Starting /dee2/code/volunteer_pipeline.sh SRR12917577 current disk space = 3089447784448 free memory = 1417020500 SRR12917577 SRAfilesize 9936e1eb09c17e7bdda9a9d4278cf23c SRR12917577.sra SRR12917577.sra file validated SRR12917577 is paired end SRR12917577 is conventional basespace SRR12917577 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917577_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.73375 37.0 37.0 37.0 37.0 37.0 2 36.589 37.0 37.0 37.0 37.0 37.0 3 36.625 37.0 37.0 37.0 37.0 37.0 4 36.756 37.0 37.0 37.0 37.0 37.0 5 36.6645 37.0 37.0 37.0 37.0 37.0 6 36.7065 37.0 37.0 37.0 37.0 37.0 7 36.6535 37.0 37.0 37.0 37.0 37.0 8 36.6245 37.0 37.0 37.0 37.0 37.0 9 36.748 37.0 37.0 37.0 37.0 37.0 10-14 36.648199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6556 37.0 37.0 37.0 37.0 37.0 20-24 36.6315 37.0 37.0 37.0 37.0 37.0 25-29 36.605199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.552 37.0 37.0 37.0 37.0 37.0 35-39 36.5339 37.0 37.0 37.0 37.0 37.0 40-44 36.546400000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.5241 37.0 37.0 37.0 37.0 37.0 50-54 36.5013 37.0 37.0 37.0 37.0 37.0 55-59 36.5178 37.0 37.0 37.0 37.0 37.0 60-64 36.5005 37.0 37.0 37.0 37.0 37.0 65-69 36.4108 37.0 37.0 37.0 37.0 37.0 70-74 36.461600000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.4252 37.0 37.0 37.0 37.0 37.0 80-84 36.4009 37.0 37.0 37.0 37.0 37.0 85-89 36.3823 37.0 37.0 37.0 37.0 37.0 90-94 36.392399999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.3271 37.0 37.0 37.0 37.0 37.0 100-104 36.262800000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.218399999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.223 37.0 37.0 37.0 37.0 37.0 115-119 36.1695 37.0 37.0 37.0 37.0 37.0 120-124 36.133900000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.1266 37.0 37.0 37.0 37.0 37.0 130-134 35.9793 37.0 37.0 37.0 37.0 37.0 135-139 35.897 37.0 37.0 37.0 37.0 37.0 140-144 35.7304 37.0 37.0 37.0 37.0 37.0 145-149 35.6665 37.0 37.0 37.0 37.0 37.0 150-151 35.5175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 3.0 26 4.0 27 0.0 28 11.0 29 17.0 30 23.0 31 15.0 32 35.0 33 59.0 34 102.0 35 307.0 36 3073.0 37 351.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.36059014753689 12.653163290822706 4.2260565141285324 40.76019004751188 2 17.4 10.525 43.475 28.599999999999998 3 16.025 17.349999999999998 28.65 37.974999999999994 4 22.6 22.45 24.85 30.099999999999998 5 23.25 29.75 25.5 21.5 6 19.950000000000003 32.550000000000004 25.324999999999996 22.175 7 15.9 27.55 40.825 15.725 8 16.275000000000002 25.0 32.875 25.85 9 16.650000000000002 22.525000000000002 36.7 24.125 10-14 19.45 30.014999999999997 28.12 22.415 15-19 19.89 28.144999999999996 27.955000000000002 24.01 20-24 20.335 27.894999999999996 27.865000000000002 23.905 25-29 20.06 27.939999999999998 28.425 23.575 30-34 20.244999999999997 28.444999999999997 27.525 23.785 35-39 20.18 28.610000000000003 27.045 24.165 40-44 20.47 27.68 27.82 24.03 45-49 20.41 27.955000000000002 27.439999999999998 24.195 50-54 20.09 28.060000000000002 27.800000000000004 24.05 55-59 20.535 28.84 26.900000000000002 23.724999999999998 60-64 19.665 27.925 28.595 23.815 65-69 19.62 28.27 27.605 24.505 70-74 20.02 28.08 27.85 24.05 75-79 20.265 28.475 27.155 24.104999999999997 80-84 20.095 28.325 27.705000000000002 23.875 85-89 20.369999999999997 28.34 27.389999999999997 23.9 90-94 20.715 28.345 27.305 23.635 95-99 20.34 27.935 27.99 23.735 100-104 21.154999999999998 28.515 27.115000000000002 23.215 105-109 21.4 27.77 27.485 23.345 110-114 20.205000000000002 28.854999999999997 27.169999999999998 23.77 115-119 21.13 27.860000000000003 27.775 23.235 120-124 21.395 27.900000000000002 26.884999999999998 23.82 125-129 20.71 27.810000000000002 27.02 24.46 130-134 21.065 28.325 26.595000000000002 24.015 135-139 21.240000000000002 27.87 27.57 23.32 140-144 21.765 27.634999999999998 26.884999999999998 23.715 145-149 21.97 27.229999999999997 27.01 23.79 150-151 21.95 27.8875 27.224999999999998 22.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 2.0 24 3.5 25 3.5 26 2.0 27 6.0 28 9.5 29 14.0 30 23.0 31 29.0 32 25.0 33 31.5 34 47.5 35 64.0 36 91.0 37 109.0 38 123.0 39 151.0 40 175.5 41 210.5 42 241.0 43 246.0 44 256.0 45 263.5 46 254.5 47 255.0 48 248.0 49 222.5 50 191.0 51 145.0 52 111.5 53 106.5 54 94.5 55 59.5 56 43.5 57 38.0 58 29.0 59 23.5 60 17.0 61 11.5 62 8.0 63 5.0 64 1.5 65 1.5 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.00689655172414 82.475 2 7.834482758620689 14.2 3 1.0482758620689656 2.85 4 0.05517241379310345 0.2 5 0.027586206896551724 0.125 6 0.027586206896551724 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCTAGACAAAGCATTTTTCTCCCCTTCTTGATGACCAGAGCAGCACTCC 6 0.15 No Hit TGCCCTTCTCTATAGGGTACCTCTCCTTCAGTGCTGAAGACCATGTGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.3875 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.6000000000000001 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.9125 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 90-91 1.2125 0.0 0.0 0.0 0.0 92-93 1.35 0.0 0.0 0.0 0.0 94-95 1.6 0.0 0.0 0.0 0.0 96-97 1.875 0.0 0.0 0.0 0.0 98-99 2.2 0.0 0.0 0.0 0.0 100-101 2.4375 0.0 0.0 0.0 0.0 102-103 2.7875 0.0 0.0 0.0 0.0 104-105 3.1125 0.0 0.0 0.0 0.0 106-107 3.3375 0.0 0.0 0.0 0.0 108-109 3.5875 0.0 0.0 0.0 0.0 110-111 4.0625 0.0 0.0 0.0 0.0 112-113 4.475 0.0 0.0 0.0 0.0 114-115 4.875 0.0 0.0 0.0 0.0 116-117 5.3375 0.0 0.0 0.0 0.0 118-119 6.025 0.0 0.0 0.0 0.0 120-121 6.512499999999999 0.0 0.0 0.0 0.0 122-123 6.975 0.0 0.0 0.0 0.0 124-125 7.512499999999999 0.0 0.0 0.0 0.0 126-127 8.2375 0.0 0.0 0.0 0.0 128-129 8.7375 0.0 0.0 0.0 0.0 130-131 9.3375 0.0 0.0 0.0 0.0 132-133 10.2125 0.0 0.0 0.0 0.0 134-135 10.7 0.0 0.0 0.0 0.0 136-137 11.375 0.0 0.0 0.0 0.0 138-139 11.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATCAC 10 0.006830828 145.0 145 TGTGGTC 10 0.006830828 145.0 3 GGTGTCA 10 0.006830828 145.0 4 >>END_MODULE SRR12917577 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917577_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.434 37.0 37.0 37.0 37.0 37.0 2 36.4675 37.0 37.0 37.0 37.0 37.0 3 36.506 37.0 37.0 37.0 37.0 37.0 4 36.4625 37.0 37.0 37.0 37.0 37.0 5 36.491 37.0 37.0 37.0 37.0 37.0 6 36.412 37.0 37.0 37.0 37.0 37.0 7 36.5085 37.0 37.0 37.0 37.0 37.0 8 36.549 37.0 37.0 37.0 37.0 37.0 9 36.561 37.0 37.0 37.0 37.0 37.0 10-14 36.5621 37.0 37.0 37.0 37.0 37.0 15-19 36.486399999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4528 37.0 37.0 37.0 37.0 37.0 25-29 36.3515 37.0 37.0 37.0 37.0 37.0 30-34 36.3434 37.0 37.0 37.0 37.0 37.0 35-39 36.2902 37.0 37.0 37.0 37.0 37.0 40-44 36.2626 37.0 37.0 37.0 37.0 37.0 45-49 36.216899999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.2219 37.0 37.0 37.0 37.0 37.0 55-59 36.2321 37.0 37.0 37.0 37.0 37.0 60-64 36.2059 37.0 37.0 37.0 37.0 37.0 65-69 36.2069 37.0 37.0 37.0 37.0 37.0 70-74 36.2037 37.0 37.0 37.0 37.0 37.0 75-79 36.1588 37.0 37.0 37.0 37.0 37.0 80-84 36.132 37.0 37.0 37.0 37.0 37.0 85-89 36.1956 37.0 37.0 37.0 37.0 37.0 90-94 36.2007 37.0 37.0 37.0 37.0 37.0 95-99 36.1136 37.0 37.0 37.0 37.0 37.0 100-104 36.1144 37.0 37.0 37.0 37.0 37.0 105-109 36.057100000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.98270000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.9625 37.0 37.0 37.0 37.0 37.0 120-124 35.8582 37.0 37.0 37.0 37.0 37.0 125-129 35.7743 37.0 37.0 37.0 37.0 37.0 130-134 35.702999999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.6183 37.0 37.0 37.0 37.0 37.0 140-144 35.437599999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.2534 37.0 37.0 37.0 29.8 37.0 150-151 34.775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 4.0 16 1.0 17 1.0 18 1.0 19 2.0 20 2.0 21 3.0 22 2.0 23 3.0 24 5.0 25 5.0 26 2.0 27 8.0 28 6.0 29 15.0 30 4.0 31 16.0 32 46.0 33 72.0 34 161.0 35 511.0 36 2890.0 37 239.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.918959479739875 26.038019009504755 7.753876938469234 28.289144572286144 2 24.7 23.075000000000003 35.75 16.475 3 18.05 26.974999999999998 35.925000000000004 19.05 4 23.175 32.7 24.675 19.45 5 25.224999999999998 37.4 22.25 15.125 6 19.975 39.800000000000004 21.725 18.5 7 19.3 22.275 39.65 18.775 8 19.2 24.975 31.025000000000002 24.8 9 22.25 23.425 31.775 22.55 10-14 23.685000000000002 29.18 26.55 20.585 15-19 23.135 28.27 27.634999999999998 20.96 20-24 22.91 28.62 27.665 20.805 25-29 22.665 27.98 28.59 20.765 30-34 23.165 28.265 27.525 21.044999999999998 35-39 22.74 27.894999999999996 27.495000000000005 21.87 40-44 22.545 28.4 28.395 20.66 45-49 22.935 28.01 27.715 21.34 50-54 22.75 27.965 28.04 21.245 55-59 23.044999999999998 28.335 27.55 21.07 60-64 23.855 27.384999999999998 27.93 20.830000000000002 65-69 23.135 27.634999999999998 28.060000000000002 21.17 70-74 23.11 28.189999999999998 27.060000000000002 21.64 75-79 22.795 28.175 27.534999999999997 21.495 80-84 23.03 28.09 27.575 21.305 85-89 23.18 27.85 27.245 21.725 90-94 23.345 28.13 27.625 20.9 95-99 23.79 28.375 27.355 20.48 100-104 23.919999999999998 28.005000000000003 27.37 20.705000000000002 105-109 24.37 28.48 26.924999999999997 20.225 110-114 24.175 28.09 27.245 20.49 115-119 25.09 28.410000000000004 26.615 19.885 120-124 25.035 27.555000000000003 26.97 20.44 125-129 25.805 27.939999999999998 26.400000000000002 19.855 130-134 26.384999999999998 28.29 26.064999999999998 19.259999999999998 135-139 26.6 27.605 26.295 19.5 140-144 27.12 27.150000000000002 26.095000000000002 19.634999999999998 145-149 28.015 27.665 25.540000000000003 18.78 150-151 28.9875 27.224999999999998 25.162499999999998 18.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 1.0 24 4.5 25 7.0 26 7.0 27 9.5 28 10.5 29 11.5 30 13.5 31 16.0 32 25.5 33 37.5 34 42.0 35 53.5 36 78.5 37 108.5 38 149.0 39 187.5 40 196.5 41 207.0 42 240.5 43 281.5 44 279.5 45 277.0 46 289.5 47 254.5 48 204.5 49 189.0 50 172.5 51 130.5 52 107.5 53 95.0 54 74.5 55 52.0 56 40.0 57 32.0 58 27.0 59 22.5 60 17.5 61 10.5 62 6.5 63 6.5 64 3.0 65 0.0 66 0.5 67 1.5 68 1.0 69 0.0 70 0.0 71 1.0 72 1.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.2 82.65 2 7.475862068965518 13.55 3 1.186206896551724 3.225 4 0.05517241379310345 0.2 5 0.08275862068965517 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 5 0.125 No Hit GCATTTCAAGCACTCTTCGCTAGAGAGGTATTGCCCCAGAGCTTCTCACC 5 0.125 No Hit CATCATCATCACAACCATGGCAGCTGCAGTAACTGCTGCAGTCTCCTTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.3875 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.6000000000000001 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.9125 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.375 0.0 0.0 0.0 0.0 94-95 1.625 0.0 0.0 0.0 0.0 96-97 1.9 0.0 0.0 0.0 0.0 98-99 2.2249999999999996 0.0 0.0 0.0 0.0 100-101 2.4625000000000004 0.0 0.0 0.0 0.0 102-103 2.8125 0.0 0.0 0.0 0.0 104-105 3.1375 0.0 0.0 0.0 0.0 106-107 3.35 0.0 0.0 0.0 0.0 108-109 3.5875 0.0 0.0 0.0 0.0 110-111 4.0625 0.0 0.0 0.0 0.0 112-113 4.475 0.0 0.0 0.0 0.0 114-115 4.9 0.0 0.0 0.0 0.0 116-117 5.3625 0.0 0.0 0.0 0.0 118-119 6.074999999999999 0.0 0.0 0.0 0.0 120-121 6.5625 0.0 0.0 0.0 0.0 122-123 7.025 0.0 0.0 0.0 0.0 124-125 7.5625 0.0 0.0 0.0 0.0 126-127 8.2875 0.0 0.0 0.0 0.0 128-129 8.787500000000001 0.0 0.0 0.0 0.0 130-131 9.3875 0.0 0.0 0.0 0.0 132-133 10.25 0.0 0.0 0.0 0.0 134-135 10.725000000000001 0.0 0.0 0.0 0.0 136-137 11.375 0.0 0.0 0.0 0.0 138-139 11.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 330 7.585186E-10 8.787879 140-144 >>END_MODULE Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726491 spots for SRR12917577.sra Written 726491 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra Read 726477 spots for SRR12917577.sra Written 726477 spots for SRR12917577.sra SRR ids: ['SRR12917577.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n65rxe29 SRR12917577.sra spots: 14529554 blocks: [[1, 726477], [726478, 1452954], [1452955, 2179431], [2179432, 2905908], [2905909, 3632385], [3632386, 4358862], [4358863, 5085339], [5085340, 5811816], [5811817, 6538293], [6538294, 7264770], [7264771, 7991247], [7991248, 8717724], [8717725, 9444201], [9444202, 10170678], [10170679, 10897155], [10897156, 11623632], [11623633, 12350109], [12350110, 13076586], [13076587, 13803063], [13803064, 14529554]] SRR12917577 file size 4916077 SRR12917577 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917577 SRR12917577_1.fastq SRR12917577_2.fastq Input file: SRR12917577_1.fastq Paired file: SRR12917577_2.fastq trimmed: SRR12917577-trimmed-pair1.fastq, SRR12917577-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:45:50 2025 >> started Thu Feb 13 14:46:06 2025 >> done (16.435s) 14529554 read pairs processed; of these: 121 ( 0.00%) short read pairs filtered out after trimming by size control 954 ( 0.01%) empty read pairs filtered out after trimming by size control 14528479 (99.99%) read pairs available; of these: 2569372 (17.69%) trimmed read pairs available after processing 11959107 (82.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 11 0.00% 21 8 0.00% 22 13 0.00% 23 11 0.00% 24 16 0.00% 25 18 0.00% 26 11 0.00% 27 27 0.00% 28 21 0.00% 29 18 0.00% 30 34 0.00% 31 27 0.00% 32 17 0.00% 33 26 0.00% 34 25 0.00% 35 35 0.00% 36 44 0.00% 37 30 0.00% 38 37 0.00% 39 41 0.00% 40 25 0.00% 41 49 0.00% 42 49 0.00% 43 54 0.00% 44 62 0.00% 45 67 0.00% 46 84 0.00% 47 91 0.00% 48 111 0.00% 49 120 0.00% 50 124 0.00% 51 179 0.00% 52 213 0.00% 53 239 0.00% 54 253 0.00% 55 295 0.00% 56 326 0.00% 57 426 0.00% 58 426 0.00% 59 509 0.00% 60 624 0.00% 61 736 0.01% 62 861 0.01% 63 1060 0.01% 64 1134 0.01% 65 1270 0.01% 66 1447 0.01% 67 1575 0.01% 68 1767 0.01% 69 2026 0.01% 70 2403 0.02% 71 2745 0.02% 72 3193 0.02% 73 3558 0.02% 74 4042 0.03% 75 4452 0.03% 76 4801 0.03% 77 5174 0.04% 78 5772 0.04% 79 6179 0.04% 80 6750 0.05% 81 7400 0.05% 82 7973 0.05% 83 8979 0.06% 84 9937 0.07% 85 11000 0.08% 86 11446 0.08% 87 11737 0.08% 88 12370 0.09% 89 13079 0.09% 90 13442 0.09% 91 14513 0.10% 92 15239 0.10% 93 16595 0.11% 94 17616 0.12% 95 19228 0.13% 96 19748 0.14% 97 20767 0.14% 98 21410 0.15% 99 21652 0.15% 100 22151 0.15% 101 22443 0.15% 102 23722 0.16% 103 24708 0.17% 104 26047 0.18% 105 27561 0.19% 106 28466 0.20% 107 29845 0.21% 108 30192 0.21% 109 31180 0.21% 110 30515 0.21% 111 31691 0.22% 112 32322 0.22% 113 32783 0.23% 114 34573 0.24% 115 36143 0.25% 116 37386 0.26% 117 38736 0.27% 118 40222 0.28% 119 40532 0.28% 120 40893 0.28% 121 41910 0.29% 122 41788 0.29% 123 42649 0.29% 124 43347 0.30% 125 44118 0.30% 126 45942 0.32% 127 47111 0.32% 128 48281 0.33% 129 48942 0.34% 130 49767 0.34% 131 48934 0.34% 132 50064 0.34% 133 50518 0.35% 134 50674 0.35% 135 51450 0.35% 136 53017 0.36% 137 53793 0.37% 138 55459 0.38% 139 56969 0.39% 140 56651 0.39% 141 56671 0.39% 142 57188 0.39% 143 57141 0.39% 144 57589 0.40% 145 57874 0.40% 146 58085 0.40% 147 59221 0.41% 148 60498 0.42% 149 60057 0.41% 150 61671 0.42% 151 11959107 82.31% 14528479 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.59 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=433.35 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=21 prefix-density=0.46 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.20 sequence-density-rank=18 fanout-score=15.50 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=6.1 sequence=AGCAATGGCAGCA SRR12917577 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:46:48 Started mapping on | Feb 13 14:46:49 Finished on | Feb 13 14:48:03 Mapping speed, Million of reads per hour | 706.79 Number of input reads | 14528479 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13852108 Uniquely mapped reads % | 95.34% Average mapped length | 290.93 Number of splices: Total | 13601680 Number of splices: Annotated (sjdb) | 13336313 Number of splices: GT/AG | 13317924 Number of splices: GC/AG | 229768 Number of splices: AT/AC | 8728 Number of splices: Non-canonical | 45260 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 292954 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 35052 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 383417 383417 383417 N_multimapping 292954 292954 292954 N_noFeature 503305 13668810 578943 N_ambiguous 196296 761 88234 UnstrandedReadsAssigned:13152507 PositiveStrandReadsAssigned:182537 NegativeStrandReadsAssigned:13184931 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917577 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917577-trimmed-pair1.fastq SRR12917577-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,528,479 reads, 13,156,267 reads pseudoaligned [quant] estimated average fragment length: 232.096 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR12917577.ke.tsv 34699 SRR12917577.se.tsv 87100 total ==> SRR12917577.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.9 500 21.5793 Potri.005G024800.1.v4.1 1035 803.904 382 36.6461 Potri.004G059700.1.v4.1 961 730.04 56 5.91575 Potri.007G009000.2.v4.1 1416 1184.9 0 0 Potri.003G141000.2.v4.1 2943 2711.9 610.795 17.3696 Potri.016G087400.1.v4.1 270 95.8305 681 548.04 Potri.015G069301.1.v4.1 564 343.027 0 0 Potri.010G195200.1.v4.1 1773 1541.9 31 1.5505 Potri.012G127500.1.v4.1 977 745.968 296 30.6013 ==> SRR12917577.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 59 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 164 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 29 Potri.001G452600.v4.1 3 SRR12917577 completed mapping pipeline successfully