Starting /dee2/code/volunteer_pipeline.sh SRR12917574 current disk space = 3089479065600 free memory = 1418564668 SRR12917574 SRAfilesize 16b9d3818b4fdbf2feff82ab8f7a5aee SRR12917574.sra SRR12917574.sra file validated SRR12917574 is paired end SRR12917574 is conventional basespace SRR12917574 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917574_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.59625 37.0 37.0 37.0 37.0 37.0 2 36.468 37.0 37.0 37.0 37.0 37.0 3 36.517 37.0 37.0 37.0 37.0 37.0 4 36.6085 37.0 37.0 37.0 37.0 37.0 5 36.589 37.0 37.0 37.0 37.0 37.0 6 36.674 37.0 37.0 37.0 37.0 37.0 7 36.527 37.0 37.0 37.0 37.0 37.0 8 36.5705 37.0 37.0 37.0 37.0 37.0 9 36.6335 37.0 37.0 37.0 37.0 37.0 10-14 36.625699999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.599000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.558299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.5375 37.0 37.0 37.0 37.0 37.0 30-34 36.496599999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.4602 37.0 37.0 37.0 37.0 37.0 40-44 36.4671 37.0 37.0 37.0 37.0 37.0 45-49 36.440200000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4401 37.0 37.0 37.0 37.0 37.0 55-59 36.4165 37.0 37.0 37.0 37.0 37.0 60-64 36.3596 37.0 37.0 37.0 37.0 37.0 65-69 36.230199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3312 37.0 37.0 37.0 37.0 37.0 75-79 36.3246 37.0 37.0 37.0 37.0 37.0 80-84 36.306799999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.3229 37.0 37.0 37.0 37.0 37.0 90-94 36.3135 37.0 37.0 37.0 37.0 37.0 95-99 36.200900000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1791 37.0 37.0 37.0 37.0 37.0 105-109 36.0897 37.0 37.0 37.0 37.0 37.0 110-114 36.1132 37.0 37.0 37.0 37.0 37.0 115-119 36.0064 37.0 37.0 37.0 37.0 37.0 120-124 36.021100000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.9582 37.0 37.0 37.0 37.0 37.0 130-134 35.9009 37.0 37.0 37.0 37.0 37.0 135-139 35.813399999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.751999999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.6888 37.0 37.0 37.0 37.0 37.0 150-151 35.541 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 2.0 24 2.0 25 2.0 26 5.0 27 6.0 28 9.0 29 21.0 30 16.0 31 31.0 32 32.0 33 71.0 34 112.0 35 349.0 36 3044.0 37 294.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.86296574143536 11.75293823455864 4.47611902975744 31.90797699424856 2 19.925 11.899999999999999 36.825 31.35 3 17.175 16.900000000000002 29.225 36.7 4 22.05 23.799999999999997 24.725 29.425 5 24.25 29.075 25.074999999999996 21.6 6 20.549999999999997 33.375 23.775 22.3 7 14.899999999999999 27.675 41.349999999999994 16.075 8 15.7 25.1 35.425000000000004 23.775 9 17.125 23.375 34.125 25.374999999999996 10-14 20.669999999999998 29.270000000000003 28.12 21.94 15-19 19.689999999999998 27.779999999999998 28.444999999999997 24.085 20-24 20.135 28.610000000000003 28.165000000000003 23.09 25-29 20.055 28.470000000000002 27.965 23.51 30-34 20.135 29.705 27.075 23.085 35-39 19.655 28.965000000000003 27.595 23.785 40-44 19.794999999999998 29.23 27.575 23.400000000000002 45-49 20.1 28.945 27.27 23.685000000000002 50-54 20.22 29.13 27.045 23.605 55-59 19.919999999999998 29.134999999999998 28.075 22.869999999999997 60-64 19.335 28.410000000000004 28.04 24.215 65-69 19.88 28.275 28.18 23.665 70-74 20.424999999999997 28.599999999999998 27.455000000000002 23.52 75-79 19.825 28.285 27.98 23.91 80-84 19.845 28.994999999999997 28.000000000000004 23.16 85-89 20.105 28.71 28.34 22.845 90-94 20.27 28.549999999999997 27.589999999999996 23.59 95-99 19.865 28.765 27.85 23.52 100-104 20.49 28.57 28.050000000000004 22.89 105-109 19.965 28.485 27.894999999999996 23.655 110-114 20.4 28.765 27.439999999999998 23.395 115-119 20.615 28.53 27.32 23.535 120-124 20.53 28.985 27.055 23.43 125-129 20.96 28.42 27.395000000000003 23.225 130-134 20.32 28.804999999999996 27.395000000000003 23.48 135-139 20.395 28.4 27.1 24.104999999999997 140-144 20.44 28.765 27.355 23.44 145-149 20.29 28.194999999999997 27.47 24.044999999999998 150-151 20.05 26.5375 27.825 25.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 2.0 22 2.5 23 1.5 24 3.0 25 7.5 26 7.0 27 7.5 28 15.5 29 17.0 30 17.0 31 23.5 32 29.5 33 30.0 34 43.5 35 68.0 36 90.0 37 117.5 38 139.5 39 153.5 40 188.0 41 231.5 42 260.5 43 273.5 44 268.0 45 271.5 46 266.0 47 251.0 48 225.5 49 200.0 50 177.5 51 136.5 52 104.0 53 85.5 54 74.0 55 60.0 56 39.5 57 23.5 58 19.0 59 19.5 60 15.0 61 10.0 62 7.0 63 2.5 64 2.5 65 2.5 66 1.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.49736037788274 81.425 2 8.141150319533203 14.649999999999999 3 1.0836343428730202 2.9250000000000003 4 0.27785495971103086 1.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.3875 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 3.0125 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.925 0.0 0.0 0.0 0.0 132-133 5.3875 0.0 0.0 0.0 0.0 134-135 5.85 0.0 0.0 0.0 0.0 136-137 6.4125 0.0 0.0 0.0 0.0 138-139 6.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTGAT 10 0.006830828 145.0 7 >>END_MODULE SRR12917574 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917574_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.18 37.0 37.0 37.0 37.0 37.0 2 36.119 37.0 37.0 37.0 37.0 37.0 3 36.2775 37.0 37.0 37.0 37.0 37.0 4 36.2565 37.0 37.0 37.0 37.0 37.0 5 36.45 37.0 37.0 37.0 37.0 37.0 6 36.183 37.0 37.0 37.0 37.0 37.0 7 36.251 37.0 37.0 37.0 37.0 37.0 8 36.436 37.0 37.0 37.0 37.0 37.0 9 36.341 37.0 37.0 37.0 37.0 37.0 10-14 36.3453 37.0 37.0 37.0 37.0 37.0 15-19 36.3003 37.0 37.0 37.0 37.0 37.0 20-24 36.271 37.0 37.0 37.0 37.0 37.0 25-29 36.1372 37.0 37.0 37.0 37.0 37.0 30-34 36.1168 37.0 37.0 37.0 37.0 37.0 35-39 36.0411 37.0 37.0 37.0 37.0 37.0 40-44 36.087399999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.9707 37.0 37.0 37.0 37.0 37.0 50-54 35.958600000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.956500000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.98819999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.9086 37.0 37.0 37.0 37.0 37.0 70-74 35.892999999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.7687 37.0 37.0 37.0 37.0 37.0 80-84 35.8212 37.0 37.0 37.0 37.0 37.0 85-89 35.8075 37.0 37.0 37.0 37.0 37.0 90-94 35.756899999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.7277 37.0 37.0 37.0 37.0 37.0 100-104 35.716300000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.655199999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.582 37.0 37.0 37.0 37.0 37.0 115-119 35.63289999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.436400000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.500899999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.3802 37.0 37.0 37.0 34.6 37.0 135-139 35.35549999999999 37.0 37.0 37.0 32.2 37.0 140-144 35.1742 37.0 37.0 37.0 27.4 37.0 145-149 35.057199999999995 37.0 37.0 37.0 27.4 37.0 150-151 34.545 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 2.0 16 5.0 17 3.0 18 0.0 19 2.0 20 2.0 21 3.0 22 5.0 23 7.0 24 3.0 25 11.0 26 6.0 27 8.0 28 17.0 29 21.0 30 29.0 31 40.0 32 55.0 33 102.0 34 225.0 35 621.0 36 2660.0 37 171.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.5 26.275 7.1 20.125 2 29.325000000000003 23.025000000000002 31.6 16.05 3 19.650000000000002 26.924999999999997 34.925 18.5 4 23.075000000000003 34.375 23.974999999999998 18.575 5 24.5 37.574999999999996 21.925 16.0 6 21.0 41.349999999999994 20.3 17.349999999999998 7 22.225 22.125 38.25 17.4 8 19.875 26.375 28.925 24.825 9 23.45 23.125 30.95 22.475 10-14 23.075000000000003 29.455 26.915 20.555 15-19 23.165 29.104999999999997 27.255000000000003 20.474999999999998 20-24 23.28 28.689999999999998 27.275 20.755000000000003 25-29 23.585 28.605000000000004 27.034999999999997 20.775 30-34 23.119999999999997 27.98 27.975 20.925 35-39 23.44 28.28 27.985 20.294999999999998 40-44 23.225 28.09 27.689999999999998 20.995 45-49 23.03 28.025 27.85 21.095 50-54 23.9 28.07 27.495000000000005 20.535 55-59 23.45 27.755000000000003 28.46 20.335 60-64 24.145 27.935 28.075 19.845 65-69 23.64 27.474999999999998 28.285 20.599999999999998 70-74 24.0 28.365000000000002 27.565 20.07 75-79 23.419999999999998 28.87 27.325 20.385 80-84 24.485 28.125 27.389999999999997 20.0 85-89 24.21 28.24 27.48 20.07 90-94 23.89 28.275 28.050000000000004 19.785 95-99 23.5 28.655 27.63 20.215 100-104 23.87 28.215 27.589999999999996 20.325 105-109 23.65 28.38 27.505000000000003 20.465 110-114 23.799999999999997 28.28 27.66 20.26 115-119 24.605 28.575 27.345000000000002 19.475 120-124 23.76 28.715000000000003 27.54 19.985 125-129 24.8 27.689999999999998 27.805000000000003 19.705000000000002 130-134 23.785 28.720000000000002 26.875 20.62 135-139 24.945 28.73 27.22 19.105 140-144 24.7 27.91 27.96 19.43 145-149 24.875 28.32 26.740000000000002 20.064999999999998 150-151 25.837500000000002 27.287499999999998 27.375 19.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 1.5 23 1.5 24 2.0 25 3.0 26 3.5 27 7.0 28 11.0 29 13.0 30 19.0 31 25.5 32 28.5 33 41.0 34 58.5 35 66.0 36 77.0 37 107.0 38 146.5 39 181.5 40 201.0 41 225.5 42 253.5 43 267.0 44 277.0 45 275.0 46 255.5 47 246.5 48 235.5 49 198.0 50 168.0 51 137.0 52 107.5 53 86.0 54 63.5 55 43.0 56 33.5 57 34.0 58 21.5 59 13.5 60 10.0 61 7.5 62 7.5 63 5.0 64 4.5 65 2.5 66 1.5 67 2.0 68 2.0 69 2.0 70 2.5 71 1.5 72 0.5 73 1.0 74 1.0 75 1.0 76 0.5 77 0.0 78 0.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 90.9894969596462 82.3 2 7.766721945826423 14.05 3 0.9673852957435046 2.625 4 0.24875621890547264 0.8999999999999999 5 0.027639579878385848 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.0625 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.125 0.0 0.0 0.025 0.0 88-89 0.1875 0.0 0.0 0.025 0.0 90-91 0.2625 0.0 0.0 0.025 0.0 92-93 0.42500000000000004 0.0 0.0 0.025 0.0 94-95 0.48750000000000004 0.0 0.0 0.025 0.0 96-97 0.6375 0.0 0.0 0.025 0.0 98-99 0.9125 0.0 0.0 0.025 0.0 100-101 1.0375 0.0 0.0 0.025 0.0 102-103 1.075 0.0 0.0 0.025 0.0 104-105 1.1375 0.0 0.0 0.025 0.0 106-107 1.4125 0.0 0.0 0.025 0.0 108-109 1.6 0.0 0.0 0.025 0.0 110-111 1.8125 0.0 0.0 0.025 0.0 112-113 2.0125 0.0 0.0 0.025 0.0 114-115 2.2249999999999996 0.0 0.0 0.025 0.0 116-117 2.3625 0.0 0.0 0.025 0.0 118-119 2.6 0.0 0.0 0.025 0.0 120-121 2.9875 0.0 0.0 0.025 0.0 122-123 3.4125 0.0 0.0 0.025 0.0 124-125 3.6625 0.0 0.0 0.025 0.0 126-127 4.025 0.0 0.0 0.025 0.0 128-129 4.449999999999999 0.0 0.0 0.025 0.0 130-131 4.925 0.0 0.0 0.025 0.0 132-133 5.4 0.0 0.0 0.025 0.0 134-135 5.8375 0.0 0.0 0.025 0.0 136-137 6.3625 0.0 0.0 0.025 0.0 138-139 6.6625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGATT 10 0.006830828 145.0 2 ACTAATT 10 0.006830828 145.0 6 AAGGCTC 10 0.006830828 145.0 9 AGATTGT 10 0.006830828 145.0 4 >>END_MODULE Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688283 spots for SRR12917574.sra Written 688283 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra Read 688269 spots for SRR12917574.sra Written 688269 spots for SRR12917574.sra SRR ids: ['SRR12917574.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g41fqp_u SRR12917574.sra spots: 13765394 blocks: [[1, 688269], [688270, 1376538], [1376539, 2064807], [2064808, 2753076], [2753077, 3441345], [3441346, 4129614], [4129615, 4817883], [4817884, 5506152], [5506153, 6194421], [6194422, 6882690], [6882691, 7570959], [7570960, 8259228], [8259229, 8947497], [8947498, 9635766], [9635767, 10324035], [10324036, 11012304], [11012305, 11700573], [11700574, 12388842], [12388843, 13077111], [13077112, 13765394]] SRR12917574 file size 4656382 SRR12917574 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917574 SRR12917574_1.fastq SRR12917574_2.fastq Input file: SRR12917574_1.fastq Paired file: SRR12917574_2.fastq trimmed: SRR12917574-trimmed-pair1.fastq, SRR12917574-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:43:32 2025 >> started Thu Feb 13 14:43:47 2025 >> done (14.409s) 13765394 read pairs processed; of these: 126 ( 0.00%) short read pairs filtered out after trimming by size control 1661 ( 0.01%) empty read pairs filtered out after trimming by size control 13763607 (99.99%) read pairs available; of these: 1230705 ( 8.94%) trimmed read pairs available after processing 12532902 (91.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 18 0.00% 20 13 0.00% 21 15 0.00% 22 28 0.00% 23 28 0.00% 24 16 0.00% 25 34 0.00% 26 25 0.00% 27 28 0.00% 28 30 0.00% 29 39 0.00% 30 33 0.00% 31 33 0.00% 32 24 0.00% 33 44 0.00% 34 46 0.00% 35 32 0.00% 36 33 0.00% 37 39 0.00% 38 51 0.00% 39 48 0.00% 40 43 0.00% 41 51 0.00% 42 46 0.00% 43 50 0.00% 44 48 0.00% 45 57 0.00% 46 43 0.00% 47 63 0.00% 48 72 0.00% 49 65 0.00% 50 90 0.00% 51 113 0.00% 52 117 0.00% 53 93 0.00% 54 97 0.00% 55 128 0.00% 56 136 0.00% 57 168 0.00% 58 153 0.00% 59 189 0.00% 60 240 0.00% 61 267 0.00% 62 320 0.00% 63 370 0.00% 64 388 0.00% 65 407 0.00% 66 471 0.00% 67 538 0.00% 68 563 0.00% 69 633 0.00% 70 741 0.01% 71 759 0.01% 72 939 0.01% 73 1181 0.01% 74 1293 0.01% 75 1277 0.01% 76 1518 0.01% 77 1579 0.01% 78 1784 0.01% 79 1988 0.01% 80 2153 0.02% 81 2464 0.02% 82 2802 0.02% 83 2990 0.02% 84 3493 0.03% 85 3655 0.03% 86 4021 0.03% 87 4092 0.03% 88 4501 0.03% 89 4712 0.03% 90 5059 0.04% 91 5310 0.04% 92 5836 0.04% 93 6422 0.05% 94 6613 0.05% 95 7286 0.05% 96 7772 0.06% 97 8099 0.06% 98 8517 0.06% 99 8746 0.06% 100 8838 0.06% 101 9604 0.07% 102 10237 0.07% 103 10670 0.08% 104 11253 0.08% 105 11922 0.09% 106 12338 0.09% 107 12685 0.09% 108 13236 0.10% 109 13416 0.10% 110 13497 0.10% 111 14117 0.10% 112 14545 0.11% 113 14923 0.11% 114 15598 0.11% 115 16252 0.12% 116 17007 0.12% 117 17766 0.13% 118 17957 0.13% 119 18395 0.13% 120 18647 0.14% 121 19235 0.14% 122 19475 0.14% 123 20197 0.15% 124 20467 0.15% 125 21228 0.15% 126 22005 0.16% 127 22839 0.17% 128 23311 0.17% 129 23938 0.17% 130 23791 0.17% 131 24655 0.18% 132 24942 0.18% 133 25571 0.19% 134 26082 0.19% 135 26752 0.19% 136 27171 0.20% 137 28343 0.21% 138 28819 0.21% 139 29265 0.21% 140 29789 0.22% 141 30464 0.22% 142 30882 0.22% 143 30800 0.22% 144 31846 0.23% 145 32794 0.24% 146 32480 0.24% 147 33280 0.24% 148 33663 0.24% 149 34117 0.25% 150 35311 0.26% 151 12532902 91.06% 13763607 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=33 prefix-density=0.37 prefix-fanout=2.0 sequence=TACAGTCCCCAACAAGTTCTCTCCATTCTCTGGATAATTGAAATCTCCAAATACCAGTTTACCTTTCTCCGATCCGAATTTCTTCCAGTTCCAAACTCCTGTGAAGGCAACAGCCTGCGGCACAGAAACATCACCTGGAACCATTGTTTTCTTATCCAAGCTTCCAGCATTCCCAAAATAGATGACTCCGTGAATGCTGAATCTAACTAGAAGGATTTGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=28.04 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=7.6 sequence=TCTTCTCATCACTC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=35 prefix-density=0.31 prefix-fanout=2.0 sequence=AAGCGCTCAAGGATATGAAGTTAAGAAAATGCTATTCTGATGAATGCCTGCCCGGAAAACCCAAAGTTGTCTTTGGATCGAAGAGTTCTACTTCTGATTTTTACGTTCGAAATAAAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=455.07 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=15.2 sequence=AAGAGAAGAAACACTAAAAAAATCACACAAGCGAAATCTCCAGCGAGAAGAGAAAGATGGATTTCAGAATCATGGGTCTTGACGCGCCACTCTTCAACACCCTCCAGCACATGATGGATGCAAGTGATCATGAGGCAGACAAGTCCTTCAATGCGCCAACACGCACTTACGTACGTGATGCCAAGGCAATGGCATCAACACCAGCTGATGTGAAAGAGTATCCAA SRR12917574 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:44:43 Started mapping on | Feb 13 14:44:43 Finished on | Feb 13 14:46:02 Mapping speed, Million of reads per hour | 627.20 Number of input reads | 13763607 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12062904 Uniquely mapped reads % | 87.64% Average mapped length | 293.63 Number of splices: Total | 11346996 Number of splices: Annotated (sjdb) | 11065868 Number of splices: GT/AG | 11137014 Number of splices: GC/AG | 163235 Number of splices: AT/AC | 12341 Number of splices: Non-canonical | 34406 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 345987 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 35490 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.46% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1354716 1354716 1354716 N_multimapping 345987 345987 345987 N_noFeature 451839 11923675 517707 N_ambiguous 213842 1678 139232 UnstrandedReadsAssigned:11397223 PositiveStrandReadsAssigned:137551 NegativeStrandReadsAssigned:11405965 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917574 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917574-trimmed-pair1.fastq SRR12917574-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,763,607 reads, 12,209,960 reads pseudoaligned [quant] estimated average fragment length: 263.633 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR12917574.ke.tsv 34699 SRR12917574.se.tsv 87100 total ==> SRR12917574.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.37 534 26.23 Potri.005G024800.1.v4.1 1035 772.367 87 9.71226 Potri.004G059700.1.v4.1 961 698.6 26 3.209 Potri.007G009000.2.v4.1 1416 1153.37 0 0 Potri.003G141000.2.v4.1 2943 2680.37 401.191 12.9057 Potri.016G087400.1.v4.1 270 84.15 741 759.258 Potri.015G069301.1.v4.1 564 317.005 0 0 Potri.010G195200.1.v4.1 1773 1510.37 35 1.99807 Potri.012G127500.1.v4.1 977 714.485 3865 466.425 ==> SRR12917574.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 137 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 242 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 33 SRR12917574 completed mapping pipeline successfully