Starting /dee2/code/volunteer_pipeline.sh SRR12917575 current disk space = 3089573658624 free memory = 1413436604 SRR12917575 SRAfilesize 8b35d71b91b6316527001a83050f2824 SRR12917575.sra SRR12917575.sra file validated SRR12917575 is paired end SRR12917575 is conventional basespace SRR12917575 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917575_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5095 37.0 37.0 37.0 37.0 37.0 2 36.3945 37.0 37.0 37.0 37.0 37.0 3 36.569 37.0 37.0 37.0 37.0 37.0 4 36.6305 37.0 37.0 37.0 37.0 37.0 5 36.6475 37.0 37.0 37.0 37.0 37.0 6 36.592 37.0 37.0 37.0 37.0 37.0 7 36.564 37.0 37.0 37.0 37.0 37.0 8 36.545 37.0 37.0 37.0 37.0 37.0 9 36.6375 37.0 37.0 37.0 37.0 37.0 10-14 36.6158 37.0 37.0 37.0 37.0 37.0 15-19 36.57790000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5234 37.0 37.0 37.0 37.0 37.0 25-29 36.526799999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.48909999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4279 37.0 37.0 37.0 37.0 37.0 40-44 36.4706 37.0 37.0 37.0 37.0 37.0 45-49 36.3813 37.0 37.0 37.0 37.0 37.0 50-54 36.3956 37.0 37.0 37.0 37.0 37.0 55-59 36.339800000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3363 37.0 37.0 37.0 37.0 37.0 65-69 36.2131 37.0 37.0 37.0 37.0 37.0 70-74 36.2399 37.0 37.0 37.0 37.0 37.0 75-79 36.271 37.0 37.0 37.0 37.0 37.0 80-84 36.241400000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.194500000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.180600000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.12800000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.0649 37.0 37.0 37.0 37.0 37.0 105-109 36.0877 37.0 37.0 37.0 37.0 37.0 110-114 36.1173 37.0 37.0 37.0 37.0 37.0 115-119 36.010400000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.919599999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9181 37.0 37.0 37.0 37.0 37.0 130-134 35.8591 37.0 37.0 37.0 37.0 37.0 135-139 35.7811 37.0 37.0 37.0 37.0 37.0 140-144 35.614700000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.5013 37.0 37.0 37.0 37.0 37.0 150-151 35.447 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.0 24 0.0 25 3.0 26 3.0 27 3.0 28 11.0 29 19.0 30 25.0 31 29.0 32 57.0 33 85.0 34 133.0 35 328.0 36 3033.0 37 265.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.52452452452453 12.212212212212211 4.704704704704705 33.55855855855856 2 19.475 10.575 40.0 29.95 3 16.1 16.825000000000003 31.1 35.975 4 20.45 25.1 25.424999999999997 29.025000000000002 5 22.2 31.1 25.575 21.125 6 19.7 33.2 24.224999999999998 22.875 7 15.024999999999999 27.85 41.6 15.525 8 15.6 25.275 35.15 23.974999999999998 9 16.825000000000003 23.175 36.525 23.474999999999998 10-14 19.71 29.715000000000003 27.994999999999997 22.58 15-19 19.49 28.78 27.815 23.915 20-24 19.715 28.23 28.04 24.015 25-29 19.39 29.01 27.950000000000003 23.65 30-34 19.79 28.499999999999996 28.115000000000002 23.595 35-39 19.335 29.62 27.51 23.535 40-44 19.555 28.485 27.925 24.035 45-49 19.55 28.155 28.34 23.955000000000002 50-54 19.689999999999998 28.549999999999997 28.34 23.419999999999998 55-59 19.68 28.455000000000002 27.700000000000003 24.165 60-64 19.74 28.360000000000003 27.644999999999996 24.255 65-69 20.119999999999997 28.42 27.68 23.78 70-74 20.135 28.515 27.74 23.61 75-79 19.805 28.449999999999996 28.025 23.72 80-84 19.830000000000002 27.925 28.249999999999996 23.995 85-89 19.765 28.99 27.47 23.775 90-94 19.775000000000002 28.395 27.845 23.985 95-99 19.645000000000003 27.99 28.194999999999997 24.169999999999998 100-104 19.814999999999998 28.854999999999997 27.83 23.5 105-109 20.035 28.65 27.54 23.775 110-114 20.005 28.225 27.92 23.849999999999998 115-119 20.45 28.050000000000004 27.725 23.775 120-124 20.86 27.994999999999997 27.295 23.849999999999998 125-129 20.195 28.03 27.595 24.18 130-134 20.125 28.544999999999998 27.169999999999998 24.16 135-139 20.635 27.93 27.83 23.605 140-144 20.775 28.48 26.745 24.0 145-149 20.715 27.685 27.52 24.08 150-151 20.9 28.449999999999996 26.5625 24.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 1.0 20 0.5 21 2.0 22 2.0 23 2.0 24 4.5 25 4.5 26 7.0 27 13.0 28 16.0 29 17.5 30 22.5 31 31.5 32 40.0 33 48.0 34 58.5 35 68.0 36 82.0 37 107.5 38 133.5 39 158.0 40 198.0 41 221.0 42 230.5 43 254.5 44 263.0 45 259.0 46 251.0 47 234.5 48 228.5 49 205.5 50 167.5 51 143.0 52 123.0 53 98.0 54 78.0 55 68.0 56 45.0 57 28.5 58 22.5 59 18.0 60 14.0 61 5.5 62 1.0 63 3.0 64 4.0 65 3.5 66 3.0 67 1.0 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 91.57287949492176 83.39999999999999 2 7.356574251990118 13.4 3 0.9058468295360966 2.475 4 0.08234971177600879 0.3 5 0.05489980785067252 0.25 6 0.0 0.0 7 0.02744990392533626 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTATCCCAACAAACCAAACATTGCAAATCCAATCCCAGTAA 7 0.17500000000000002 No Hit ATCAGATCCTTGAGCAAAACTTATTTCATCTGCCAAATGGAGGTTGGTTC 5 0.125 No Hit GCTTCAACCTCGGATTGCCCACCAGACAAAAACATGATTCCAGGGACGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1625 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.2625000000000002 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 3.9749999999999996 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.5875 0.0 0.0 0.0 0.0 136-137 5.0375 0.0 0.0 0.0 0.0 138-139 5.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCATT 10 0.006830828 145.0 1 ACACCAA 10 0.006830828 145.0 2 GACCATA 10 0.006830828 145.0 9 >>END_MODULE SRR12917575 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917575_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3695 37.0 37.0 37.0 37.0 37.0 2 36.25 37.0 37.0 37.0 37.0 37.0 3 36.1915 37.0 37.0 37.0 37.0 37.0 4 36.364 37.0 37.0 37.0 37.0 37.0 5 36.4375 37.0 37.0 37.0 37.0 37.0 6 36.3035 37.0 37.0 37.0 37.0 37.0 7 36.378 37.0 37.0 37.0 37.0 37.0 8 36.45 37.0 37.0 37.0 37.0 37.0 9 36.467 37.0 37.0 37.0 37.0 37.0 10-14 36.4047 37.0 37.0 37.0 37.0 37.0 15-19 36.3769 37.0 37.0 37.0 37.0 37.0 20-24 36.327 37.0 37.0 37.0 37.0 37.0 25-29 36.282199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.153999999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1168 37.0 37.0 37.0 37.0 37.0 40-44 36.146499999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0738 37.0 37.0 37.0 37.0 37.0 50-54 36.044399999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.067600000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.079699999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.9972 37.0 37.0 37.0 37.0 37.0 70-74 35.9966 37.0 37.0 37.0 37.0 37.0 75-79 35.893299999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.9658 37.0 37.0 37.0 37.0 37.0 85-89 35.9506 37.0 37.0 37.0 37.0 37.0 90-94 35.935700000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.919399999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.9019 37.0 37.0 37.0 37.0 37.0 105-109 35.873400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.849199999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.7861 37.0 37.0 37.0 37.0 37.0 120-124 35.6649 37.0 37.0 37.0 37.0 37.0 125-129 35.6519 37.0 37.0 37.0 37.0 37.0 130-134 35.612 37.0 37.0 37.0 37.0 37.0 135-139 35.58069999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.41 37.0 37.0 37.0 37.0 37.0 145-149 35.2921 37.0 37.0 37.0 29.8 37.0 150-151 34.832 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 3.0 17 1.0 18 1.0 19 1.0 20 3.0 21 7.0 22 4.0 23 2.0 24 4.0 25 4.0 26 2.0 27 8.0 28 13.0 29 23.0 30 21.0 31 40.0 32 55.0 33 83.0 34 183.0 35 609.0 36 2718.0 37 214.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.425 27.474999999999998 7.2749999999999995 20.825 2 27.950000000000003 24.75 30.825000000000003 16.475 3 19.25 27.725 35.75 17.275 4 23.525 34.150000000000006 24.375 17.95 5 26.924999999999997 36.925000000000004 20.599999999999998 15.55 6 20.599999999999998 40.875 20.674999999999997 17.849999999999998 7 20.95 22.125 38.375 18.55 8 18.95 26.674999999999997 29.65 24.725 9 22.175 23.7 30.95 23.175 10-14 23.455000000000002 29.425 27.05 20.07 15-19 24.325 28.225 26.915 20.535 20-24 23.3 28.389999999999997 28.035 20.275000000000002 25-29 24.05 27.939999999999998 27.46 20.549999999999997 30-34 23.200000000000003 27.865000000000002 28.205000000000002 20.73 35-39 23.31 27.87 27.994999999999997 20.825 40-44 23.125 27.76 28.294999999999998 20.82 45-49 22.994999999999997 27.845 28.599999999999998 20.560000000000002 50-54 23.855 27.54 27.915 20.69 55-59 23.830000000000002 27.735 27.685 20.75 60-64 23.005 27.450000000000003 28.67 20.875 65-69 23.78 28.134999999999998 27.615000000000002 20.47 70-74 24.169999999999998 28.044999999999998 27.16 20.625 75-79 23.405 28.28 27.37 20.945 80-84 23.255 27.845 27.99 20.91 85-89 23.34 28.925 27.334999999999997 20.4 90-94 24.065 27.875 27.634999999999998 20.424999999999997 95-99 24.08 27.47 28.395 20.055 100-104 23.645 27.474999999999998 28.57 20.31 105-109 24.115000000000002 28.485 27.785 19.615 110-114 23.405 27.975 27.57 21.05 115-119 24.03 28.395 27.48 20.095 120-124 24.224999999999998 27.565 28.12 20.09 125-129 24.44 27.66 27.779999999999998 20.119999999999997 130-134 24.349999999999998 27.785 27.750000000000004 20.115 135-139 24.455 27.450000000000003 27.950000000000003 20.145 140-144 25.335 27.215 27.575 19.875 145-149 24.785 27.675 27.49 20.05 150-151 25.087500000000002 27.775 27.224999999999998 19.9125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.0 21 1.5 22 0.5 23 1.5 24 3.0 25 4.5 26 5.5 27 6.0 28 7.0 29 14.0 30 18.5 31 24.0 32 30.5 33 39.5 34 50.5 35 53.0 36 73.5 37 103.5 38 141.0 39 181.0 40 190.0 41 211.5 42 262.5 43 280.0 44 271.5 45 282.5 46 283.5 47 242.5 48 215.5 49 205.5 50 161.5 51 121.0 52 113.5 53 89.0 54 64.5 55 59.0 56 50.5 57 41.0 58 24.5 59 13.5 60 10.5 61 9.5 62 6.0 63 4.0 64 2.5 65 1.0 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 1.0 72 1.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 1.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.225 #Duplication Level Percentage of deduplicated Percentage of total 1 91.69635516579885 83.65 2 7.262263633872294 13.25 3 0.9043573581803234 2.475 4 0.054809536859413546 0.2 5 0.054809536859413546 0.25 6 0.0 0.0 7 0.027404768429706773 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAACTCCTGATGAGCTGGACATGGAGGATGGGGATGAGATCGATGCTA 7 0.17500000000000002 No Hit AATGATGAGTCATGGTGCCAAGGTCTTGATGGACTCGCCTCCCGCACAGC 5 0.125 No Hit GGATCTTGCTGAAAAGAAGTATGGAAAAGTTCCATCTGGGGACACAAAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1625 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.2625000000000002 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.4625000000000004 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.3875 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 5.112500000000001 0.0 0.0 0.0 0.0 138-139 5.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCAA 10 0.006830828 145.0 5 >>END_MODULE Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683321 spots for SRR12917575.sra Written 683321 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra Read 683314 spots for SRR12917575.sra Written 683314 spots for SRR12917575.sra SRR ids: ['SRR12917575.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pnkgvx5v SRR12917575.sra spots: 13666287 blocks: [[1, 683314], [683315, 1366628], [1366629, 2049942], [2049943, 2733256], [2733257, 3416570], [3416571, 4099884], [4099885, 4783198], [4783199, 5466512], [5466513, 6149826], [6149827, 6833140], [6833141, 7516454], [7516455, 8199768], [8199769, 8883082], [8883083, 9566396], [9566397, 10249710], [10249711, 10933024], [10933025, 11616338], [11616339, 12299652], [12299653, 12982966], [12982967, 13666287]] SRR12917575 file size 4622701 SRR12917575 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917575 SRR12917575_1.fastq SRR12917575_2.fastq Input file: SRR12917575_1.fastq Paired file: SRR12917575_2.fastq trimmed: SRR12917575-trimmed-pair1.fastq, SRR12917575-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:36:24 2025 >> started Thu Feb 13 14:36:39 2025 >> done (15.162s) 13666287 read pairs processed; of these: 115 ( 0.00%) short read pairs filtered out after trimming by size control 2591 ( 0.02%) empty read pairs filtered out after trimming by size control 13663581 (99.98%) read pairs available; of these: 1172168 ( 8.58%) trimmed read pairs available after processing 12491413 (91.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 5 0.00% 20 11 0.00% 21 19 0.00% 22 23 0.00% 23 18 0.00% 24 22 0.00% 25 22 0.00% 26 32 0.00% 27 35 0.00% 28 34 0.00% 29 24 0.00% 30 43 0.00% 31 41 0.00% 32 41 0.00% 33 43 0.00% 34 33 0.00% 35 39 0.00% 36 33 0.00% 37 38 0.00% 38 81 0.00% 39 47 0.00% 40 30 0.00% 41 37 0.00% 42 48 0.00% 43 39 0.00% 44 31 0.00% 45 42 0.00% 46 38 0.00% 47 81 0.00% 48 74 0.00% 49 91 0.00% 50 80 0.00% 51 117 0.00% 52 102 0.00% 53 113 0.00% 54 125 0.00% 55 151 0.00% 56 148 0.00% 57 161 0.00% 58 207 0.00% 59 179 0.00% 60 270 0.00% 61 314 0.00% 62 368 0.00% 63 425 0.00% 64 443 0.00% 65 492 0.00% 66 581 0.00% 67 608 0.00% 68 707 0.01% 69 807 0.01% 70 909 0.01% 71 1021 0.01% 72 1239 0.01% 73 1479 0.01% 74 1433 0.01% 75 1625 0.01% 76 1844 0.01% 77 1848 0.01% 78 2184 0.02% 79 2288 0.02% 80 2473 0.02% 81 2662 0.02% 82 3045 0.02% 83 3206 0.02% 84 3606 0.03% 85 3748 0.03% 86 4043 0.03% 87 4287 0.03% 88 4437 0.03% 89 4791 0.04% 90 4885 0.04% 91 5386 0.04% 92 5767 0.04% 93 6127 0.04% 94 6390 0.05% 95 6950 0.05% 96 7200 0.05% 97 7622 0.06% 98 7612 0.06% 99 8228 0.06% 100 8328 0.06% 101 8668 0.06% 102 9317 0.07% 103 9732 0.07% 104 10258 0.08% 105 10512 0.08% 106 11187 0.08% 107 11377 0.08% 108 11750 0.09% 109 12128 0.09% 110 12157 0.09% 111 12686 0.09% 112 13357 0.10% 113 13421 0.10% 114 14368 0.11% 115 15041 0.11% 116 15613 0.11% 117 15964 0.12% 118 16485 0.12% 119 16955 0.12% 120 16977 0.12% 121 18044 0.13% 122 18185 0.13% 123 18578 0.14% 124 19241 0.14% 125 19799 0.14% 126 20939 0.15% 127 20888 0.15% 128 21901 0.16% 129 22450 0.16% 130 22637 0.17% 131 23029 0.17% 132 23612 0.17% 133 24509 0.18% 134 24885 0.18% 135 25869 0.19% 136 25972 0.19% 137 26891 0.20% 138 27420 0.20% 139 28570 0.21% 140 28604 0.21% 141 28831 0.21% 142 29711 0.22% 143 30405 0.22% 144 30703 0.22% 145 31557 0.23% 146 32214 0.24% 147 32649 0.24% 148 33383 0.24% 149 33618 0.25% 150 34852 0.26% 151 12491413 91.42% 13663581 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=30 prefix-density=0.57 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=33.89 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=9.8 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=26 prefix-density=0.36 prefix-fanout=2.2 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCAC criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=27.02 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=5.5 sequence=CAATGGCAGCAGCAACAATGGCCCTCTC SRR12917575 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:37:36 Started mapping on | Feb 13 14:37:37 Finished on | Feb 13 14:38:47 Mapping speed, Million of reads per hour | 702.70 Number of input reads | 13663581 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 11908566 Uniquely mapped reads % | 87.16% Average mapped length | 289.62 Number of splices: Total | 11681074 Number of splices: Annotated (sjdb) | 11398548 Number of splices: GT/AG | 11443119 Number of splices: GC/AG | 188228 Number of splices: AT/AC | 8049 Number of splices: Non-canonical | 41678 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291997 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 42984 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.26% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1463018 1463018 1463018 N_multimapping 291997 291997 291997 N_noFeature 449276 11755748 500590 N_ambiguous 220163 1102 117928 UnstrandedReadsAssigned:11239127 PositiveStrandReadsAssigned:151716 NegativeStrandReadsAssigned:11290048 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917575 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917575-trimmed-pair1.fastq SRR12917575-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,663,581 reads, 12,228,098 reads pseudoaligned [quant] estimated average fragment length: 261.954 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR12917575.ke.tsv 34699 SRR12917575.se.tsv 87100 total ==> SRR12917575.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.05 459 21.7117 Potri.005G024800.1.v4.1 1035 774.046 370 39.7281 Potri.004G059700.1.v4.1 961 700.2 60 7.12185 Potri.007G009000.2.v4.1 1416 1155.05 0 0 Potri.003G141000.2.v4.1 2943 2682.05 416.286 12.9 Potri.016G087400.1.v4.1 270 86.8651 857 819.972 Potri.015G069301.1.v4.1 564 319.326 0 0 Potri.010G195200.1.v4.1 1773 1512.05 38 2.08873 Potri.012G127500.1.v4.1 977 716.129 1243 144.259 ==> SRR12917575.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 48 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 62 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12917575 completed mapping pipeline successfully