Starting /dee2/code/volunteer_pipeline.sh SRR12917579 current disk space = 3089349636096 free memory = 1408630416 SRR12917579 SRAfilesize 429244bff37f17f13ba065ff33121fc9 SRR12917579.sra SRR12917579.sra file validated SRR12917579 is paired end SRR12917579 is conventional basespace SRR12917579 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917579_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5845 37.0 37.0 37.0 37.0 37.0 2 36.5585 37.0 37.0 37.0 37.0 37.0 3 36.6235 37.0 37.0 37.0 37.0 37.0 4 36.7045 37.0 37.0 37.0 37.0 37.0 5 36.6875 37.0 37.0 37.0 37.0 37.0 6 36.721 37.0 37.0 37.0 37.0 37.0 7 36.6365 37.0 37.0 37.0 37.0 37.0 8 36.604 37.0 37.0 37.0 37.0 37.0 9 36.6575 37.0 37.0 37.0 37.0 37.0 10-14 36.6865 37.0 37.0 37.0 37.0 37.0 15-19 36.657000000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.63439999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.594300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.561800000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.549400000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.540499999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.5132 37.0 37.0 37.0 37.0 37.0 50-54 36.468399999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.4563 37.0 37.0 37.0 37.0 37.0 60-64 36.4547 37.0 37.0 37.0 37.0 37.0 65-69 36.303900000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.37949999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.39149999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.3452 37.0 37.0 37.0 37.0 37.0 85-89 36.355399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.3695 37.0 37.0 37.0 37.0 37.0 95-99 36.2663 37.0 37.0 37.0 37.0 37.0 100-104 36.2368 37.0 37.0 37.0 37.0 37.0 105-109 36.194 37.0 37.0 37.0 37.0 37.0 110-114 36.171 37.0 37.0 37.0 37.0 37.0 115-119 36.1232 37.0 37.0 37.0 37.0 37.0 120-124 36.1238 37.0 37.0 37.0 37.0 37.0 125-129 35.9697 37.0 37.0 37.0 37.0 37.0 130-134 35.9329 37.0 37.0 37.0 37.0 37.0 135-139 35.9184 37.0 37.0 37.0 37.0 37.0 140-144 35.6168 37.0 37.0 37.0 37.0 37.0 145-149 35.522800000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.21725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 1.0 26 4.0 27 10.0 28 6.0 29 16.0 30 22.0 31 26.0 32 35.0 33 60.0 34 114.0 35 333.0 36 3013.0 37 356.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.0440220110055 14.057028514257128 5.127563781890945 42.77138569284642 2 17.625 11.5 40.725 30.15 3 17.325 16.675 27.800000000000004 38.2 4 22.325 22.925 23.65 31.1 5 22.825 29.799999999999997 25.5 21.875 6 19.75 34.375 23.575 22.3 7 15.75 27.250000000000004 41.25 15.75 8 15.75 24.575 34.725 24.95 9 18.8 22.45 35.475 23.275000000000002 10-14 19.54 30.14 27.750000000000004 22.57 15-19 20.29 27.794999999999998 28.215 23.7 20-24 20.485 28.37 27.685 23.46 25-29 19.7 28.405 28.565 23.330000000000002 30-34 19.89 28.76 27.48 23.87 35-39 19.875 28.38 27.529999999999998 24.215 40-44 20.24 28.76 27.284999999999997 23.715 45-49 20.43 28.395 27.465 23.71 50-54 20.080000000000002 27.884999999999998 28.050000000000004 23.985 55-59 20.044999999999998 28.285 27.715 23.955000000000002 60-64 20.28 27.860000000000003 27.67 24.19 65-69 20.68 28.144999999999996 27.52 23.655 70-74 20.630000000000003 27.395000000000003 28.335 23.64 75-79 20.055 28.49 27.825 23.630000000000003 80-84 20.599999999999998 28.660000000000004 27.205000000000002 23.535 85-89 20.580000000000002 28.615000000000002 27.355 23.45 90-94 20.16 29.325000000000003 27.11 23.405 95-99 20.73 28.439999999999998 27.384999999999998 23.445 100-104 21.59 28.415000000000003 26.86 23.135 105-109 20.785 28.76 27.139999999999997 23.315 110-114 21.335 28.025 27.155 23.485 115-119 21.255 28.615000000000002 26.295 23.835 120-124 20.595 28.499999999999996 26.575 24.33 125-129 21.02 28.555000000000003 26.44 23.985 130-134 21.09 27.985 26.82 24.104999999999997 135-139 21.715 27.405 26.68 24.2 140-144 20.715 27.944999999999997 26.200000000000003 25.14 145-149 21.37 26.939999999999998 26.700000000000003 24.990000000000002 150-151 21.8625 27.650000000000002 26.55 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 2.5 26 4.5 27 7.5 28 11.0 29 18.5 30 20.5 31 21.0 32 38.5 33 45.5 34 45.0 35 58.5 36 80.5 37 112.5 38 130.0 39 148.5 40 192.0 41 207.0 42 225.0 43 257.0 44 255.0 45 252.5 46 252.0 47 259.5 48 253.5 49 219.5 50 186.5 51 152.0 52 123.0 53 103.5 54 84.5 55 62.5 56 48.0 57 31.5 58 16.5 59 17.5 60 15.0 61 9.0 62 9.0 63 7.0 64 3.0 65 1.5 66 1.0 67 1.0 68 2.0 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.40346058775062 83.2 2 7.552870090634441 13.750000000000002 3 0.8514144465806098 2.325 4 0.16478989288656962 0.6 5 0.027464982147761604 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGGACTTGTACTGTAACAAAAAGCTATAGTCACGTTCTTCCGTGTTAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.5249999999999999 0.0 0.0 0.0 0.0 80-81 0.6625000000000001 0.0 0.0 0.0 0.0 82-83 0.825 0.0 0.0 0.0 0.0 84-85 1.0625 0.0 0.0 0.0 0.0 86-87 1.35 0.0 0.0 0.0 0.0 88-89 1.6 0.0 0.0 0.0 0.0 90-91 1.85 0.0 0.0 0.0 0.0 92-93 2.0625 0.0 0.0 0.0 0.0 94-95 2.45 0.0 0.0 0.0 0.0 96-97 2.8875 0.0 0.0 0.0 0.0 98-99 3.475 0.0 0.0 0.0 0.0 100-101 3.8625 0.0 0.0 0.0 0.0 102-103 4.5 0.0 0.0 0.0 0.0 104-105 5.0 0.0 0.0 0.0 0.0 106-107 5.5875 0.0 0.0 0.0 0.0 108-109 6.4375 0.0 0.0 0.0 0.0 110-111 7.0375 0.0 0.0 0.0 0.0 112-113 7.550000000000001 0.0 0.0 0.0 0.0 114-115 8.287500000000001 0.0 0.0 0.0 0.0 116-117 8.925 0.0 0.0 0.0 0.0 118-119 9.8 0.0 0.0 0.0 0.0 120-121 10.575 0.0 0.0 0.0 0.0 122-123 11.3 0.0 0.0 0.0 0.0 124-125 12.225000000000001 0.0 0.0 0.0 0.0 126-127 13.1125 0.0 0.0 0.0 0.0 128-129 14.025 0.0 0.0 0.0 0.0 130-131 14.875 0.0 0.0 0.0 0.0 132-133 15.7375 0.0 0.0 0.0 0.0 134-135 16.6625 0.0 0.0 0.0 0.0 136-137 17.4125 0.0 0.0 0.0 0.0 138-139 18.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTGAT 10 0.006830828 145.0 3 GCAATTG 10 0.006830828 145.0 3 TTTTTTT 40 0.0076550315 18.125 30-34 >>END_MODULE SRR12917579 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917579_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.34525 37.0 37.0 37.0 37.0 37.0 2 36.1485 37.0 37.0 37.0 37.0 37.0 3 36.234 37.0 37.0 37.0 37.0 37.0 4 36.3295 37.0 37.0 37.0 37.0 37.0 5 36.399 37.0 37.0 37.0 37.0 37.0 6 36.288 37.0 37.0 37.0 37.0 37.0 7 36.444 37.0 37.0 37.0 37.0 37.0 8 36.392 37.0 37.0 37.0 37.0 37.0 9 36.5245 37.0 37.0 37.0 37.0 37.0 10-14 36.4157 37.0 37.0 37.0 37.0 37.0 15-19 36.3792 37.0 37.0 37.0 37.0 37.0 20-24 36.3127 37.0 37.0 37.0 37.0 37.0 25-29 36.2553 37.0 37.0 37.0 37.0 37.0 30-34 36.16760000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.2036 37.0 37.0 37.0 37.0 37.0 40-44 36.2358 37.0 37.0 37.0 37.0 37.0 45-49 36.091300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.1185 37.0 37.0 37.0 37.0 37.0 55-59 36.158100000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.0535 37.0 37.0 37.0 37.0 37.0 65-69 36.0579 37.0 37.0 37.0 37.0 37.0 70-74 36.065 37.0 37.0 37.0 37.0 37.0 75-79 35.93 37.0 37.0 37.0 37.0 37.0 80-84 35.9692 37.0 37.0 37.0 37.0 37.0 85-89 35.9969 37.0 37.0 37.0 37.0 37.0 90-94 35.9926 37.0 37.0 37.0 37.0 37.0 95-99 35.9468 37.0 37.0 37.0 37.0 37.0 100-104 35.8637 37.0 37.0 37.0 37.0 37.0 105-109 35.785199999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.7277 37.0 37.0 37.0 37.0 37.0 115-119 35.609700000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.4748 37.0 37.0 37.0 37.0 37.0 125-129 35.3591 37.0 37.0 37.0 37.0 37.0 130-134 35.2065 37.0 37.0 37.0 32.2 37.0 135-139 35.0612 37.0 37.0 37.0 25.0 37.0 140-144 34.682500000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.3574 37.0 37.0 37.0 25.0 37.0 150-151 33.83075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 4.0 16 2.0 17 0.0 18 2.0 19 0.0 20 0.0 21 2.0 22 2.0 23 2.0 24 4.0 25 3.0 26 6.0 27 7.0 28 16.0 29 9.0 30 21.0 31 48.0 32 78.0 33 132.0 34 245.0 35 617.0 36 2609.0 37 186.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.2093023255814 25.156289072268066 8.32708177044261 29.307326831707925 2 26.650000000000002 24.825 33.725 14.799999999999999 3 20.200000000000003 27.700000000000003 33.75 18.35 4 23.625 32.5 25.775 18.099999999999998 5 26.0 37.5 21.0 15.5 6 21.325 38.925 21.475 18.275 7 20.474999999999998 22.275 39.1 18.15 8 19.75 26.200000000000003 29.875 24.175 9 23.025000000000002 23.875 30.25 22.85 10-14 23.1 29.244999999999997 26.355 21.3 15-19 23.815 27.825 27.275 21.085 20-24 23.18 28.235 27.744999999999997 20.84 25-29 23.525 27.810000000000002 27.644999999999996 21.02 30-34 23.52 27.82 27.975 20.685000000000002 35-39 23.685000000000002 27.815 27.625 20.875 40-44 23.455000000000002 27.584999999999997 28.125 20.835 45-49 23.05 28.155 28.084999999999997 20.71 50-54 24.240000000000002 27.61 27.750000000000004 20.4 55-59 23.44 27.474999999999998 28.050000000000004 21.035 60-64 23.845 27.27 27.77 21.115000000000002 65-69 23.665 27.99 27.715 20.630000000000003 70-74 23.369999999999997 28.33 27.52 20.78 75-79 23.68 28.175 27.57 20.575 80-84 23.375 28.82 27.334999999999997 20.47 85-89 23.585 28.615000000000002 27.01 20.79 90-94 23.97 28.465 26.825 20.74 95-99 24.895 28.03 27.334999999999997 19.74 100-104 23.97 27.99 27.0 21.04 105-109 24.935 28.634999999999998 26.77 19.66 110-114 25.0 28.09 27.200000000000003 19.71 115-119 26.02 27.855 26.55 19.575 120-124 25.96 27.88 26.745 19.415 125-129 26.729999999999997 28.000000000000004 26.340000000000003 18.93 130-134 27.36 27.625 25.990000000000002 19.025 135-139 27.83 26.924999999999997 26.200000000000003 19.045 140-144 29.044999999999998 26.169999999999998 26.3 18.485 145-149 29.625 25.985000000000003 26.529999999999998 17.86 150-151 31.0625 25.5 25.6 17.837500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 1.0 22 0.5 23 0.0 24 1.0 25 2.5 26 3.0 27 3.0 28 7.0 29 13.0 30 18.0 31 21.0 32 31.0 33 39.5 34 44.5 35 51.0 36 77.0 37 108.5 38 127.0 39 175.0 40 214.0 41 221.5 42 253.5 43 269.0 44 257.5 45 256.0 46 257.5 47 262.0 48 228.0 49 188.5 50 167.0 51 151.5 52 139.5 53 107.0 54 72.0 55 50.5 56 41.0 57 33.5 58 24.0 59 21.0 60 15.5 61 8.0 62 7.0 63 3.5 64 1.0 65 1.0 66 0.5 67 1.0 68 1.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 1.0 92 1.0 93 0.5 94 0.5 95 0.0 96 1.0 97 1.0 98 1.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.55470249520154 83.475 2 7.485604606525912 13.65 3 0.7677543186180422 2.1 4 0.13709898546750754 0.5 5 0.027419797093501508 0.125 6 0.027419797093501508 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GTTTGCTTTCTTTTTGGCGTTCTTCTAAAAAAAAAAATCAATGGAAGAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.3625 0.0 0.0 0.0 0.0 78-79 0.5249999999999999 0.0 0.0 0.0 0.0 80-81 0.6875 0.0 0.0 0.0 0.0 82-83 0.8500000000000001 0.0 0.0 0.0 0.0 84-85 1.0875 0.0 0.0 0.0 0.0 86-87 1.375 0.0 0.0 0.0 0.0 88-89 1.625 0.0 0.0 0.0 0.0 90-91 1.875 0.0 0.0 0.0 0.0 92-93 2.0875000000000004 0.0 0.0 0.0 0.0 94-95 2.4749999999999996 0.0 0.0 0.0 0.0 96-97 2.9125 0.0 0.0 0.0 0.0 98-99 3.5 0.0 0.0 0.0 0.0 100-101 3.8875 0.0 0.0 0.0 0.0 102-103 4.525 0.0 0.0 0.0 0.0 104-105 5.025 0.0 0.0 0.0 0.0 106-107 5.6125 0.0 0.0 0.0 0.0 108-109 6.4625 0.0 0.0 0.0 0.0 110-111 7.0625 0.0 0.0 0.0 0.0 112-113 7.574999999999999 0.0 0.0 0.0 0.0 114-115 8.3125 0.0 0.0 0.0 0.0 116-117 8.95 0.0 0.0 0.0 0.0 118-119 9.8 0.0 0.0 0.0 0.0 120-121 10.575 0.0 0.0 0.0 0.0 122-123 11.350000000000001 0.0 0.0 0.0 0.0 124-125 12.274999999999999 0.0 0.0 0.0 0.0 126-127 13.1625 0.0 0.0 0.0 0.0 128-129 14.0875 0.0 0.0 0.0 0.0 130-131 14.975 0.0 0.0 0.0 0.0 132-133 15.8375 0.0 0.0 0.0 0.0 134-135 16.762500000000003 0.0 0.0 0.0 0.0 136-137 17.5 0.0 0.0 0.0 0.0 138-139 18.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAATTC 10 0.006830828 145.0 1 CCCTTGA 10 0.006830828 145.0 7 AAAAAAA 55 0.0025160722 15.818182 40-44 >>END_MODULE Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra Read 600894 spots for SRR12917579.sra Written 600894 spots for SRR12917579.sra Read 600879 spots for SRR12917579.sra Written 600879 spots for SRR12917579.sra SRR ids: ['SRR12917579.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b4m3hknd SRR12917579.sra spots: 12017595 blocks: [[1, 600879], [600880, 1201758], [1201759, 1802637], [1802638, 2403516], [2403517, 3004395], [3004396, 3605274], [3605275, 4206153], [4206154, 4807032], [4807033, 5407911], [5407912, 6008790], [6008791, 6609669], [6609670, 7210548], [7210549, 7811427], [7811428, 8412306], [8412307, 9013185], [9013186, 9614064], [9614065, 10214943], [10214944, 10815822], [10815823, 11416701], [11416702, 12017595]] SRR12917579 file size 4062404 SRR12917579 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917579 SRR12917579_1.fastq SRR12917579_2.fastq Input file: SRR12917579_1.fastq Paired file: SRR12917579_2.fastq trimmed: SRR12917579-trimmed-pair1.fastq, SRR12917579-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:51:39 2025 >> started Thu Feb 13 14:51:52 2025 >> done (13.173s) 12017595 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 1921 ( 0.02%) empty read pairs filtered out after trimming by size control 12015580 (99.98%) read pairs available; of these: 2815507 (23.43%) trimmed read pairs available after processing 9200073 (76.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 9 0.00% 21 7 0.00% 22 8 0.00% 23 10 0.00% 24 11 0.00% 25 4 0.00% 26 17 0.00% 27 19 0.00% 28 14 0.00% 29 14 0.00% 30 19 0.00% 31 22 0.00% 32 31 0.00% 33 25 0.00% 34 24 0.00% 35 25 0.00% 36 32 0.00% 37 50 0.00% 38 43 0.00% 39 52 0.00% 40 43 0.00% 41 49 0.00% 42 63 0.00% 43 63 0.00% 44 47 0.00% 45 78 0.00% 46 80 0.00% 47 127 0.00% 48 121 0.00% 49 150 0.00% 50 197 0.00% 51 198 0.00% 52 253 0.00% 53 268 0.00% 54 328 0.00% 55 320 0.00% 56 353 0.00% 57 409 0.00% 58 522 0.00% 59 548 0.00% 60 716 0.01% 61 893 0.01% 62 986 0.01% 63 1126 0.01% 64 1360 0.01% 65 1421 0.01% 66 1616 0.01% 67 1801 0.01% 68 2023 0.02% 69 2298 0.02% 70 2737 0.02% 71 3127 0.03% 72 3608 0.03% 73 4157 0.03% 74 4585 0.04% 75 5310 0.04% 76 5729 0.05% 77 6106 0.05% 78 6518 0.05% 79 7290 0.06% 80 8172 0.07% 81 9199 0.08% 82 10282 0.09% 83 11196 0.09% 84 12787 0.11% 85 13907 0.12% 86 15186 0.13% 87 15925 0.13% 88 16684 0.14% 89 17483 0.15% 90 18365 0.15% 91 19267 0.16% 92 20524 0.17% 93 22269 0.19% 94 23680 0.20% 95 25952 0.22% 96 26553 0.22% 97 27803 0.23% 98 28697 0.24% 99 29528 0.25% 100 30162 0.25% 101 30459 0.25% 102 31425 0.26% 103 32340 0.27% 104 34123 0.28% 105 35737 0.30% 106 37152 0.31% 107 38022 0.32% 108 38321 0.32% 109 39603 0.33% 110 39368 0.33% 111 39934 0.33% 112 39774 0.33% 113 40390 0.34% 114 41147 0.34% 115 43576 0.36% 116 44687 0.37% 117 45389 0.38% 118 46435 0.39% 119 46489 0.39% 120 46820 0.39% 121 47139 0.39% 122 46977 0.39% 123 47616 0.40% 124 47720 0.40% 125 48313 0.40% 126 49436 0.41% 127 50790 0.42% 128 51215 0.43% 129 51462 0.43% 130 51941 0.43% 131 51183 0.43% 132 50938 0.42% 133 51478 0.43% 134 51003 0.42% 135 51141 0.43% 136 51894 0.43% 137 52490 0.44% 138 52954 0.44% 139 55035 0.46% 140 53965 0.45% 141 54459 0.45% 142 53427 0.44% 143 53184 0.44% 144 53274 0.44% 145 53323 0.44% 146 53013 0.44% 147 53236 0.44% 148 54708 0.46% 149 54018 0.45% 150 55290 0.46% 151 9200073 76.57% 12015580 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=20 prefix-density=0.55 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=102.33 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=14.7 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTA criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=21 prefix-density=0.62 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=84.22 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.6 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12917579 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:52:34 Started mapping on | Feb 13 14:52:34 Finished on | Feb 13 14:53:47 Mapping speed, Million of reads per hour | 592.55 Number of input reads | 12015580 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 11401624 Uniquely mapped reads % | 94.89% Average mapped length | 286.57 Number of splices: Total | 10685846 Number of splices: Annotated (sjdb) | 10450932 Number of splices: GT/AG | 10453078 Number of splices: GC/AG | 190442 Number of splices: AT/AC | 7785 Number of splices: Non-canonical | 34541 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289495 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 28910 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 324461 324461 324461 N_multimapping 289495 289495 289495 N_noFeature 404401 11235650 470306 N_ambiguous 181946 604 81553 UnstrandedReadsAssigned:10815277 PositiveStrandReadsAssigned:165370 NegativeStrandReadsAssigned:10849765 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR12917579 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917579-trimmed-pair1.fastq SRR12917579-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,015,580 reads, 10,909,475 reads pseudoaligned [quant] estimated average fragment length: 219.288 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR12917579.ke.tsv 34699 SRR12917579.se.tsv 87100 total ==> SRR12917579.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.71 325 16.6037 Potri.005G024800.1.v4.1 1035 816.712 292 32.873 Potri.004G059700.1.v4.1 961 742.867 22 2.72293 Potri.007G009000.2.v4.1 1416 1197.71 0 0 Potri.003G141000.2.v4.1 2943 2724.71 441.154 14.8865 Potri.016G087400.1.v4.1 270 104.757 657 576.641 Potri.015G069301.1.v4.1 564 356.066 0 0 Potri.010G195200.1.v4.1 1773 1554.71 23 1.3602 Potri.012G127500.1.v4.1 977 758.821 229 27.7473 ==> SRR12917579.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 295 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 137 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR12917579 completed mapping pipeline successfully