Starting /dee2/code/volunteer_pipeline.sh SRR12917576 current disk space = 3089535246336 free memory = 1409186184 SRR12917576 SRAfilesize a5c7968dbc978f42cc346ec514319e18 SRR12917576.sra SRR12917576.sra file validated SRR12917576 is paired end SRR12917576 is conventional basespace SRR12917576 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917576_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.60725 37.0 37.0 37.0 37.0 37.0 2 36.417 37.0 37.0 37.0 37.0 37.0 3 36.625 37.0 37.0 37.0 37.0 37.0 4 36.6765 37.0 37.0 37.0 37.0 37.0 5 36.6635 37.0 37.0 37.0 37.0 37.0 6 36.6925 37.0 37.0 37.0 37.0 37.0 7 36.5065 37.0 37.0 37.0 37.0 37.0 8 36.5935 37.0 37.0 37.0 37.0 37.0 9 36.6985 37.0 37.0 37.0 37.0 37.0 10-14 36.567099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.61540000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5818 37.0 37.0 37.0 37.0 37.0 25-29 36.5783 37.0 37.0 37.0 37.0 37.0 30-34 36.534 37.0 37.0 37.0 37.0 37.0 35-39 36.5129 37.0 37.0 37.0 37.0 37.0 40-44 36.508500000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.4628 37.0 37.0 37.0 37.0 37.0 50-54 36.45389999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.37670000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.3326 37.0 37.0 37.0 37.0 37.0 65-69 36.2978 37.0 37.0 37.0 37.0 37.0 70-74 36.32619999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.3421 37.0 37.0 37.0 37.0 37.0 80-84 36.3284 37.0 37.0 37.0 37.0 37.0 85-89 36.2912 37.0 37.0 37.0 37.0 37.0 90-94 36.264599999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.2072 37.0 37.0 37.0 37.0 37.0 100-104 36.1717 37.0 37.0 37.0 37.0 37.0 105-109 36.0972 37.0 37.0 37.0 37.0 37.0 110-114 36.1178 37.0 37.0 37.0 37.0 37.0 115-119 36.0972 37.0 37.0 37.0 37.0 37.0 120-124 36.062 37.0 37.0 37.0 37.0 37.0 125-129 35.9427 37.0 37.0 37.0 37.0 37.0 130-134 35.9582 37.0 37.0 37.0 37.0 37.0 135-139 35.8476 37.0 37.0 37.0 37.0 37.0 140-144 35.767100000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.732 37.0 37.0 37.0 37.0 37.0 150-151 35.40475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 3.0 25 3.0 26 10.0 27 5.0 28 8.0 29 17.0 30 15.0 31 29.0 32 38.0 33 70.0 34 137.0 35 293.0 36 3076.0 37 295.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.76169042260565 13.028257064266066 5.251312828207052 34.958739684921234 2 19.475 11.025 38.574999999999996 30.925000000000004 3 17.849999999999998 16.775000000000002 28.325 37.05 4 21.125 21.25 25.525 32.1 5 23.75 30.775000000000002 24.55 20.925 6 20.875 33.375 22.7 23.05 7 14.575 28.749999999999996 40.025 16.650000000000002 8 16.75 26.650000000000002 33.45 23.150000000000002 9 17.175 24.075 36.075 22.675 10-14 19.415 29.94 27.965 22.68 15-19 19.61 28.26 28.075 24.055 20-24 19.64 28.005000000000003 28.62 23.735 25-29 19.505 27.905 28.96 23.630000000000003 30-34 19.49 29.110000000000003 27.575 23.825 35-39 19.475 28.565 27.805000000000003 24.154999999999998 40-44 19.595000000000002 29.195 27.67 23.54 45-49 19.605 28.884999999999998 27.805000000000003 23.705000000000002 50-54 19.275000000000002 28.405 28.044999999999998 24.275 55-59 19.515 28.455000000000002 28.299999999999997 23.73 60-64 19.99 28.08 28.194999999999997 23.735 65-69 19.56 28.9 28.09 23.45 70-74 19.855 28.025 28.675 23.445 75-79 19.755 28.365000000000002 27.83 24.05 80-84 19.915 28.655 26.985 24.445 85-89 19.55 27.73 28.485 24.235 90-94 19.900000000000002 28.46 27.67 23.97 95-99 19.84 28.24 27.775 24.145 100-104 20.46 27.884999999999998 27.785 23.87 105-109 20.145 27.99 27.71 24.154999999999998 110-114 20.645 28.565 27.77 23.02 115-119 20.535 28.93 26.735 23.799999999999997 120-124 20.74 28.555000000000003 27.01 23.695 125-129 19.99 28.365000000000002 27.97 23.674999999999997 130-134 20.395 27.900000000000002 27.810000000000002 23.895 135-139 20.79 27.705000000000002 27.74 23.765 140-144 20.605 28.025 27.825 23.544999999999998 145-149 20.990000000000002 28.310000000000002 27.41 23.29 150-151 20.5625 27.975 26.674999999999997 24.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 3.0 18 3.5 19 1.0 20 1.5 21 2.0 22 3.0 23 3.5 24 6.5 25 5.5 26 4.0 27 9.0 28 11.5 29 15.0 30 22.0 31 28.5 32 34.0 33 38.0 34 49.5 35 63.0 36 75.0 37 97.5 38 140.5 39 168.0 40 188.0 41 213.5 42 227.0 43 256.0 44 280.0 45 290.5 46 287.0 47 258.0 48 233.5 49 193.5 50 151.5 51 138.5 52 118.0 53 90.5 54 71.5 55 59.0 56 44.0 57 25.5 58 18.5 59 20.0 60 14.0 61 9.5 62 6.0 63 5.0 64 4.5 65 1.0 66 2.0 67 2.5 68 1.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.14999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.6267332224071 81.69999999999999 2 8.208541320022185 14.799999999999999 3 0.8874098724348309 2.4 4 0.19412090959511924 0.7000000000000001 5 0.055463117027176934 0.25 6 0.027731558513588467 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGATTTTGTGAGACATTCAAAAGGAGAAGATCAAGCTTTATTGGATACAC 6 0.15 No Hit GGCTTATCATTTCAGGCTTGATTTCAACTTGATTAAAGGTTTTGCCGTTG 5 0.125 No Hit TGGCGGAATATGAAAACTCAGGGTCCTCTTTAGTCAATATTTCCACCACA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.6124999999999998 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.6375 0.0 0.0 0.0 0.0 130-131 3.9125 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.55 0.0 0.0 0.0 0.0 136-137 4.85 0.0 0.0 0.0 0.0 138-139 5.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTGCA 10 0.006830828 145.0 8 GCCTGAC 10 0.006830828 145.0 1 >>END_MODULE SRR12917576 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917576_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.298 37.0 37.0 37.0 37.0 37.0 2 36.059 37.0 37.0 37.0 37.0 37.0 3 36.231 37.0 37.0 37.0 37.0 37.0 4 36.311 37.0 37.0 37.0 37.0 37.0 5 36.374 37.0 37.0 37.0 37.0 37.0 6 36.2765 37.0 37.0 37.0 37.0 37.0 7 36.273 37.0 37.0 37.0 37.0 37.0 8 36.346 37.0 37.0 37.0 37.0 37.0 9 36.358 37.0 37.0 37.0 37.0 37.0 10-14 36.3187 37.0 37.0 37.0 37.0 37.0 15-19 36.2118 37.0 37.0 37.0 37.0 37.0 20-24 36.2361 37.0 37.0 37.0 37.0 37.0 25-29 36.1087 37.0 37.0 37.0 37.0 37.0 30-34 36.082 37.0 37.0 37.0 37.0 37.0 35-39 36.0167 37.0 37.0 37.0 37.0 37.0 40-44 36.0358 37.0 37.0 37.0 37.0 37.0 45-49 35.927 37.0 37.0 37.0 37.0 37.0 50-54 35.944100000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.9373 37.0 37.0 37.0 37.0 37.0 60-64 35.951 37.0 37.0 37.0 37.0 37.0 65-69 35.937400000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.8936 37.0 37.0 37.0 37.0 37.0 75-79 35.783100000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.8541 37.0 37.0 37.0 37.0 37.0 85-89 35.8631 37.0 37.0 37.0 37.0 37.0 90-94 35.790499999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.7967 37.0 37.0 37.0 37.0 37.0 100-104 35.7078 37.0 37.0 37.0 37.0 37.0 105-109 35.7028 37.0 37.0 37.0 37.0 37.0 110-114 35.6529 37.0 37.0 37.0 37.0 37.0 115-119 35.609899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.5894 37.0 37.0 37.0 37.0 37.0 125-129 35.4607 37.0 37.0 37.0 37.0 37.0 130-134 35.4074 37.0 37.0 37.0 34.6 37.0 135-139 35.3743 37.0 37.0 37.0 37.0 37.0 140-144 35.2823 37.0 37.0 37.0 32.2 37.0 145-149 35.1316 37.0 37.0 37.0 27.4 37.0 150-151 34.66375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 5.0 16 1.0 17 0.0 18 5.0 19 0.0 20 2.0 21 6.0 22 5.0 23 8.0 24 3.0 25 3.0 26 13.0 27 13.0 28 21.0 29 24.0 30 27.0 31 38.0 32 53.0 33 90.0 34 210.0 35 600.0 36 2681.0 37 190.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.825 27.150000000000002 8.200000000000001 21.825 2 28.249999999999996 25.525 31.075000000000003 15.15 3 20.25 27.3 36.375 16.075 4 26.200000000000003 31.0 25.0 17.8 5 25.95 35.8 21.65 16.6 6 20.9 38.875 21.15 19.075 7 20.549999999999997 23.575 37.875 18.0 8 19.55 26.35 29.549999999999997 24.55 9 21.775 24.025 31.125000000000004 23.075000000000003 10-14 23.24 28.93 27.185 20.645 15-19 23.549999999999997 28.27 28.144999999999996 20.035 20-24 23.549999999999997 28.865000000000002 27.52 20.064999999999998 25-29 23.244999999999997 28.599999999999998 27.72 20.435 30-34 23.515 28.050000000000004 27.87 20.565 35-39 23.235 28.63 27.47 20.665 40-44 22.835 28.465 28.189999999999998 20.51 45-49 23.064999999999998 28.015 28.37 20.549999999999997 50-54 23.39 28.555000000000003 28.065 19.99 55-59 23.535 28.465 27.800000000000004 20.200000000000003 60-64 23.855 27.87 28.16 20.115 65-69 23.28 27.905 28.494999999999997 20.32 70-74 24.05 27.595 28.17 20.185 75-79 24.044999999999998 28.084999999999997 28.095 19.775000000000002 80-84 23.724999999999998 27.589999999999996 27.87 20.815 85-89 23.75 28.694999999999997 27.425 20.13 90-94 23.365 28.52 27.615000000000002 20.5 95-99 23.595 28.115000000000002 27.794999999999998 20.495 100-104 23.73 28.005000000000003 27.915 20.349999999999998 105-109 23.34 28.065 28.17 20.424999999999997 110-114 23.849999999999998 28.21 26.955000000000002 20.985 115-119 23.785 28.43 27.58 20.205000000000002 120-124 23.41 28.035 28.155 20.4 125-129 24.75 28.17 27.37 19.71 130-134 24.505 28.37 27.405 19.72 135-139 25.16 28.24 26.5 20.1 140-144 25.41 27.884999999999998 27.01 19.695 145-149 25.264999999999997 28.544999999999998 26.16 20.03 150-151 25.4 28.237499999999997 26.887499999999996 19.475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.5 8 1.5 9 0.5 10 0.0 11 1.0 12 1.0 13 0.5 14 0.5 15 0.0 16 1.0 17 2.0 18 2.0 19 1.5 20 1.5 21 2.5 22 3.5 23 4.5 24 5.0 25 6.0 26 10.5 27 9.5 28 8.5 29 14.0 30 13.0 31 20.0 32 34.0 33 42.0 34 55.5 35 70.5 36 87.0 37 105.5 38 130.5 39 170.0 40 208.5 41 230.5 42 241.5 43 268.0 44 270.5 45 273.0 46 272.0 47 238.0 48 213.0 49 197.5 50 166.0 51 134.0 52 113.0 53 91.5 54 74.0 55 51.0 56 32.0 57 22.5 58 23.0 59 19.0 60 11.5 61 6.5 62 4.5 63 8.0 64 6.5 65 1.0 66 1.5 67 2.5 68 1.5 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.275 #Duplication Level Percentage of deduplicated Percentage of total 1 90.88895042924398 82.05 2 7.864857380227083 14.2 3 0.9692605926336195 2.625 4 0.1938521185267239 0.7000000000000001 5 0.05538631957906397 0.25 6 0.0 0.0 7 0.027693159789531983 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GAAGCCTCCAGTTCAATCATCTCTCCTCTTCGAGTTAACTCATTAATGGA 5 0.125 No Hit AGAAGTTCAGTTTCAGAGGAGTTGATCTGGATGCTCTTCTGGACATGTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1749999999999998 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.6124999999999998 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.7 0.0 0.0 0.0 0.0 122-123 2.9375 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.75 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0 134-135 4.675 0.0 0.0 0.0 0.0 136-137 4.975 0.0 0.0 0.0 0.0 138-139 5.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGCA 10 0.006830828 145.0 8 >>END_MODULE Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824257 spots for SRR12917576.sra Written 824257 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra Read 824251 spots for SRR12917576.sra Written 824251 spots for SRR12917576.sra SRR ids: ['SRR12917576.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e4kbr0dh SRR12917576.sra spots: 16485026 blocks: [[1, 824251], [824252, 1648502], [1648503, 2472753], [2472754, 3297004], [3297005, 4121255], [4121256, 4945506], [4945507, 5769757], [5769758, 6594008], [6594009, 7418259], [7418260, 8242510], [8242511, 9066761], [9066762, 9891012], [9891013, 10715263], [10715264, 11539514], [11539515, 12363765], [12363766, 13188016], [13188017, 14012267], [14012268, 14836518], [14836519, 15660769], [15660770, 16485026]] SRR12917576 file size 5580632 SRR12917576 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917576 SRR12917576_1.fastq SRR12917576_2.fastq Input file: SRR12917576_1.fastq Paired file: SRR12917576_2.fastq trimmed: SRR12917576-trimmed-pair1.fastq, SRR12917576-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:39:08 2025 >> started Thu Feb 13 14:39:28 2025 >> done (19.345s) 16485026 read pairs processed; of these: 58 ( 0.00%) short read pairs filtered out after trimming by size control 2720 ( 0.02%) empty read pairs filtered out after trimming by size control 16482248 (99.98%) read pairs available; of these: 1286094 ( 7.80%) trimmed read pairs available after processing 15196154 (92.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 14 0.00% 21 16 0.00% 22 19 0.00% 23 17 0.00% 24 29 0.00% 25 31 0.00% 26 26 0.00% 27 23 0.00% 28 34 0.00% 29 34 0.00% 30 28 0.00% 31 43 0.00% 32 32 0.00% 33 35 0.00% 34 34 0.00% 35 31 0.00% 36 31 0.00% 37 44 0.00% 38 37 0.00% 39 69 0.00% 40 49 0.00% 41 41 0.00% 42 50 0.00% 43 82 0.00% 44 60 0.00% 45 82 0.00% 46 73 0.00% 47 62 0.00% 48 100 0.00% 49 100 0.00% 50 115 0.00% 51 106 0.00% 52 121 0.00% 53 154 0.00% 54 181 0.00% 55 193 0.00% 56 185 0.00% 57 219 0.00% 58 276 0.00% 59 317 0.00% 60 378 0.00% 61 436 0.00% 62 457 0.00% 63 562 0.00% 64 608 0.00% 65 674 0.00% 66 706 0.00% 67 756 0.00% 68 851 0.01% 69 1014 0.01% 70 1099 0.01% 71 1328 0.01% 72 1468 0.01% 73 1696 0.01% 74 1994 0.01% 75 2079 0.01% 76 2231 0.01% 77 2453 0.01% 78 2732 0.02% 79 2770 0.02% 80 3006 0.02% 81 3340 0.02% 82 3793 0.02% 83 4060 0.02% 84 4549 0.03% 85 4935 0.03% 86 5124 0.03% 87 5352 0.03% 88 5626 0.03% 89 5961 0.04% 90 6170 0.04% 91 6849 0.04% 92 6887 0.04% 93 7248 0.04% 94 8006 0.05% 95 8580 0.05% 96 9107 0.06% 97 9527 0.06% 98 9314 0.06% 99 9814 0.06% 100 10215 0.06% 101 10163 0.06% 102 10782 0.07% 103 11262 0.07% 104 11935 0.07% 105 12388 0.08% 106 13250 0.08% 107 13349 0.08% 108 13827 0.08% 109 13823 0.08% 110 13992 0.08% 111 14648 0.09% 112 15091 0.09% 113 15308 0.09% 114 16033 0.10% 115 16664 0.10% 116 17359 0.11% 117 17980 0.11% 118 18860 0.11% 119 18525 0.11% 120 19214 0.12% 121 19148 0.12% 122 20027 0.12% 123 20363 0.12% 124 20815 0.13% 125 21252 0.13% 126 22371 0.14% 127 22921 0.14% 128 23576 0.14% 129 24249 0.15% 130 24794 0.15% 131 24815 0.15% 132 25199 0.15% 133 25554 0.16% 134 26272 0.16% 135 26881 0.16% 136 27358 0.17% 137 28261 0.17% 138 29087 0.18% 139 29727 0.18% 140 30356 0.18% 141 30861 0.19% 142 31063 0.19% 143 31437 0.19% 144 32855 0.20% 145 32530 0.20% 146 33263 0.20% 147 33865 0.21% 148 34551 0.21% 149 34951 0.21% 150 36281 0.22% 151 15196154 92.20% 16482248 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=9.50 fanout-score-rank=8 prefix-density=0.31 prefix-fanout=4.3 sequence=CTTCTTGTCAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=232.42 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=29.7 sequence=TCATCTTCATCA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=29 prefix-density=0.22 prefix-fanout=2.8 sequence=GGGATGGAGAAGCTGGTTTCAGAGGTTGATCTTGTCAAGTCCTTTGAATGGGGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=474.85 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=13.1 sequence=AGAAAGAGAGCCTCAAGAGAAGTCTTACACTAAAACCAACAAGCCATGGCCTCGTGTCAGTGCTCCAAACCCGTTGAGCATCCATGCAACCAAGACCAGAAAAGCCACTCATCGGGCCAAAAGGTAGAGAAACAGGCTGAAGGTGGAGTCGTCAAGACCGGGACTCGCAGCTCAAGCCAAAGCC SRR12917576 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:40:14 Started mapping on | Feb 13 14:40:14 Finished on | Feb 13 14:42:47 Mapping speed, Million of reads per hour | 387.82 Number of input reads | 16482248 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15101500 Uniquely mapped reads % | 91.62% Average mapped length | 296.44 Number of splices: Total | 14634936 Number of splices: Annotated (sjdb) | 14291585 Number of splices: GT/AG | 14354582 Number of splices: GC/AG | 217038 Number of splices: AT/AC | 15185 Number of splices: Non-canonical | 48131 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.04% Deletion average length | 3.14 Insertion rate per base | 0.03% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 426614 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 52181 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.25% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 954134 954134 954134 N_multimapping 426614 426614 426614 N_noFeature 600050 14906388 692727 N_ambiguous 197412 852 94702 UnstrandedReadsAssigned:14304038 PositiveStrandReadsAssigned:194260 NegativeStrandReadsAssigned:14314071 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917576 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917576-trimmed-pair1.fastq SRR12917576-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,482,248 reads, 14,319,113 reads pseudoaligned [quant] estimated average fragment length: 270.382 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR12917576.ke.tsv 34699 SRR12917576.se.tsv 87100 total ==> SRR12917576.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.62 606 24.1415 Potri.005G024800.1.v4.1 1035 765.618 211 19.1981 Potri.004G059700.1.v4.1 961 691.744 47 4.73303 Potri.007G009000.2.v4.1 1416 1146.62 0 0 Potri.003G141000.2.v4.1 2943 2673.62 636.464 16.5829 Potri.016G087400.1.v4.1 270 78.8392 1228 1085.03 Potri.015G069301.1.v4.1 564 308.904 0 0 Potri.010G195200.1.v4.1 1773 1503.62 96 4.44755 Potri.012G127500.1.v4.1 977 707.69 6970 686.084 ==> SRR12917576.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 231 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 346 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 13 Potri.001G452600.v4.1 16 SRR12917576 completed mapping pipeline successfully