Starting /dee2/code/volunteer_pipeline.sh SRR12917578 current disk space = 3089334931456 free memory = 1448409088 SRR12917578 SRAfilesize bf6069f192089a2e06419614b9b87df5 SRR12917578.sra SRR12917578.sra file validated SRR12917578 is paired end SRR12917578 is conventional basespace SRR12917578 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917578_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.60425 37.0 37.0 37.0 37.0 37.0 2 36.527 37.0 37.0 37.0 37.0 37.0 3 36.666 37.0 37.0 37.0 37.0 37.0 4 36.751 37.0 37.0 37.0 37.0 37.0 5 36.608 37.0 37.0 37.0 37.0 37.0 6 36.7445 37.0 37.0 37.0 37.0 37.0 7 36.55 37.0 37.0 37.0 37.0 37.0 8 36.6025 37.0 37.0 37.0 37.0 37.0 9 36.685 37.0 37.0 37.0 37.0 37.0 10-14 36.662200000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.6414 37.0 37.0 37.0 37.0 37.0 20-24 36.62579999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.584199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.5265 37.0 37.0 37.0 37.0 37.0 35-39 36.4913 37.0 37.0 37.0 37.0 37.0 40-44 36.505700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3953 37.0 37.0 37.0 37.0 37.0 50-54 36.5098 37.0 37.0 37.0 37.0 37.0 55-59 36.4056 37.0 37.0 37.0 37.0 37.0 60-64 36.42220000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.3352 37.0 37.0 37.0 37.0 37.0 70-74 36.3283 37.0 37.0 37.0 37.0 37.0 75-79 36.3172 37.0 37.0 37.0 37.0 37.0 80-84 36.356100000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.34740000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.339200000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.194100000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.139500000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1357 37.0 37.0 37.0 37.0 37.0 110-114 36.169799999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1224 37.0 37.0 37.0 37.0 37.0 120-124 36.0741 37.0 37.0 37.0 37.0 37.0 125-129 35.8999 37.0 37.0 37.0 37.0 37.0 130-134 35.7843 37.0 37.0 37.0 37.0 37.0 135-139 35.597500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.2686 37.0 37.0 37.0 34.6 37.0 145-149 34.966699999999996 37.0 37.0 37.0 27.4 37.0 150-151 34.78275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 1.0 23 2.0 24 2.0 25 3.0 26 1.0 27 9.0 28 4.0 29 12.0 30 18.0 31 34.0 32 52.0 33 97.0 34 140.0 35 354.0 36 2958.0 37 311.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.38309577394349 12.153038259564891 4.451112778194548 51.012753188297076 2 15.25 11.725 46.125 26.900000000000002 3 15.9 15.75 29.25 39.1 4 22.05 24.0 23.375 30.575000000000003 5 24.474999999999998 31.900000000000002 24.125 19.5 6 19.825 32.324999999999996 25.575 22.275 7 15.525 28.175 40.400000000000006 15.9 8 14.625 25.75 35.25 24.375 9 15.875 22.675 35.65 25.8 10-14 19.945 29.18 28.005000000000003 22.869999999999997 15-19 19.575 28.205000000000002 27.765 24.455 20-24 19.625 28.199999999999996 27.834999999999997 24.34 25-29 20.05 28.605000000000004 27.87 23.474999999999998 30-34 20.255000000000003 28.58 26.950000000000003 24.215 35-39 19.585 27.644999999999996 28.265 24.505 40-44 20.445 28.71 27.265 23.580000000000002 45-49 20.11 28.294999999999998 27.779999999999998 23.815 50-54 20.07 28.15 27.744999999999997 24.035 55-59 20.349999999999998 27.96 28.1 23.59 60-64 19.875 27.82 28.485 23.82 65-69 20.235 27.865000000000002 27.865000000000002 24.035 70-74 20.335 28.57 27.73 23.365 75-79 19.205 28.585 27.955000000000002 24.255 80-84 20.615 28.494999999999997 27.389999999999997 23.5 85-89 20.555 28.050000000000004 27.575 23.82 90-94 21.2 28.405 26.97 23.425 95-99 20.765 27.644999999999996 28.115000000000002 23.474999999999998 100-104 21.765 28.38 26.834999999999997 23.02 105-109 21.07 28.965000000000003 27.055 22.91 110-114 21.029999999999998 28.455000000000002 27.125 23.39 115-119 20.835 28.285 26.755000000000003 24.125 120-124 20.544999999999998 28.439999999999998 26.615 24.4 125-129 21.015 28.595 26.38 24.01 130-134 20.9 28.77 25.924999999999997 24.404999999999998 135-139 21.605 27.365000000000002 26.529999999999998 24.5 140-144 21.305 28.449999999999996 26.115 24.13 145-149 21.485000000000003 28.044999999999998 26.13 24.34 150-151 21.462500000000002 28.325 27.0 23.2125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 2.0 22 3.0 23 3.0 24 3.5 25 4.5 26 8.5 27 9.5 28 11.0 29 17.0 30 19.0 31 24.0 32 34.0 33 41.0 34 52.0 35 60.0 36 79.0 37 103.5 38 120.0 39 155.5 40 186.5 41 205.5 42 233.0 43 233.5 44 237.5 45 262.0 46 276.0 47 265.0 48 241.5 49 231.0 50 201.0 51 157.5 52 118.0 53 87.0 54 70.0 55 57.5 56 46.0 57 36.0 58 24.0 59 17.5 60 15.5 61 11.5 62 8.5 63 5.0 64 2.0 65 2.5 66 3.5 67 2.5 68 0.5 69 0.5 70 2.0 71 2.0 72 1.0 73 2.0 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.05 #Duplication Level Percentage of deduplicated Percentage of total 1 92.3139598044541 84.975 2 6.92558392178164 12.75 3 0.5975013579576317 1.6500000000000001 4 0.13579576317218903 0.5 5 0.027159152634437803 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAATGGGAATATGCATTCTCAATTTGTATGTGAAAAAAAAATGCAAGTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.1125 0.0 0.0 0.0 0.0 88-89 1.3625 0.0 0.0 0.0 0.0 90-91 1.625 0.0 0.0 0.0 0.0 92-93 2.05 0.0 0.0 0.0 0.0 94-95 2.4124999999999996 0.0 0.0 0.0 0.0 96-97 2.925 0.0 0.0 0.0 0.0 98-99 3.4124999999999996 0.0 0.0 0.0 0.0 100-101 3.8875 0.0 0.0 0.0 0.0 102-103 4.525 0.0 0.0 0.0 0.0 104-105 5.2125 0.0 0.0 0.0 0.0 106-107 5.7125 0.0 0.0 0.0 0.0 108-109 6.3625 0.0 0.0 0.0 0.0 110-111 6.975 0.0 0.0 0.0 0.0 112-113 7.612500000000001 0.0 0.0 0.0 0.0 114-115 8.3875 0.0 0.0 0.0 0.0 116-117 8.9375 0.0 0.0 0.0 0.0 118-119 9.7375 0.0 0.0 0.0 0.0 120-121 10.4875 0.0 0.0 0.0 0.0 122-123 11.075 0.0 0.0 0.0 0.0 124-125 11.55 0.0 0.0 0.0 0.0 126-127 12.1875 0.0 0.0 0.0 0.0 128-129 12.8 0.0 0.0 0.0 0.0 130-131 13.325 0.0 0.0 0.0 0.0 132-133 14.2375 0.0 0.0 0.0 0.0 134-135 15.075 0.0 0.0 0.0 0.0 136-137 15.825 0.0 0.0 0.0 0.0 138-139 16.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917578 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917578_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.447 37.0 37.0 37.0 37.0 37.0 2 36.4635 37.0 37.0 37.0 37.0 37.0 3 36.5075 37.0 37.0 37.0 37.0 37.0 4 36.5075 37.0 37.0 37.0 37.0 37.0 5 36.5995 37.0 37.0 37.0 37.0 37.0 6 36.4265 37.0 37.0 37.0 37.0 37.0 7 36.562 37.0 37.0 37.0 37.0 37.0 8 36.581 37.0 37.0 37.0 37.0 37.0 9 36.5975 37.0 37.0 37.0 37.0 37.0 10-14 36.496900000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.488200000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.462900000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.3809 37.0 37.0 37.0 37.0 37.0 30-34 36.3129 37.0 37.0 37.0 37.0 37.0 35-39 36.28240000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.3004 37.0 37.0 37.0 37.0 37.0 45-49 36.2235 37.0 37.0 37.0 37.0 37.0 50-54 36.156600000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.2005 37.0 37.0 37.0 37.0 37.0 60-64 36.1666 37.0 37.0 37.0 37.0 37.0 65-69 36.1762 37.0 37.0 37.0 37.0 37.0 70-74 36.132999999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0272 37.0 37.0 37.0 37.0 37.0 80-84 36.1141 37.0 37.0 37.0 37.0 37.0 85-89 36.1158 37.0 37.0 37.0 37.0 37.0 90-94 36.1177 37.0 37.0 37.0 37.0 37.0 95-99 36.047000000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.003699999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.9383 37.0 37.0 37.0 37.0 37.0 110-114 35.880500000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.7775 37.0 37.0 37.0 37.0 37.0 120-124 35.630700000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.5946 37.0 37.0 37.0 37.0 37.0 130-134 35.419799999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.3194 37.0 37.0 37.0 32.2 37.0 140-144 34.9214 37.0 37.0 37.0 25.0 37.0 145-149 34.5992 37.0 37.0 37.0 25.0 37.0 150-151 34.057500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.0 19 0.0 20 1.0 21 0.0 22 3.0 23 3.0 24 4.0 25 7.0 26 4.0 27 13.0 28 15.0 29 10.0 30 18.0 31 34.0 32 54.0 33 117.0 34 208.0 35 548.0 36 2719.0 37 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.5 22.75 9.25 34.5 2 23.325000000000003 24.575 37.375 14.725 3 19.575 26.125 35.0 19.3 4 23.3 34.35 23.925 18.425 5 26.325 38.3 20.424999999999997 14.95 6 19.400000000000002 39.275 22.650000000000002 18.675 7 20.375 21.95 39.050000000000004 18.625 8 18.275 25.75 31.275 24.7 9 21.125 23.3 32.275 23.3 10-14 22.59 28.77 27.675 20.965 15-19 22.975 27.915 27.625 21.485000000000003 20-24 22.745 28.410000000000004 27.685 21.16 25-29 22.49 27.615000000000002 29.095 20.8 30-34 22.61 27.765 28.15 21.475 35-39 23.03 27.605 27.705000000000002 21.66 40-44 23.205000000000002 28.110000000000003 27.900000000000002 20.785 45-49 22.509999999999998 28.28 28.005000000000003 21.205 50-54 23.665 27.6 27.51 21.224999999999998 55-59 23.25 27.884999999999998 28.050000000000004 20.815 60-64 23.32 27.700000000000003 28.225 20.755000000000003 65-69 23.13 27.705000000000002 27.950000000000003 21.215 70-74 23.335 27.91 27.665 21.09 75-79 23.34 27.985 27.79 20.885 80-84 23.845 27.435 27.700000000000003 21.02 85-89 23.935000000000002 28.249999999999996 27.42 20.395 90-94 23.665 27.85 26.905 21.58 95-99 23.865 28.815 27.045 20.275000000000002 100-104 24.25 28.235 26.889999999999997 20.625 105-109 24.52 27.905 27.26 20.315 110-114 25.319999999999997 28.03 26.995 19.655 115-119 25.290000000000003 28.34 26.474999999999998 19.895 120-124 25.869999999999997 27.810000000000002 26.790000000000003 19.53 125-129 26.605 27.82 26.025 19.55 130-134 27.089999999999996 28.02 25.874999999999996 19.015 135-139 27.98 27.055 26.340000000000003 18.625 140-144 28.005000000000003 27.525 25.605 18.865000000000002 145-149 29.354999999999997 26.86 25.64 18.145 150-151 29.6625 26.400000000000002 26.137500000000003 17.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 1.0 20 2.0 21 2.5 22 2.5 23 1.0 24 2.5 25 4.0 26 5.0 27 7.5 28 10.0 29 13.5 30 17.5 31 20.5 32 36.0 33 49.0 34 57.0 35 69.5 36 95.5 37 118.5 38 136.0 39 165.0 40 181.5 41 216.0 42 239.5 43 245.0 44 258.5 45 264.5 46 249.0 47 236.0 48 231.5 49 200.5 50 168.5 51 147.0 52 117.5 53 90.5 54 79.5 55 65.5 56 47.0 57 38.0 58 28.0 59 19.5 60 16.5 61 11.5 62 7.0 63 5.5 64 4.0 65 1.0 66 1.0 67 2.0 68 2.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.5 97 1.0 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.85 #Duplication Level Percentage of deduplicated Percentage of total 1 92.18835057158411 84.675 2 7.022318998366902 12.9 3 0.5988023952095809 1.6500000000000001 4 0.1360914534567229 0.5 5 0.027218290691344585 0.125 6 0.027218290691344585 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTTATAGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCT 6 0.15 No Hit TTGTAATTTGAGTATCTTGTGTAAACTTGCTGTCAAACTCTGTCCACTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.44999999999999996 0.0 0.0 0.0 0.0 80-81 0.5375 0.0 0.0 0.0 0.0 82-83 0.75 0.0 0.0 0.0 0.0 84-85 0.8875 0.0 0.0 0.0 0.0 86-87 1.0875 0.0 0.0 0.0 0.0 88-89 1.3375 0.0 0.0 0.0 0.0 90-91 1.6 0.0 0.0 0.0 0.0 92-93 2.025 0.0 0.0 0.0 0.0 94-95 2.3875 0.0 0.0 0.0 0.0 96-97 2.9 0.0 0.0 0.0 0.0 98-99 3.375 0.0 0.0 0.0 0.0 100-101 3.8375 0.0 0.0 0.0 0.0 102-103 4.475 0.0 0.0 0.0 0.0 104-105 5.175 0.0 0.0 0.0 0.0 106-107 5.6875 0.0 0.0 0.0 0.0 108-109 6.3375 0.0 0.0 0.0 0.0 110-111 6.987500000000001 0.0 0.0 0.0 0.0 112-113 7.612500000000001 0.0 0.0 0.0 0.0 114-115 8.4 0.0 0.0 0.0 0.0 116-117 8.9625 0.0 0.0 0.0 0.0 118-119 9.774999999999999 0.0 0.0 0.0 0.0 120-121 10.525 0.0 0.0 0.0 0.0 122-123 11.225000000000001 0.0 0.0 0.0 0.0 124-125 11.75 0.0 0.0 0.0 0.0 126-127 12.3875 0.0 0.0 0.0 0.0 128-129 13.0 0.0 0.0 0.0 0.0 130-131 13.5125 0.0 0.0 0.0 0.0 132-133 14.4375 0.0 0.0 0.0 0.0 134-135 15.2625 0.0 0.0 0.0 0.0 136-137 16.0 0.0 0.0 0.0 0.0 138-139 16.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTATC 10 0.006830828 145.0 1 GGGGGGG 220 0.009102302 6.5909095 145 >>END_MODULE Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482998 spots for SRR12917578.sra Written 482998 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra Read 482995 spots for SRR12917578.sra Written 482995 spots for SRR12917578.sra SRR ids: ['SRR12917578.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v2tij7k2 SRR12917578.sra spots: 9659903 blocks: [[1, 482995], [482996, 965990], [965991, 1448985], [1448986, 1931980], [1931981, 2414975], [2414976, 2897970], [2897971, 3380965], [3380966, 3863960], [3863961, 4346955], [4346956, 4829950], [4829951, 5312945], [5312946, 5795940], [5795941, 6278935], [6278936, 6761930], [6761931, 7244925], [7244926, 7727920], [7727921, 8210915], [8210916, 8693910], [8693911, 9176905], [9176906, 9659903]] SRR12917578 file size 3261821 SRR12917578 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917578 SRR12917578_1.fastq SRR12917578_2.fastq Input file: SRR12917578_1.fastq Paired file: SRR12917578_2.fastq trimmed: SRR12917578-trimmed-pair1.fastq, SRR12917578-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:52:54 2025 >> started Thu Feb 13 14:53:05 2025 >> done (10.613s) 9659903 read pairs processed; of these: 78 ( 0.00%) short read pairs filtered out after trimming by size control 725 ( 0.01%) empty read pairs filtered out after trimming by size control 9659100 (99.99%) read pairs available; of these: 2219740 (22.98%) trimmed read pairs available after processing 7439360 (77.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 11 0.00% 20 4 0.00% 21 4 0.00% 22 10 0.00% 23 11 0.00% 24 7 0.00% 25 9 0.00% 26 13 0.00% 27 18 0.00% 28 8 0.00% 29 15 0.00% 30 10 0.00% 31 14 0.00% 32 19 0.00% 33 22 0.00% 34 23 0.00% 35 25 0.00% 36 25 0.00% 37 29 0.00% 38 30 0.00% 39 36 0.00% 40 41 0.00% 41 43 0.00% 42 44 0.00% 43 52 0.00% 44 70 0.00% 45 68 0.00% 46 89 0.00% 47 83 0.00% 48 117 0.00% 49 137 0.00% 50 151 0.00% 51 215 0.00% 52 219 0.00% 53 282 0.00% 54 310 0.00% 55 343 0.00% 56 435 0.00% 57 420 0.00% 58 552 0.01% 59 655 0.01% 60 781 0.01% 61 918 0.01% 62 1136 0.01% 63 1351 0.01% 64 1406 0.01% 65 1551 0.02% 66 1772 0.02% 67 2071 0.02% 68 2303 0.02% 69 2545 0.03% 70 3044 0.03% 71 3477 0.04% 72 4042 0.04% 73 4618 0.05% 74 5199 0.05% 75 5471 0.06% 76 6191 0.06% 77 6506 0.07% 78 7182 0.07% 79 7931 0.08% 80 8487 0.09% 81 9323 0.10% 82 10091 0.10% 83 11023 0.11% 84 12287 0.13% 85 13075 0.14% 86 13861 0.14% 87 14512 0.15% 88 15191 0.16% 89 15520 0.16% 90 16208 0.17% 91 16912 0.18% 92 17696 0.18% 93 18839 0.20% 94 20092 0.21% 95 21552 0.22% 96 21874 0.23% 97 22643 0.23% 98 23206 0.24% 99 23393 0.24% 100 24360 0.25% 101 24717 0.26% 102 25695 0.27% 103 26094 0.27% 104 26717 0.28% 105 27591 0.29% 106 28338 0.29% 107 29717 0.31% 108 29625 0.31% 109 30587 0.32% 110 30408 0.31% 111 31019 0.32% 112 31406 0.33% 113 31302 0.32% 114 32245 0.33% 115 33520 0.35% 116 33880 0.35% 117 34685 0.36% 118 35505 0.37% 119 35694 0.37% 120 36241 0.38% 121 35880 0.37% 122 36015 0.37% 123 36382 0.38% 124 36246 0.38% 125 37302 0.39% 126 38251 0.40% 127 38039 0.39% 128 38628 0.40% 129 38550 0.40% 130 39254 0.41% 131 39182 0.41% 132 39184 0.41% 133 39319 0.41% 134 38627 0.40% 135 38802 0.40% 136 39666 0.41% 137 40120 0.42% 138 40366 0.42% 139 41449 0.43% 140 41036 0.42% 141 40755 0.42% 142 41082 0.43% 143 40525 0.42% 144 40692 0.42% 145 40425 0.42% 146 40425 0.42% 147 40763 0.42% 148 41331 0.43% 149 41011 0.42% 150 41132 0.43% 151 7439360 77.02% 9659100 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=18 prefix-density=0.51 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.15 sequence-density-rank=18 fanout-score=10.47 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=4.0 sequence=TTGCAGCCATTCTC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=20 prefix-density=0.66 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=45.19 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.2 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTATGGCGATGGTTGTTAGTGCACCTCTAGCAGAAGCTGCCATCTCATGCGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAGGCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR12917578 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:54:46 Started mapping on | Feb 13 14:54:47 Finished on | Feb 13 14:55:50 Mapping speed, Million of reads per hour | 551.95 Number of input reads | 9659100 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 9172854 Uniquely mapped reads % | 94.97% Average mapped length | 286.34 Number of splices: Total | 8833414 Number of splices: Annotated (sjdb) | 8631576 Number of splices: GT/AG | 8655458 Number of splices: GC/AG | 144980 Number of splices: AT/AC | 6203 Number of splices: Non-canonical | 26773 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 224522 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 60774 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.96% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 261724 261724 261724 N_multimapping 224522 224522 224522 N_noFeature 372939 9061485 420093 N_ambiguous 123233 437 58796 UnstrandedReadsAssigned:8676682 PositiveStrandReadsAssigned:110932 NegativeStrandReadsAssigned:8693965 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR12917578 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917578-trimmed-pair1.fastq SRR12917578-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,659,100 reads, 8,715,248 reads pseudoaligned [quant] estimated average fragment length: 225.694 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR12917578.ke.tsv 34699 SRR12917578.se.tsv 87100 total ==> SRR12917578.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.31 270 18.9045 Potri.005G024800.1.v4.1 1035 810.306 254 39.3587 Potri.004G059700.1.v4.1 961 736.463 23 3.92132 Potri.007G009000.2.v4.1 1416 1191.31 0 0 Potri.003G141000.2.v4.1 2943 2718.31 305 14.0883 Potri.016G087400.1.v4.1 270 104.976 701 838.465 Potri.015G069301.1.v4.1 564 351.98 0 0 Potri.010G195200.1.v4.1 1773 1548.31 14 1.13534 Potri.012G127500.1.v4.1 977 752.385 239 39.8853 ==> SRR12917578.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 105 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12917578 completed mapping pipeline successfully