Starting /dee2/code/volunteer_pipeline.sh SRR12917572 current disk space = 3089391939584 free memory = 1479414016 SRR12917572 SRAfilesize 9a27bc20a64e3c674a2a6245231f3487 SRR12917572.sra SRR12917572.sra file validated SRR12917572 is paired end SRR12917572 is conventional basespace SRR12917572 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917572_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7125 37.0 37.0 37.0 37.0 37.0 2 36.5435 37.0 37.0 37.0 37.0 37.0 3 36.651 37.0 37.0 37.0 37.0 37.0 4 36.742 37.0 37.0 37.0 37.0 37.0 5 36.636 37.0 37.0 37.0 37.0 37.0 6 36.7175 37.0 37.0 37.0 37.0 37.0 7 36.574 37.0 37.0 37.0 37.0 37.0 8 36.568 37.0 37.0 37.0 37.0 37.0 9 36.718 37.0 37.0 37.0 37.0 37.0 10-14 36.6472 37.0 37.0 37.0 37.0 37.0 15-19 36.6192 37.0 37.0 37.0 37.0 37.0 20-24 36.5899 37.0 37.0 37.0 37.0 37.0 25-29 36.540699999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.522000000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.513 37.0 37.0 37.0 37.0 37.0 40-44 36.5182 37.0 37.0 37.0 37.0 37.0 45-49 36.4045 37.0 37.0 37.0 37.0 37.0 50-54 36.4614 37.0 37.0 37.0 37.0 37.0 55-59 36.4029 37.0 37.0 37.0 37.0 37.0 60-64 36.3827 37.0 37.0 37.0 37.0 37.0 65-69 36.2849 37.0 37.0 37.0 37.0 37.0 70-74 36.3029 37.0 37.0 37.0 37.0 37.0 75-79 36.3423 37.0 37.0 37.0 37.0 37.0 80-84 36.3078 37.0 37.0 37.0 37.0 37.0 85-89 36.2517 37.0 37.0 37.0 37.0 37.0 90-94 36.2616 37.0 37.0 37.0 37.0 37.0 95-99 36.229200000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.212900000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.131299999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.11039999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.0028 37.0 37.0 37.0 37.0 37.0 120-124 36.047999999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.9717 37.0 37.0 37.0 37.0 37.0 130-134 35.892599999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.838499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.6785 37.0 37.0 37.0 37.0 37.0 145-149 35.603 37.0 37.0 37.0 37.0 37.0 150-151 35.41375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 2.0 25 4.0 26 3.0 27 3.0 28 10.0 29 11.0 30 21.0 31 30.0 32 42.0 33 63.0 34 134.0 35 343.0 36 3036.0 37 295.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.24412206103052 11.755877938969485 5.777888944472236 44.22211105552776 2 18.525 11.774999999999999 39.45 30.25 3 16.325 15.625 27.425 40.625 4 20.674999999999997 21.8 26.0 31.525 5 24.675 28.425 25.6 21.3 6 20.674999999999997 31.974999999999998 25.025 22.325 7 14.099999999999998 29.9 40.325 15.675 8 15.6 26.650000000000002 33.45 24.3 9 16.05 23.75 35.875 24.325 10-14 19.43 30.294999999999998 28.015 22.259999999999998 15-19 18.92 27.88 28.410000000000004 24.79 20-24 19.015 29.080000000000002 28.015 23.89 25-29 19.525000000000002 28.475 28.315 23.685000000000002 30-34 19.470000000000002 28.685 27.700000000000003 24.145 35-39 19.705000000000002 28.92 27.439999999999998 23.935000000000002 40-44 19.415 28.694999999999997 28.7 23.189999999999998 45-49 19.41 28.915000000000003 28.025 23.65 50-54 20.165 28.58 27.985 23.27 55-59 19.935 28.189999999999998 28.155 23.72 60-64 19.66 28.76 27.325 24.255 65-69 19.345000000000002 28.515 27.944999999999997 24.195 70-74 20.71 28.625 26.979999999999997 23.685000000000002 75-79 19.775000000000002 28.4 27.700000000000003 24.125 80-84 20.18 27.905 28.065 23.849999999999998 85-89 19.7 27.76 28.12 24.42 90-94 20.195 27.515 27.865000000000002 24.425 95-99 20.11 28.27 27.85 23.77 100-104 19.935 28.17 27.860000000000003 24.035 105-109 19.985 28.144999999999996 27.750000000000004 24.12 110-114 20.105 28.115000000000002 28.144999999999996 23.635 115-119 20.105 28.055000000000003 27.810000000000002 24.03 120-124 20.23 28.144999999999996 27.284999999999997 24.34 125-129 20.395 28.89 26.650000000000002 24.065 130-134 20.485 27.860000000000003 27.875 23.78 135-139 20.549999999999997 28.68 27.47 23.3 140-144 20.78 27.800000000000004 27.515 23.905 145-149 20.87 28.310000000000002 27.075 23.745 150-151 20.0125 29.5875 26.5125 23.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.5 23 2.0 24 2.5 25 3.0 26 4.5 27 6.0 28 9.0 29 14.5 30 17.0 31 20.0 32 33.5 33 50.5 34 58.0 35 72.0 36 87.5 37 104.0 38 123.5 39 136.5 40 181.0 41 212.5 42 233.5 43 276.0 44 295.5 45 286.0 46 272.0 47 259.5 48 247.0 49 229.5 50 187.0 51 133.0 52 98.5 53 81.5 54 60.0 55 44.5 56 35.0 57 35.5 58 26.5 59 13.0 60 10.0 61 6.5 62 5.5 63 4.0 64 4.5 65 4.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.5 72 1.0 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.975 #Duplication Level Percentage of deduplicated Percentage of total 1 91.37125583951635 83.125 2 7.4745809288266 13.600000000000001 3 1.0167628469359713 2.775 4 0.1374003847210772 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.9749999999999999 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.1500000000000004 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.8625 0.0 0.0 0.0 0.0 132-133 5.3 0.0 0.0 0.0 0.0 134-135 5.875 0.0 0.0 0.0 0.0 136-137 6.225 0.0 0.0 0.0 0.0 138-139 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGTAA 10 0.006830828 145.0 5 >>END_MODULE SRR12917572 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917572_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.418 37.0 37.0 37.0 37.0 37.0 2 36.338 37.0 37.0 37.0 37.0 37.0 3 36.3525 37.0 37.0 37.0 37.0 37.0 4 36.3865 37.0 37.0 37.0 37.0 37.0 5 36.5325 37.0 37.0 37.0 37.0 37.0 6 36.428 37.0 37.0 37.0 37.0 37.0 7 36.4055 37.0 37.0 37.0 37.0 37.0 8 36.4485 37.0 37.0 37.0 37.0 37.0 9 36.517 37.0 37.0 37.0 37.0 37.0 10-14 36.44690000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.427699999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.360200000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.27910000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.2095 37.0 37.0 37.0 37.0 37.0 35-39 36.1923 37.0 37.0 37.0 37.0 37.0 40-44 36.199 37.0 37.0 37.0 37.0 37.0 45-49 36.1368 37.0 37.0 37.0 37.0 37.0 50-54 36.058499999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.1636 37.0 37.0 37.0 37.0 37.0 60-64 36.1303 37.0 37.0 37.0 37.0 37.0 65-69 36.0781 37.0 37.0 37.0 37.0 37.0 70-74 36.0171 37.0 37.0 37.0 37.0 37.0 75-79 35.9786 37.0 37.0 37.0 37.0 37.0 80-84 35.989 37.0 37.0 37.0 37.0 37.0 85-89 36.0436 37.0 37.0 37.0 37.0 37.0 90-94 36.0376 37.0 37.0 37.0 37.0 37.0 95-99 35.9886 37.0 37.0 37.0 37.0 37.0 100-104 35.964999999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.873900000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.9032 37.0 37.0 37.0 37.0 37.0 115-119 35.7523 37.0 37.0 37.0 37.0 37.0 120-124 35.7074 37.0 37.0 37.0 37.0 37.0 125-129 35.6662 37.0 37.0 37.0 37.0 37.0 130-134 35.6309 37.0 37.0 37.0 37.0 37.0 135-139 35.581 37.0 37.0 37.0 37.0 37.0 140-144 35.4224 37.0 37.0 37.0 34.6 37.0 145-149 35.212900000000005 37.0 37.0 37.0 29.8 37.0 150-151 34.744 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 2.0 17 1.0 18 0.0 19 2.0 20 0.0 21 4.0 22 2.0 23 6.0 24 2.0 25 4.0 26 4.0 27 10.0 28 12.0 29 12.0 30 29.0 31 38.0 32 62.0 33 98.0 34 151.0 35 551.0 36 2801.0 37 207.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.099999999999994 27.224999999999998 10.75 26.924999999999997 2 25.874999999999996 25.900000000000002 33.625 14.6 3 19.675 27.075 35.0 18.25 4 23.05 31.474999999999998 25.174999999999997 20.3 5 25.174999999999997 36.449999999999996 21.95 16.425 6 20.175 39.6 22.525000000000002 17.7 7 21.3 23.625 37.275000000000006 17.8 8 19.5 25.924999999999997 31.7 22.875 9 22.125 23.599999999999998 31.8 22.475 10-14 23.455000000000002 29.020000000000003 27.334999999999997 20.19 15-19 22.98 28.595 28.07 20.355 20-24 22.75 28.13 28.305000000000003 20.815 25-29 22.73 27.72 29.145 20.405 30-34 23.015 27.88 28.360000000000003 20.745 35-39 22.900000000000002 29.115000000000002 27.800000000000004 20.185 40-44 22.875 28.199999999999996 28.67 20.255000000000003 45-49 23.064999999999998 28.265 28.425 20.244999999999997 50-54 23.235 28.389999999999997 28.144999999999996 20.23 55-59 23.465 28.134999999999998 27.939999999999998 20.46 60-64 23.635 28.285 28.615000000000002 19.465 65-69 23.400000000000002 27.800000000000004 28.345 20.455000000000002 70-74 23.885 28.185 27.775 20.155 75-79 23.599999999999998 28.115000000000002 27.985 20.3 80-84 24.38 28.325 27.295 20.0 85-89 23.75 27.650000000000002 28.025 20.575 90-94 24.22 27.955000000000002 27.35 20.474999999999998 95-99 23.97 28.125 27.700000000000003 20.205000000000002 100-104 23.87 28.425 27.544999999999998 20.16 105-109 24.29 28.09 27.22 20.4 110-114 24.365000000000002 28.26 27.435 19.939999999999998 115-119 24.33 28.04 27.96 19.67 120-124 24.69 28.17 27.145000000000003 19.994999999999997 125-129 24.11 28.04 27.42 20.43 130-134 24.995 28.48 27.04 19.485 135-139 24.865000000000002 28.415000000000003 27.200000000000003 19.52 140-144 25.1 28.470000000000002 26.765 19.665 145-149 25.724999999999998 27.33 27.38 19.564999999999998 150-151 26.85 27.575 26.55 19.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 3.0 24 3.0 25 4.0 26 4.5 27 5.0 28 8.0 29 16.0 30 23.0 31 21.0 32 26.0 33 38.5 34 52.5 35 73.0 36 95.5 37 130.5 38 159.0 39 181.0 40 214.5 41 240.5 42 266.5 43 271.5 44 268.0 45 275.5 46 261.0 47 242.5 48 219.5 49 187.5 50 168.0 51 142.5 52 102.5 53 67.5 54 56.0 55 41.5 56 26.0 57 26.0 58 21.0 59 14.5 60 7.0 61 6.0 62 5.5 63 2.0 64 1.5 65 2.5 66 3.0 67 1.0 68 1.0 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.475 #Duplication Level Percentage of deduplicated Percentage of total 1 91.96501776441652 84.125 2 6.941787373599344 12.7 3 0.9018857611369226 2.475 4 0.19130910084722602 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.9749999999999999 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.5875 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.1500000000000004 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.85 0.0 0.0 0.0 0.0 132-133 5.3 0.0 0.0 0.0 0.0 134-135 5.875 0.0 0.0 0.0 0.0 136-137 6.25 0.0 0.0 0.0 0.0 138-139 6.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487058 spots for SRR12917572.sra Written 487058 spots for SRR12917572.sra Read 487064 spots for SRR12917572.sra Written 487064 spots for SRR12917572.sra SRR ids: ['SRR12917572.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ldbx9l5z SRR12917572.sra spots: 9741166 blocks: [[1, 487058], [487059, 974116], [974117, 1461174], [1461175, 1948232], [1948233, 2435290], [2435291, 2922348], [2922349, 3409406], [3409407, 3896464], [3896465, 4383522], [4383523, 4870580], [4870581, 5357638], [5357639, 5844696], [5844697, 6331754], [6331755, 6818812], [6818813, 7305870], [7305871, 7792928], [7792929, 8279986], [8279987, 8767044], [8767045, 9254102], [9254103, 9741166]] SRR12917572 file size 3289279 SRR12917572 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917572 SRR12917572_1.fastq SRR12917572_2.fastq Input file: SRR12917572_1.fastq Paired file: SRR12917572_2.fastq trimmed: SRR12917572-trimmed-pair1.fastq, SRR12917572-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:47:10 2025 >> started Thu Feb 13 14:47:21 2025 >> done (10.966s) 9741166 read pairs processed; of these: 124 ( 0.00%) short read pairs filtered out after trimming by size control 1215 ( 0.01%) empty read pairs filtered out after trimming by size control 9739827 (99.99%) read pairs available; of these: 964739 ( 9.91%) trimmed read pairs available after processing 8775088 (90.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 7 0.00% 20 7 0.00% 21 9 0.00% 22 8 0.00% 23 6 0.00% 24 6 0.00% 25 15 0.00% 26 9 0.00% 27 8 0.00% 28 14 0.00% 29 18 0.00% 30 15 0.00% 31 11 0.00% 32 23 0.00% 33 20 0.00% 34 13 0.00% 35 22 0.00% 36 22 0.00% 37 20 0.00% 38 21 0.00% 39 20 0.00% 40 43 0.00% 41 19 0.00% 42 29 0.00% 43 33 0.00% 44 40 0.00% 45 39 0.00% 46 36 0.00% 47 44 0.00% 48 42 0.00% 49 48 0.00% 50 52 0.00% 51 72 0.00% 52 60 0.00% 53 58 0.00% 54 84 0.00% 55 88 0.00% 56 104 0.00% 57 117 0.00% 58 135 0.00% 59 153 0.00% 60 148 0.00% 61 215 0.00% 62 211 0.00% 63 258 0.00% 64 290 0.00% 65 336 0.00% 66 373 0.00% 67 381 0.00% 68 431 0.00% 69 558 0.01% 70 611 0.01% 71 624 0.01% 72 798 0.01% 73 940 0.01% 74 993 0.01% 75 1100 0.01% 76 1258 0.01% 77 1359 0.01% 78 1438 0.01% 79 1635 0.02% 80 1759 0.02% 81 1929 0.02% 82 2306 0.02% 83 2521 0.03% 84 2619 0.03% 85 3078 0.03% 86 3193 0.03% 87 3443 0.04% 88 3652 0.04% 89 3670 0.04% 90 4071 0.04% 91 4309 0.04% 92 4529 0.05% 93 4872 0.05% 94 5415 0.06% 95 5756 0.06% 96 6077 0.06% 97 6307 0.06% 98 6656 0.07% 99 6853 0.07% 100 6933 0.07% 101 7209 0.07% 102 7657 0.08% 103 8069 0.08% 104 8405 0.09% 105 8855 0.09% 106 9407 0.10% 107 9969 0.10% 108 10125 0.10% 109 10554 0.11% 110 10471 0.11% 111 10799 0.11% 112 11136 0.11% 113 11457 0.12% 114 12010 0.12% 115 12504 0.13% 116 13057 0.13% 117 13701 0.14% 118 14214 0.15% 119 14364 0.15% 120 14686 0.15% 121 14815 0.15% 122 15091 0.15% 123 15699 0.16% 124 16353 0.17% 125 16467 0.17% 126 17032 0.17% 127 17896 0.18% 128 18621 0.19% 129 18912 0.19% 130 19359 0.20% 131 19293 0.20% 132 19701 0.20% 133 20402 0.21% 134 20355 0.21% 135 20845 0.21% 136 21341 0.22% 137 21769 0.22% 138 22575 0.23% 139 23561 0.24% 140 23607 0.24% 141 24146 0.25% 142 24207 0.25% 143 24507 0.25% 144 25349 0.26% 145 25157 0.26% 146 25875 0.27% 147 25981 0.27% 148 26443 0.27% 149 27208 0.28% 150 28027 0.29% 151 8775088 90.09% 9739827 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=17 prefix-density=0.35 prefix-fanout=2.5 sequence=GTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATACCAGTTTACCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=29.21 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.6 sequence=TTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=28 prefix-density=0.42 prefix-fanout=2.2 sequence=CACAGCAGTCCATGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=422.61 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=14.0 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12917572 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:48:17 Started mapping on | Feb 13 14:48:17 Finished on | Feb 13 14:49:08 Mapping speed, Million of reads per hour | 687.52 Number of input reads | 9739827 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 8660030 Uniquely mapped reads % | 88.91% Average mapped length | 293.60 Number of splices: Total | 8447588 Number of splices: Annotated (sjdb) | 8258164 Number of splices: GT/AG | 8294163 Number of splices: GC/AG | 116849 Number of splices: AT/AC | 7734 Number of splices: Non-canonical | 28842 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 246076 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 25613 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.21% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 833721 833721 833721 N_multimapping 246076 246076 246076 N_noFeature 283432 8566022 319094 N_ambiguous 152713 850 93935 UnstrandedReadsAssigned:8223885 PositiveStrandReadsAssigned:93158 NegativeStrandReadsAssigned:8247001 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917572 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917572-trimmed-pair1.fastq SRR12917572-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,739,827 reads, 8,861,312 reads pseudoaligned [quant] estimated average fragment length: 258.322 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 955 rounds 52401 SRR12917572.ke.tsv 34699 SRR12917572.se.tsv 87100 total ==> SRR12917572.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.68 365 24.0934 Potri.005G024800.1.v4.1 1035 777.678 115 17.1863 Potri.004G059700.1.v4.1 961 703.78 115 18.9909 Potri.007G009000.2.v4.1 1416 1158.68 0 0 Potri.003G141000.2.v4.1 2943 2685.68 360.057 15.5813 Potri.016G087400.1.v4.1 270 85.9014 651 880.777 Potri.015G069301.1.v4.1 564 320.333 0 0 Potri.010G195200.1.v4.1 1773 1515.68 44 3.37389 Potri.012G127500.1.v4.1 977 719.738 2010 324.569 ==> SRR12917572.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 194 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 147 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 18 SRR12917572 completed mapping pipeline successfully