0 37.0 37.0 37.0 37.0 145-149 35.742999999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.59175 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 1.0 25 0.0 26 1.0 27 3.0 28 14.0 29 12.0 30 23.0 31 37.0 32 37.0 33 62.0 34 111.0 35 316.0 36 3084.0 37 295.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.73568392098024 13.253313328332084 5.126281570392599 38.884721180295074 2 17.724999999999998 12.375 38.800000000000004 31.1 3 16.625 14.35 30.349999999999998 38.675 4 22.55 22.775000000000002 23.75 30.925000000000004 5 23.35 31.05 23.35 22.25 6 20.525 33.650000000000006 23.674999999999997 22.15 7 15.15 28.65 40.875 15.325 8 16.525000000000002 25.874999999999996 32.800000000000004 24.8 9 17.424999999999997 22.6 35.65 24.325 10-14 19.235 30.09 27.415 23.26 15-19 19.869999999999997 28.194999999999997 27.61 24.325 20-24 20.26 28.389999999999997 28.315 23.035 25-29 20.41 29.025000000000002 27.450000000000003 23.115 30-34 19.665 28.26 27.76 24.315 35-39 19.54 28.46 27.865000000000002 24.135 40-44 19.485 28.67 27.700000000000003 24.145 45-49 19.53 28.52 28.060000000000002 23.89 50-54 20.055 28.03 28.02 23.895 55-59 19.55 28.18 28.37 23.9 60-64 19.605 28.599999999999998 27.12 24.675 65-69 20.105 28.199999999999996 27.72 23.974999999999998 70-74 20.645 28.444999999999997 27.67 23.24 75-79 19.845 28.225 28.27 23.66 80-84 20.635 28.34 27.35 23.674999999999997 85-89 20.415 28.32 27.83 23.435 90-94 20.325 28.055000000000003 27.96 23.66 95-99 21.125 28.389999999999997 27.029999999999998 23.455000000000002 100-104 20.19 28.255000000000003 27.805000000000003 23.75 105-109 20.724999999999998 27.815 27.6 23.86 110-114 20.195 27.985 28.050000000000004 23.77 115-119 20.29 27.735 28.16 23.815 120-124 20.330000000000002 28.23 27.62 23.82 125-129 20.495 27.96 27.665 23.880000000000003 130-134 20.505000000000003 28.43 27.139999999999997 23.925 135-139 20.59 27.634999999999998 27.845 23.93 140-144 20.685000000000002 27.915 27.455000000000002 23.945 145-149 21.565 27.785 26.729999999999997 23.919999999999998 150-151 20.9875 28.787499999999998 26.525 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 2.0 18 1.5 19 0.0 20 0.5 21 0.5 22 0.5 23 2.5 24 4.0 25 5.5 26 9.0 27 11.5 28 11.0 29 13.0 30 20.0 31 21.5 32 28.0 33 40.5 34 49.0 35 65.5 36 78.0 37 104.0 38 126.5 39 151.0 40 189.5 41 210.5 42 233.0 43 249.5 44 254.5 45 260.5 46 270.5 47 264.5 48 251.0 49 216.0 50 181.5 51 151.5 52 118.5 53 99.5 54 74.0 55 58.0 56 47.5 57 37.0 58 24.0 59 15.5 60 12.5 61 13.0 62 9.5 63 2.0 64 1.0 65 3.0 66 2.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.85 #Duplication Level Percentage of deduplicated Percentage of total 1 91.22179416620804 82.875 2 7.649972482113373 13.900000000000002 3 1.0181618051733627 2.775 4 0.0825536598789213 0.3 5 0.0 0.0 6 0.0275178866263071 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.4875 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 2.9749999999999996 0.0 0.0 0.0 0.0 126-127 3.2750000000000004 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 3.8375 0.0 0.0 0.0 0.0 132-133 4.112500000000001 0.0 0.0 0.0 0.0 134-135 4.35 0.0 0.0 0.0 0.0 136-137 4.7375 0.0 0.0 0.0 0.0 138-139 5.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCAG 10 0.006830828 145.0 9 >>END_MODULE SRR12917571 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917571_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.348 37.0 37.0 37.0 37.0 37.0 2 36.212 37.0 37.0 37.0 37.0 37.0 3 36.4015 37.0 37.0 37.0 37.0 37.0 4 36.387 37.0 37.0 37.0 37.0 37.0 5 36.442 37.0 37.0 37.0 37.0 37.0 6 36.3825 37.0 37.0 37.0 37.0 37.0 7 36.372 37.0 37.0 37.0 37.0 37.0 8 36.3775 37.0 37.0 37.0 37.0 37.0 9 36.448 37.0 37.0 37.0 37.0 37.0 10-14 36.4303 37.0 37.0 37.0 37.0 37.0 15-19 36.3531 37.0 37.0 37.0 37.0 37.0 20-24 36.316 37.0 37.0 37.0 37.0 37.0 25-29 36.199400000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.193400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.1495 37.0 37.0 37.0 37.0 37.0 40-44 36.173899999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.123200000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.0925 37.0 37.0 37.0 37.0 37.0 55-59 36.0529 37.0 37.0 37.0 37.0 37.0 60-64 36.1034 37.0 37.0 37.0 37.0 37.0 65-69 36.029700000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.016000000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.9917 37.0 37.0 37.0 37.0 37.0 80-84 36.005399999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.022000000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.0202 37.0 37.0 37.0 37.0 37.0 95-99 35.9715 37.0 37.0 37.0 37.0 37.0 100-104 35.914 37.0 37.0 37.0 37.0 37.0 105-109 35.9255 37.0 37.0 37.0 37.0 37.0 110-114 35.8612 37.0 37.0 37.0 37.0 37.0 115-119 35.8092 37.0 37.0 37.0 37.0 37.0 120-124 35.7952 37.0 37.0 37.0 37.0 37.0 125-129 35.7173 37.0 37.0 37.0 37.0 37.0 130-134 35.6517 37.0 37.0 37.0 37.0 37.0 135-139 35.6353 37.0 37.0 37.0 37.0 37.0 140-144 35.4414 37.0 37.0 37.0 34.6 37.0 145-149 35.3018 37.0 37.0 37.0 32.2 37.0 150-151 34.838 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 0.0 15 6.0 16 1.0 17 1.0 18 1.0 19 0.0 20 0.0 21 2.0 22 4.0 23 2.0 24 3.0 25 8.0 26 5.0 27 3.0 28 14.0 29 21.0 30 12.0 31 33.0 32 56.0 33 92.0 34 163.0 35 558.0 36 2770.0 37 241.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.45 24.575 10.225 26.75 2 27.175 24.625 31.7 16.5 3 20.8 26.200000000000003 34.925 18.075 4 23.5 33.2 24.125 19.175 5 25.900000000000002 36.925000000000004 21.425 15.75 6 20.150000000000002 38.875 23.425 17.549999999999997 7 21.45 21.2 38.425 18.925 8 19.475 25.275 29.125 26.125 9 20.65 25.0 31.25 23.1 10-14 23.325000000000003 29.409999999999997 26.105 21.16 15-19 23.544999999999998 28.189999999999998 27.655 20.61 20-24 22.650000000000002 28.34 27.810000000000002 21.2 25-29 23.315 28.265 26.99 21.43 30-34 23.695 28.555000000000003 27.415 20.335 35-39 22.775000000000002 27.939999999999998 27.92 21.365000000000002 40-44 23.455000000000002 28.165000000000003 27.224999999999998 21.154999999999998 45-49 23.635 27.77 27.88 20.715 50-54 22.675 28.025 27.860000000000003 21.44 55-59 23.565 27.925 27.395000000000003 21.115000000000002 60-64 23.28 27.505000000000003 27.589999999999996 21.625 65-69 23.255 28.08 27.785 20.880000000000003 70-74 23.31 27.24 27.79 21.66 75-79 23.135 27.860000000000003 27.200000000000003 21.805 80-84 23.565 28.125 27.305 21.005 85-89 22.88 28.15 27.750000000000004 21.22 90-94 23.855 27.99 27.195000000000004 20.96 95-99 23.22 27.389999999999997 28.18 21.21 100-104 23.765 27.584999999999997 27.589999999999996 21.060000000000002 105-109 23.815 28.444999999999997 27.36 20.380000000000003 110-114 24.115000000000002 27.46 27.505000000000003 20.919999999999998 115-119 24.145 28.299999999999997 27.189999999999998 20.365 120-124 23.919999999999998 27.825 27.685 20.57 125-129 23.815 28.395 27.105 20.685000000000002 130-134 24.77 27.500000000000004 27.505000000000003 20.225 135-139 24.32 28.194999999999997 26.55 20.935000000000002 140-144 24.525 27.474999999999998 27.534999999999997 20.465 145-149 24.98 28.065 27.205000000000002 19.75 150-151 23.825 28.6625 28.125 19.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.0 18 0.5 19 1.5 20 2.5 21 2.0 22 3.5 23 3.0 24 3.0 25 8.0 26 7.0 27 6.0 28 9.0 29 13.0 30 15.5 31 18.5 32 23.0 33 28.5 34 35.0 35 61.0 36 96.0 37 120.0 38 130.5 39 152.0 40 177.0 41 199.5 42 234.0 43 256.0 44 283.0 45 283.5 46 263.0 47 251.5 48 231.0 49 203.0 50 168.0 51 141.5 52 117.5 53 94.5 54 89.0 55 76.5 56 49.5 57 31.5 58 26.5 59 20.0 60 13.0 61 8.5 62 6.0 63 7.5 64 8.0 65 5.0 66 2.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 1.5 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.5 #Duplication Level Percentage of deduplicated Percentage of total 1 90.99447513812154 82.35 2 7.70718232044199 13.950000000000001 3 1.1325966850828728 3.075 4 0.13812154696132595 0.5 5 0.027624309392265196 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8500000000000001 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.4875 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.8625 0.0 0.0 0.0 0.0 118-119 2.2249999999999996 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 2.9749999999999996 0.0 0.0 0.0 0.0 126-127 3.2750000000000004 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 3.8625 0.0 0.0 0.0 0.0 132-133 4.137499999999999 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.7625 0.0 0.0 0.0 0.0 138-139 5.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652300 spots for SRR12917571.sra Written 652300 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra Read 652288 spots for SRR12917571.sra Written 652288 spots for SRR12917571.sra SRR ids: ['SRR12917571.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vwdaez9t SRR12917571.sra spots: 13045772 blocks: [[1, 652288], [652289, 1304576], [1304577, 1956864], [1956865, 2609152], [2609153, 3261440], [3261441, 3913728], [3913729, 4566016], [4566017, 5218304], [5218305, 5870592], [5870593, 6522880], [6522881, 7175168], [7175169, 7827456], [7827457, 8479744], [8479745, 9132032], [9132033, 9784320], [9784321, 10436608], [10436609, 11088896], [11088897, 11741184], [11741185, 12393472], [12393473, 13045772]] SRR12917571 file size 4411823 SRR12917571 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917571 SRR12917571_1.fastq SRR12917571_2.fastq Input file: SRR12917571_1.fastq Paired file: SRR12917571_2.fastq trimmed: SRR12917571-trimmed-pair1.fastq, SRR12917571-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:20:11 2025 >> started Thu Feb 13 14:20:27 2025 >> done (15.883s) 13045772 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 736 ( 0.01%) empty read pairs filtered out after trimming by size control 13044956 (99.99%) read pairs available; of these: 1037326 ( 7.95%) trimmed read pairs available after processing 12007630 (92.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 6 0.00% 21 6 0.00% 22 11 0.00% 23 8 0.00% 24 8 0.00% 25 9 0.00% 26 19 0.00% 27 18 0.00% 28 20 0.00% 29 25 0.00% 30 11 0.00% 31 23 0.00% 32 13 0.00% 33 22 0.00% 34 25 0.00% 35 22 0.00% 36 27 0.00% 37 13 0.00% 38 37 0.00% 39 24 0.00% 40 33 0.00% 41 33 0.00% 42 26 0.00% 43 34 0.00% 44 36 0.00% 45 30 0.00% 46 43 0.00% 47 44 0.00% 48 41 0.00% 49 49 0.00% 50 64 0.00% 51 71 0.00% 52 85 0.00% 53 92 0.00% 54 96 0.00% 55 87 0.00% 56 109 0.00% 57 116 0.00% 58 142 0.00% 59 181 0.00% 60 219 0.00% 61 241 0.00% 62 269 0.00% 63 285 0.00% 64 300 0.00% 65 311 0.00% 66 380 0.00% 67 419 0.00% 68 460 0.00% 69 570 0.00% 70 616 0.00% 71 715 0.01% 72 783 0.01% 73 1026 0.01% 74 1101 0.01% 75 1287 0.01% 76 1243 0.01% 77 1359 0.01% 78 1476 0.01% 79 1676 0.01% 80 1847 0.01% 81 2092 0.02% 82 2383 0.02% 83 2525 0.02% 84 2912 0.02% 85 3232 0.02% 86 3494 0.03% 87 3615 0.03% 88 3866 0.03% 89 4008 0.03% 90 4217 0.03% 91 4703 0.04% 92 4873 0.04% 93 5403 0.04% 94 5679 0.04% 95 6459 0.05% 96 6491 0.05% 97 7000 0.05% 98 7078 0.05% 99 7298 0.06% 100 7639 0.06% 101 7709 0.06% 102 8390 0.06% 103 8548 0.07% 104 9149 0.07% 105 9556 0.07% 106 9881 0.08% 107 10422 0.08% 108 10739 0.08% 109 11084 0.08% 110 11384 0.09% 111 11700 0.09% 112 11749 0.09% 113 12123 0.09% 114 12963 0.10% 115 13473 0.10% 116 13929 0.11% 117 14622 0.11% 118 14987 0.11% 119 15365 0.12% 120 15667 0.12% 121 15990 0.12% 122 16035 0.12% 123 16859 0.13% 124 17388 0.13% 125 17570 0.13% 126 18453 0.14% 127 18838 0.14% 128 19352 0.15% 129 20221 0.16% 130 20529 0.16% 131 20721 0.16% 132 21119 0.16% 133 21797 0.17% 134 21677 0.17% 135 22294 0.17% 136 23076 0.18% 137 23648 0.18% 138 24247 0.19% 139 25355 0.19% 140 25347 0.19% 141 25845 0.20% 142 26479 0.20% 143 26506 0.20% 144 26983 0.21% 145 27941 0.21% 146 27964 0.21% 147 28310 0.22% 148 29592 0.23% 149 29618 0.23% 150 30815 0.24% 151 12007630 92.05% 13044956 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.84 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=11.98 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=4.3 sequence=ACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=20 prefix-density=0.97 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=64.15 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.8 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGACTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR12917571 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:21:12 Started mapping on | Feb 13 14:21:12 Finished on | Feb 13 14:22:37 Mapping speed, Million of reads per hour | 552.49 Number of input reads | 13044956 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12344713 Uniquely mapped reads % | 94.63% Average mapped length | 296.73 Number of splices: Total | 12458671 Number of splices: Annotated (sjdb) | 12209071 Number of splices: GT/AG | 12205673 Number of splices: GC/AG | 209127 Number of splices: AT/AC | 7545 Number of splices: Non-canonical | 36326 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285562 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 39444 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 414681 414681 414681 N_multimapping 285562 285562 285562 N_noFeature 410159 12182970 470020 N_ambiguous 195137 669 92880 UnstrandedReadsAssigned:11739417 PositiveStrandReadsAssigned:161074 NegativeStrandReadsAssigned:11781813 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917571 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917571-trimmed-pair1.fastq SRR12917571-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,044,956 reads, 11,791,942 reads pseudoaligned [quant] estimated average fragment length: 271.739 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 997 rounds 52401 SRR12917571.ke.tsv 34699 SRR12917571.se.tsv 87100 total ==> SRR12917571.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.26 292 13.6606 Potri.005G024800.1.v4.1 1035 764.261 112 11.979 Potri.004G059700.1.v4.1 961 690.419 22 2.60468 Potri.007G009000.2.v4.1 1416 1145.26 0 0 Potri.003G141000.2.v4.1 2943 2672.26 318.341 9.73772 Potri.016G087400.1.v4.1 270 78.5654 489 508.77 Potri.015G069301.1.v4.1 564 308.382 0 0 Potri.010G195200.1.v4.1 1773 1502.26 5 0.272062 Potri.012G127500.1.v4.1 977 706.343 278 32.1716 ==> SRR12917571.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 110 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 128 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 8 SRR12917571 completed mapping pipeline successfully