Starting /dee2/code/volunteer_pipeline.sh SRR12917573 current disk space = 3089741524992 free memory = 1447501664 SRR12917573 SRAfilesize 87af2c55f3c358fc9e9cc7da0fca38f8 SRR12917573.sra SRR12917573.sra file validated SRR12917573 is paired end SRR12917573 is conventional basespace SRR12917573 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917573_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.544 37.0 37.0 37.0 37.0 37.0 2 36.2955 37.0 37.0 37.0 37.0 37.0 3 36.59 37.0 37.0 37.0 37.0 37.0 4 36.6155 37.0 37.0 37.0 37.0 37.0 5 36.579 37.0 37.0 37.0 37.0 37.0 6 36.5735 37.0 37.0 37.0 37.0 37.0 7 36.614 37.0 37.0 37.0 37.0 37.0 8 36.562 37.0 37.0 37.0 37.0 37.0 9 36.6245 37.0 37.0 37.0 37.0 37.0 10-14 36.6071 37.0 37.0 37.0 37.0 37.0 15-19 36.569 37.0 37.0 37.0 37.0 37.0 20-24 36.588499999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5255 37.0 37.0 37.0 37.0 37.0 30-34 36.494600000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.4746 37.0 37.0 37.0 37.0 37.0 40-44 36.4854 37.0 37.0 37.0 37.0 37.0 45-49 36.4298 37.0 37.0 37.0 37.0 37.0 50-54 36.4533 37.0 37.0 37.0 37.0 37.0 55-59 36.38199999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.34929999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.2808 37.0 37.0 37.0 37.0 37.0 70-74 36.311 37.0 37.0 37.0 37.0 37.0 75-79 36.3284 37.0 37.0 37.0 37.0 37.0 80-84 36.3199 37.0 37.0 37.0 37.0 37.0 85-89 36.236399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2995 37.0 37.0 37.0 37.0 37.0 95-99 36.192099999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.20270000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.1104 37.0 37.0 37.0 37.0 37.0 110-114 36.097699999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0745 37.0 37.0 37.0 37.0 37.0 120-124 36.0526 37.0 37.0 37.0 37.0 37.0 125-129 35.9846 37.0 37.0 37.0 37.0 37.0 130-134 35.9666 37.0 37.0 37.0 37.0 37.0 135-139 35.84310000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.79090000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.686099999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.44175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 2.0 23 1.0 24 1.0 25 3.0 26 3.0 27 5.0 28 9.0 29 13.0 30 22.0 31 27.0 32 50.0 33 70.0 34 129.0 35 327.0 36 3022.0 37 314.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.4 12.65 4.875 37.075 2 19.475 11.4 37.45 31.674999999999997 3 16.400000000000002 16.7 28.275 38.625 4 21.175 23.674999999999997 25.8 29.349999999999998 5 23.799999999999997 29.4 24.375 22.425 6 19.1 33.1 23.375 24.425 7 13.05 29.725 40.45 16.775000000000002 8 17.175 25.474999999999998 33.825 23.525 9 16.825000000000003 22.875 36.35 23.95 10-14 19.71 30.285 28.175 21.83 15-19 19.580000000000002 27.725 28.139999999999997 24.555 20-24 18.995 27.655 28.660000000000004 24.69 25-29 19.765 28.610000000000003 28.125 23.5 30-34 19.285 29.099999999999998 27.750000000000004 23.865 35-39 19.11 28.689999999999998 27.67 24.529999999999998 40-44 19.314999999999998 29.095 27.505000000000003 24.085 45-49 20.115 28.565 27.875 23.445 50-54 19.8 28.79 27.435 23.974999999999998 55-59 20.06 28.675 27.435 23.830000000000002 60-64 19.8 28.465 27.839999999999996 23.895 65-69 19.575 28.27 28.249999999999996 23.905 70-74 19.985 28.27 27.455000000000002 24.29 75-79 19.900000000000002 28.1 27.705000000000002 24.295 80-84 19.470000000000002 28.24 27.644999999999996 24.645 85-89 19.994999999999997 28.415000000000003 28.360000000000003 23.23 90-94 20.085 27.83 27.67 24.415 95-99 20.0 28.525 27.725 23.75 100-104 19.655 28.485 28.244999999999997 23.615 105-109 20.16 28.544999999999998 26.99 24.305 110-114 20.25 27.900000000000002 27.834999999999997 24.015 115-119 20.18 28.904999999999998 27.215 23.7 120-124 20.14 28.675 27.375 23.810000000000002 125-129 20.810000000000002 27.860000000000003 27.279999999999998 24.05 130-134 20.9 28.865000000000002 26.97 23.265 135-139 20.674999999999997 28.115000000000002 27.310000000000002 23.9 140-144 20.349999999999998 28.535 27.325 23.79 145-149 20.294999999999998 27.400000000000002 28.17 24.135 150-151 20.9 28.1375 26.825 24.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 1.0 24 4.0 25 6.5 26 5.5 27 5.0 28 5.5 29 9.0 30 21.0 31 31.0 32 36.0 33 50.0 34 61.0 35 74.5 36 89.0 37 99.5 38 127.5 39 142.5 40 165.5 41 205.0 42 232.0 43 267.0 44 277.0 45 271.5 46 283.5 47 277.0 48 237.5 49 201.5 50 176.5 51 145.0 52 119.0 53 103.0 54 76.5 55 47.0 56 29.5 57 25.0 58 23.5 59 16.0 60 12.5 61 7.5 62 5.0 63 8.5 64 7.0 65 2.0 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.6207276736494 83.1 2 6.89084895259096 12.5 3 1.2127894156560088 3.3000000000000003 4 0.19294377067254684 0.7000000000000001 5 0.05512679162072767 0.25 6 0.027563395810363836 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGACCTTTTCTGCCTCTGGATCAGGAACAACGGGAAGGAAATTTGGT 6 0.15 No Hit CGGTGAAGAAATTGCATTTTGATAAACCACAAAAACAAATCCAAAAACGA 5 0.125 No Hit CAGATCAGTTGAGTGGCCATGGTGATCCCGCCATCACTGCTTCAATTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0125 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.1125 0.025 0.0 0.0 0.0 80-81 0.1375 0.025 0.0 0.0 0.0 82-83 0.2 0.025 0.0 0.0 0.0 84-85 0.2 0.025 0.0 0.0 0.0 86-87 0.25 0.025 0.0 0.0 0.0 88-89 0.3125 0.025 0.0 0.0 0.0 90-91 0.38749999999999996 0.025 0.0 0.0 0.0 92-93 0.5 0.025 0.0 0.0 0.0 94-95 0.6375 0.025 0.0 0.0 0.0 96-97 0.75 0.025 0.0 0.0 0.0 98-99 0.8125 0.025 0.0 0.0 0.0 100-101 0.875 0.025 0.0 0.0 0.0 102-103 0.9875 0.025 0.0 0.0 0.0 104-105 1.1125 0.025 0.0 0.0 0.0 106-107 1.3875 0.025 0.0 0.0 0.0 108-109 1.625 0.025 0.0 0.0 0.0 110-111 1.7875 0.025 0.0 0.0 0.0 112-113 1.925 0.025 0.0 0.0 0.0 114-115 2.1375 0.025 0.0 0.0 0.0 116-117 2.4749999999999996 0.025 0.0 0.0 0.0 118-119 2.675 0.025 0.0 0.0 0.0 120-121 2.9125 0.025 0.0 0.0 0.0 122-123 3.325 0.025 0.0 0.0 0.0 124-125 3.675 0.025 0.0 0.0 0.0 126-127 4.0375 0.025 0.0 0.0 0.0 128-129 4.5 0.025 0.0 0.0 0.0 130-131 4.85 0.025 0.0 0.0 0.0 132-133 5.262499999999999 0.025 0.0 0.0 0.0 134-135 5.7 0.025 0.0 0.0 0.0 136-137 6.0375 0.025 0.0 0.0 0.0 138-139 6.5125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAGGT 10 0.006830828 145.0 2 TGGATTC 10 0.006830828 145.0 9 GTCCAGG 10 0.006830828 145.0 1 AGGTTTT 10 0.006830828 145.0 5 CAGGTTT 10 0.006830828 145.0 4 TTTGTTT 10 0.006830828 145.0 9 CCAGGTT 10 0.006830828 145.0 3 CAAGTCA 10 0.006830828 145.0 8 AAGTCAA 10 0.006830828 145.0 9 >>END_MODULE SRR12917573 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917573_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2795 37.0 37.0 37.0 37.0 37.0 2 36.317 37.0 37.0 37.0 37.0 37.0 3 36.2415 37.0 37.0 37.0 37.0 37.0 4 36.361 37.0 37.0 37.0 37.0 37.0 5 36.3385 37.0 37.0 37.0 37.0 37.0 6 36.267 37.0 37.0 37.0 37.0 37.0 7 36.3635 37.0 37.0 37.0 37.0 37.0 8 36.4175 37.0 37.0 37.0 37.0 37.0 9 36.4525 37.0 37.0 37.0 37.0 37.0 10-14 36.376999999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.348800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.325700000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.2462 37.0 37.0 37.0 37.0 37.0 30-34 36.189 37.0 37.0 37.0 37.0 37.0 35-39 36.1352 37.0 37.0 37.0 37.0 37.0 40-44 36.1231 37.0 37.0 37.0 37.0 37.0 45-49 36.0907 37.0 37.0 37.0 37.0 37.0 50-54 36.0601 37.0 37.0 37.0 37.0 37.0 55-59 36.1005 37.0 37.0 37.0 37.0 37.0 60-64 36.127300000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.0315 37.0 37.0 37.0 37.0 37.0 70-74 35.9502 37.0 37.0 37.0 37.0 37.0 75-79 35.8829 37.0 37.0 37.0 37.0 37.0 80-84 35.923199999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.96040000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.971900000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.9311 37.0 37.0 37.0 37.0 37.0 100-104 35.8743 37.0 37.0 37.0 37.0 37.0 105-109 35.8004 37.0 37.0 37.0 37.0 37.0 110-114 35.7196 37.0 37.0 37.0 37.0 37.0 115-119 35.7018 37.0 37.0 37.0 37.0 37.0 120-124 35.6065 37.0 37.0 37.0 37.0 37.0 125-129 35.6394 37.0 37.0 37.0 37.0 37.0 130-134 35.558499999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.4841 37.0 37.0 37.0 37.0 37.0 140-144 35.2847 37.0 37.0 37.0 32.2 37.0 145-149 35.227700000000006 37.0 37.0 37.0 29.8 37.0 150-151 34.69125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 1.0 16 0.0 17 0.0 18 4.0 19 2.0 20 1.0 21 2.0 22 1.0 23 4.0 24 3.0 25 9.0 26 5.0 27 5.0 28 9.0 29 16.0 30 25.0 31 41.0 32 44.0 33 104.0 34 224.0 35 609.0 36 2708.0 37 180.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.675 26.375 9.3 23.65 2 27.625 24.425 32.4 15.55 3 20.7 26.174999999999997 35.55 17.575 4 23.799999999999997 33.6 24.4 18.2 5 26.8 35.65 20.724999999999998 16.825000000000003 6 20.599999999999998 41.75 21.099999999999998 16.55 7 22.625 22.375 38.2 16.8 8 21.675 25.0 30.375000000000004 22.95 9 21.224999999999998 24.725 29.925 24.125 10-14 22.85 29.154999999999998 27.689999999999998 20.305 15-19 22.895 28.875 27.560000000000002 20.669999999999998 20-24 22.605 28.865000000000002 27.91 20.62 25-29 23.59 28.225 27.284999999999997 20.9 30-34 23.015 28.084999999999997 28.585 20.315 35-39 23.244999999999997 28.804999999999996 27.389999999999997 20.560000000000002 40-44 22.61 28.360000000000003 28.57 20.46 45-49 23.22 27.900000000000002 28.235 20.645 50-54 24.2 28.749999999999996 27.145000000000003 19.905 55-59 23.51 28.26 27.689999999999998 20.54 60-64 23.49 28.585 27.83 20.095 65-69 23.419999999999998 28.7 27.92 19.96 70-74 23.965 28.095 27.735 20.205000000000002 75-79 23.66 27.85 28.560000000000002 19.93 80-84 23.39 28.225 27.875 20.51 85-89 23.695 27.21 28.475 20.62 90-94 23.990000000000002 27.725 27.83 20.455000000000002 95-99 23.565 28.044999999999998 27.82 20.57 100-104 23.544999999999998 27.750000000000004 27.839999999999996 20.865000000000002 105-109 23.09 28.595 27.845 20.47 110-114 23.87 28.03 27.57 20.53 115-119 24.16 28.655 27.415 19.77 120-124 23.76 28.13 27.665 20.445 125-129 24.505 27.935 27.534999999999997 20.025000000000002 130-134 24.654999999999998 28.13 27.455000000000002 19.759999999999998 135-139 24.245 28.610000000000003 26.77 20.375 140-144 25.035 27.994999999999997 27.525 19.445 145-149 25.595000000000002 28.060000000000002 27.07 19.275000000000002 150-151 26.7625 27.425 26.687499999999996 19.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.5 11 2.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 1.0 21 1.0 22 0.5 23 1.0 24 1.5 25 2.0 26 4.0 27 8.5 28 12.5 29 12.0 30 13.5 31 21.0 32 35.0 33 42.0 34 54.0 35 76.0 36 89.0 37 110.0 38 136.0 39 160.5 40 196.5 41 237.0 42 262.5 43 277.0 44 289.0 45 287.0 46 268.5 47 241.5 48 219.0 49 200.0 50 165.0 51 135.0 52 110.5 53 80.5 54 57.5 55 44.0 56 31.5 57 21.5 58 21.0 59 17.0 60 12.0 61 8.5 62 6.5 63 7.0 64 4.5 65 1.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.89783026641032 83.65 2 6.701455644053832 12.2 3 1.1260642680582258 3.075 4 0.19225487503433122 0.7000000000000001 5 0.08239494644328481 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTTTTATCCTCGATTACTTAAATTGAAACCAGAAGAAGTATTGATTGA 5 0.125 No Hit GTTGCATTTATCTAAAGTATTGTCACTTTACTTAACACTTGAGCTGCATA 5 0.125 No Hit CGGAAGTGGAAGTTTGTAACGAGTCAGATACAGCAGAAACCTTCCTCTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.8374999999999999 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.6749999999999998 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.3375 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 4.0375 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 4.8375 0.0 0.0 0.0 0.0 132-133 5.237500000000001 0.0 0.0 0.0 0.0 134-135 5.675 0.0 0.0 0.0 0.0 136-137 6.012499999999999 0.0 0.0 0.0 0.0 138-139 6.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCACTT 10 0.006830828 145.0 1 TGATTCA 10 0.006830828 145.0 8 GATTCAG 10 0.006830828 145.0 9 GCACTTT 10 0.006830828 145.0 2 TTGTGCT 10 0.006830828 145.0 145 >>END_MODULE Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566970 spots for SRR12917573.sra Written 566970 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra Read 566953 spots for SRR12917573.sra Written 566953 spots for SRR12917573.sra SRR ids: ['SRR12917573.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_504515jk SRR12917573.sra spots: 11339077 blocks: [[1, 566953], [566954, 1133906], [1133907, 1700859], [1700860, 2267812], [2267813, 2834765], [2834766, 3401718], [3401719, 3968671], [3968672, 4535624], [4535625, 5102577], [5102578, 5669530], [5669531, 6236483], [6236484, 6803436], [6803437, 7370389], [7370390, 7937342], [7937343, 8504295], [8504296, 9071248], [9071249, 9638201], [9638202, 10205154], [10205155, 10772107], [10772108, 11339077]] SRR12917573 file size 3831814 SRR12917573 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917573 SRR12917573_1.fastq SRR12917573_2.fastq Input file: SRR12917573_1.fastq Paired file: SRR12917573_2.fastq trimmed: SRR12917573-trimmed-pair1.fastq, SRR12917573-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:28:51 2025 >> started Thu Feb 13 14:29:03 2025 >> done (12.420s) 11339077 read pairs processed; of these: 124 ( 0.00%) short read pairs filtered out after trimming by size control 1554 ( 0.01%) empty read pairs filtered out after trimming by size control 11337399 (99.99%) read pairs available; of these: 1035617 ( 9.13%) trimmed read pairs available after processing 10301782 (90.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 4 0.00% 21 7 0.00% 22 7 0.00% 23 11 0.00% 24 16 0.00% 25 12 0.00% 26 11 0.00% 27 24 0.00% 28 6 0.00% 29 16 0.00% 30 13 0.00% 31 19 0.00% 32 16 0.00% 33 15 0.00% 34 23 0.00% 35 16 0.00% 36 17 0.00% 37 18 0.00% 38 26 0.00% 39 27 0.00% 40 32 0.00% 41 17 0.00% 42 23 0.00% 43 29 0.00% 44 38 0.00% 45 28 0.00% 46 34 0.00% 47 46 0.00% 48 52 0.00% 49 62 0.00% 50 81 0.00% 51 69 0.00% 52 80 0.00% 53 74 0.00% 54 89 0.00% 55 83 0.00% 56 104 0.00% 57 144 0.00% 58 154 0.00% 59 163 0.00% 60 167 0.00% 61 226 0.00% 62 298 0.00% 63 342 0.00% 64 346 0.00% 65 391 0.00% 66 430 0.00% 67 443 0.00% 68 507 0.00% 69 582 0.01% 70 677 0.01% 71 819 0.01% 72 931 0.01% 73 1014 0.01% 74 1135 0.01% 75 1268 0.01% 76 1423 0.01% 77 1470 0.01% 78 1683 0.01% 79 1819 0.02% 80 1963 0.02% 81 2117 0.02% 82 2452 0.02% 83 2646 0.02% 84 2998 0.03% 85 3292 0.03% 86 3391 0.03% 87 3742 0.03% 88 3943 0.03% 89 3977 0.04% 90 4280 0.04% 91 4617 0.04% 92 4950 0.04% 93 5399 0.05% 94 5781 0.05% 95 6189 0.05% 96 6468 0.06% 97 6828 0.06% 98 6965 0.06% 99 7130 0.06% 100 7535 0.07% 101 7759 0.07% 102 8017 0.07% 103 8559 0.08% 104 9097 0.08% 105 9770 0.09% 106 9941 0.09% 107 10594 0.09% 108 10803 0.10% 109 11120 0.10% 110 10982 0.10% 111 11390 0.10% 112 11904 0.10% 113 11992 0.11% 114 12973 0.11% 115 13468 0.12% 116 14152 0.12% 117 14567 0.13% 118 14971 0.13% 119 15066 0.13% 120 15609 0.14% 121 15788 0.14% 122 16009 0.14% 123 16535 0.15% 124 17478 0.15% 125 17990 0.16% 126 18505 0.16% 127 19007 0.17% 128 19600 0.17% 129 20065 0.18% 130 20340 0.18% 131 20594 0.18% 132 21057 0.19% 133 21424 0.19% 134 21768 0.19% 135 22324 0.20% 136 22956 0.20% 137 23799 0.21% 138 24651 0.22% 139 24972 0.22% 140 25776 0.23% 141 25940 0.23% 142 26473 0.23% 143 26060 0.23% 144 26963 0.24% 145 27359 0.24% 146 27453 0.24% 147 28645 0.25% 148 28787 0.25% 149 29538 0.26% 150 30677 0.27% 151 10301782 90.87% 11337399 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=24 prefix-density=0.68 prefix-fanout=2.1 sequence=GGAATTGAATTAATGAACTTGGTGGCAGCAAGGAAGGCGTTGTAGGAGGCTAAATAGCTAACTCCAGAGTCTGAACTTGTTTCACCAGCTACATTTGAAACACCTTGGAACACCACGAAGAGCTTTTCATTTGACA criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=15.64 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.9 sequence=TTATTTATTTAAGCAAAGTACCCAGCAACGCCACACATATGAAAAACAAGTAAGAGACTGGCCATGACATGGTTGCTGCATTTTTCTTTTGCGCGAGTTGCATTATTTCACTAACAAGGCTTGGCGCAAAAACAGCGGCGGCGGAACCCTTTGCATTCACCACCGGGAAAACCTTCAGTCTTGCACACACTAGCACAGTTGTGGCCTCTTACACATGGTCCTTTAAAACTATGGCTCTGTGACAAACAAACCCTAGCCTCAGCAGGTACCATCATTTCCTGGGAAGCCAGGGCAATGAGCAGCAACAAGAAAAGACCATAGCATTTCTTCTCCATCTCTCTGTCTAACAAGAACCTGTCTAACACTAGCTCTC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=26 prefix-density=0.75 prefix-fanout=2.0 sequence=CATAGAATGTCTACAGTCAATTTGGCAGCACTGCTGTTGCTTGGGCTGCTGCTGGTTATGCCACAGCAGTCCATGCAAGCGAGTTTGATAGACCCCATTGCTGAAATCGAGAGAAGCAACTGCAAAATCGCACACCTTCGCTTAGGGCTTGTTTTTAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=49.53 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.5 sequence=CACAAAGCAGTTGCATTTATCTAAAGTATT SRR12917573 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:29:46 Started mapping on | Feb 13 14:29:46 Finished on | Feb 13 14:31:09 Mapping speed, Million of reads per hour | 491.74 Number of input reads | 11337399 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10710889 Uniquely mapped reads % | 94.47% Average mapped length | 296.18 Number of splices: Total | 10210251 Number of splices: Annotated (sjdb) | 9976121 Number of splices: GT/AG | 10027603 Number of splices: GC/AG | 144842 Number of splices: AT/AC | 10037 Number of splices: Non-canonical | 27769 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 3.10 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294808 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 41698 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.42% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 331702 331702 331702 N_multimapping 294808 294808 294808 N_noFeature 395196 10572363 460363 N_ambiguous 145083 775 71213 UnstrandedReadsAssigned:10170610 PositiveStrandReadsAssigned:137751 NegativeStrandReadsAssigned:10179313 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917573 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917573-trimmed-pair1.fastq SRR12917573-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,337,399 reads, 10,201,151 reads pseudoaligned [quant] estimated average fragment length: 264.663 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR12917573.ke.tsv 34699 SRR12917573.se.tsv 87100 total ==> SRR12917573.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.34 387 21.9505 Potri.005G024800.1.v4.1 1035 771.337 142 18.3185 Potri.004G059700.1.v4.1 961 697.454 11 1.56936 Potri.007G009000.2.v4.1 1416 1152.34 0 0 Potri.003G141000.2.v4.1 2943 2679.34 364.222 13.5265 Potri.016G087400.1.v4.1 270 81.593 950 1158.56 Potri.015G069301.1.v4.1 564 314.734 0 0 Potri.010G195200.1.v4.1 1773 1509.34 86 5.66968 Potri.012G127500.1.v4.1 977 713.402 1529 213.265 ==> SRR12917573.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 36 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 176 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 22 SRR12917573 completed mapping pipeline successfully