Starting /dee2/code/volunteer_pipeline.sh SRR12917580 current disk space = 3088817262592 free memory = 1578887120 SRR12917580 SRAfilesize 14160cea10d584f0a1b0239f73de9918 SRR12917580.sra SRR12917580.sra file validated SRR12917580 is paired end SRR12917580 is conventional basespace SRR12917580 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917580_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.67925 37.0 37.0 37.0 37.0 37.0 2 36.5195 37.0 37.0 37.0 37.0 37.0 3 36.686 37.0 37.0 37.0 37.0 37.0 4 36.701 37.0 37.0 37.0 37.0 37.0 5 36.747 37.0 37.0 37.0 37.0 37.0 6 36.6715 37.0 37.0 37.0 37.0 37.0 7 36.6085 37.0 37.0 37.0 37.0 37.0 8 36.6675 37.0 37.0 37.0 37.0 37.0 9 36.645 37.0 37.0 37.0 37.0 37.0 10-14 36.6439 37.0 37.0 37.0 37.0 37.0 15-19 36.6446 37.0 37.0 37.0 37.0 37.0 20-24 36.58200000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.56750000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.519 37.0 37.0 37.0 37.0 37.0 35-39 36.5447 37.0 37.0 37.0 37.0 37.0 40-44 36.529199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.478199999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.5055 37.0 37.0 37.0 37.0 37.0 55-59 36.4318 37.0 37.0 37.0 37.0 37.0 60-64 36.3891 37.0 37.0 37.0 37.0 37.0 65-69 36.349399999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.40259999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.3865 37.0 37.0 37.0 37.0 37.0 80-84 36.3837 37.0 37.0 37.0 37.0 37.0 85-89 36.313300000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.3701 37.0 37.0 37.0 37.0 37.0 95-99 36.25179999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.2248 37.0 37.0 37.0 37.0 37.0 105-109 36.2055 37.0 37.0 37.0 37.0 37.0 110-114 36.163500000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.131299999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.017100000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.8233 37.0 37.0 37.0 37.0 37.0 130-134 35.783 37.0 37.0 37.0 37.0 37.0 135-139 35.609 37.0 37.0 37.0 37.0 37.0 140-144 35.3767 37.0 37.0 37.0 34.6 37.0 145-149 35.2089 37.0 37.0 37.0 29.8 37.0 150-151 34.90275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 1.0 25 1.0 26 3.0 27 6.0 28 8.0 29 21.0 30 16.0 31 33.0 32 35.0 33 75.0 34 158.0 35 321.0 36 3026.0 37 292.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.459114778694676 14.528632158039509 5.651412853213303 43.360840210052515 2 17.349999999999998 12.3 40.625 29.725 3 16.425 15.875 28.749999999999996 38.95 4 22.225 22.85 24.7 30.225 5 23.974999999999998 29.575000000000003 24.925 21.525 6 19.55 34.949999999999996 23.5 22.0 7 15.4 27.150000000000002 41.925000000000004 15.525 8 17.1 25.275 32.975 24.65 9 16.475 23.200000000000003 36.9 23.425 10-14 19.189999999999998 29.75 28.275 22.785 15-19 19.564999999999998 27.77 28.315 24.349999999999998 20-24 19.12 28.32 28.79 23.77 25-29 20.3 28.18 27.865000000000002 23.655 30-34 19.575 28.910000000000004 27.88 23.635 35-39 19.82 28.83 27.66 23.69 40-44 19.865 28.754999999999995 27.694999999999997 23.685000000000002 45-49 20.125 28.65 28.165000000000003 23.06 50-54 20.1 28.475 27.61 23.815 55-59 20.064999999999998 28.310000000000002 27.965 23.66 60-64 20.349999999999998 28.9 27.250000000000004 23.5 65-69 20.45 28.199999999999996 28.015 23.335 70-74 20.835 28.09 27.415 23.66 75-79 20.185 28.105000000000004 28.07 23.64 80-84 20.805 28.425 27.310000000000002 23.46 85-89 20.794999999999998 28.415000000000003 27.224999999999998 23.565 90-94 20.695 28.315 26.87 24.12 95-99 20.68 29.03 26.16 24.13 100-104 21.21 29.475 25.895000000000003 23.419999999999998 105-109 21.075 28.23 26.405 24.29 110-114 21.240000000000002 28.18 26.07 24.51 115-119 21.385 27.725 26.465 24.425 120-124 21.22 28.449999999999996 26.19 24.14 125-129 21.34 28.01 25.674999999999997 24.975 130-134 20.93 27.935 26.565 24.57 135-139 21.445 27.339999999999996 26.555 24.66 140-144 21.47 26.875 26.85 24.805 145-149 22.264999999999997 26.365 26.655 24.715 150-151 22.5125 26.150000000000002 26.387500000000003 24.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.5 25 4.5 26 5.5 27 6.5 28 12.5 29 17.0 30 21.5 31 32.5 32 37.5 33 41.5 34 51.0 35 68.0 36 85.0 37 100.0 38 142.5 39 177.5 40 185.5 41 200.0 42 228.0 43 247.5 44 249.5 45 259.0 46 252.5 47 244.0 48 253.5 49 214.5 50 171.5 51 148.5 52 118.5 53 94.5 54 65.0 55 58.5 56 52.0 57 39.5 58 31.5 59 20.5 60 18.5 61 11.5 62 6.0 63 7.0 64 4.5 65 1.0 66 1.0 67 1.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.2 #Duplication Level Percentage of deduplicated Percentage of total 1 91.72149122807018 83.65 2 7.12719298245614 13.0 3 0.9594298245614036 2.625 4 0.1644736842105263 0.6 5 0.027412280701754384 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAGACATGTTCTTCAAGGTGTTTCTTCGCATCTTGCCTTCCCACGTTCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.3125 0.0 0.0 0.0 0.0 66-67 0.3875 0.0 0.0 0.0 0.0 68-69 0.475 0.0 0.0 0.0 0.0 70-71 0.5375000000000001 0.0 0.0 0.0 0.0 72-73 0.6625 0.0 0.0 0.0 0.0 74-75 0.9 0.0 0.0 0.0 0.0 76-77 1.1375000000000002 0.0 0.0 0.0 0.0 78-79 1.5125000000000002 0.0 0.0 0.0 0.0 80-81 1.825 0.0 0.0 0.0 0.0 82-83 2.0875 0.0 0.0 0.0 0.0 84-85 2.3625 0.0 0.0 0.0 0.0 86-87 2.725 0.0 0.0 0.0 0.0 88-89 3.25 0.0 0.0 0.0 0.0 90-91 3.9124999999999996 0.0 0.0 0.0 0.0 92-93 4.3125 0.0 0.0 0.0 0.0 94-95 5.074999999999999 0.0 0.0 0.0 0.0 96-97 5.6625 0.0 0.0 0.0 0.0 98-99 6.425 0.0 0.0 0.0 0.0 100-101 7.0875 0.0 0.0 0.0 0.0 102-103 7.925000000000001 0.0 0.0 0.0 0.0 104-105 8.6625 0.0 0.0 0.0 0.0 106-107 9.375 0.0 0.0 0.0 0.0 108-109 10.375 0.0 0.0 0.0 0.0 110-111 11.3875 0.0 0.0 0.0 0.0 112-113 12.1875 0.0 0.0 0.0 0.0 114-115 13.149999999999999 0.0 0.0 0.0 0.0 116-117 14.025 0.0 0.0 0.0 0.0 118-119 14.85 0.0 0.0 0.0 0.0 120-121 15.5875 0.0 0.0 0.0 0.0 122-123 16.4375 0.0 0.0 0.0 0.0 124-125 17.225 0.0 0.0 0.0 0.0 126-127 17.975 0.0 0.0 0.0 0.0 128-129 18.8375 0.0 0.0 0.0 0.0 130-131 19.674999999999997 0.0 0.0 0.0 0.0 132-133 20.525 0.0 0.0 0.0 0.0 134-135 21.5125 0.0 0.0 0.0 0.0 136-137 22.525 0.0 0.0 0.0 0.0 138-139 23.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCAGA 10 0.006830828 145.0 1 GCTGGAT 15 1.1411342E-4 145.0 1 CTGGATT 10 0.006830828 145.0 2 TTCCATT 10 0.006830828 145.0 2 >>END_MODULE SRR12917580 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917580_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4155 37.0 37.0 37.0 37.0 37.0 2 36.3075 37.0 37.0 37.0 37.0 37.0 3 36.2945 37.0 37.0 37.0 37.0 37.0 4 36.363 37.0 37.0 37.0 37.0 37.0 5 36.5 37.0 37.0 37.0 37.0 37.0 6 36.3565 37.0 37.0 37.0 37.0 37.0 7 36.4245 37.0 37.0 37.0 37.0 37.0 8 36.3905 37.0 37.0 37.0 37.0 37.0 9 36.3555 37.0 37.0 37.0 37.0 37.0 10-14 36.4385 37.0 37.0 37.0 37.0 37.0 15-19 36.45799999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.3661 37.0 37.0 37.0 37.0 37.0 25-29 36.2783 37.0 37.0 37.0 37.0 37.0 30-34 36.2847 37.0 37.0 37.0 37.0 37.0 35-39 36.2173 37.0 37.0 37.0 37.0 37.0 40-44 36.26279999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.1148 37.0 37.0 37.0 37.0 37.0 50-54 36.1459 37.0 37.0 37.0 37.0 37.0 55-59 36.15 37.0 37.0 37.0 37.0 37.0 60-64 36.1679 37.0 37.0 37.0 37.0 37.0 65-69 36.0921 37.0 37.0 37.0 37.0 37.0 70-74 36.0683 37.0 37.0 37.0 37.0 37.0 75-79 36.011900000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0175 37.0 37.0 37.0 37.0 37.0 85-89 35.9634 37.0 37.0 37.0 37.0 37.0 90-94 35.999900000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.911 37.0 37.0 37.0 37.0 37.0 100-104 35.8838 37.0 37.0 37.0 37.0 37.0 105-109 35.760000000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.7224 37.0 37.0 37.0 37.0 37.0 115-119 35.622299999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.388999999999996 37.0 37.0 37.0 34.6 37.0 125-129 35.2713 37.0 37.0 37.0 34.6 37.0 130-134 35.0034 37.0 37.0 37.0 25.0 37.0 135-139 34.833400000000005 37.0 37.0 37.0 25.0 37.0 140-144 34.4213 37.0 37.0 37.0 25.0 37.0 145-149 34.2712 37.0 37.0 37.0 25.0 37.0 150-151 33.653999999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 0.0 16 1.0 17 3.0 18 0.0 19 3.0 20 0.0 21 3.0 22 4.0 23 4.0 24 2.0 25 3.0 26 6.0 27 10.0 28 13.0 29 13.0 30 23.0 31 48.0 32 77.0 33 137.0 34 255.0 35 656.0 36 2535.0 37 201.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.325 24.75 11.924999999999999 28.999999999999996 2 25.924999999999997 26.025 33.275 14.774999999999999 3 20.375 27.0 34.2 18.425 4 24.15 33.85 24.75 17.25 5 26.275 36.449999999999996 21.175 16.1 6 20.875 40.1 22.075 16.950000000000003 7 20.3 22.375 38.4 18.925 8 19.625 25.1 31.95 23.325000000000003 9 23.150000000000002 22.925 31.3 22.625 10-14 23.77 29.015 26.755000000000003 20.46 15-19 23.3 28.065 27.73 20.905 20-24 23.605 28.275 27.73 20.39 25-29 23.49 27.765 28.000000000000004 20.745 30-34 23.35 28.134999999999998 28.075 20.44 35-39 22.905 28.565 27.47 21.060000000000002 40-44 23.385 28.63 27.345000000000002 20.64 45-49 23.580000000000002 27.525 28.470000000000002 20.424999999999997 50-54 24.03 27.415 27.925 20.630000000000003 55-59 24.0 27.51 27.115000000000002 21.375 60-64 23.695 27.150000000000002 28.17 20.985 65-69 23.645 27.560000000000002 27.905 20.89 70-74 24.325 27.534999999999997 27.505000000000003 20.635 75-79 23.57 28.02 27.345000000000002 21.065 80-84 24.104999999999997 27.505000000000003 27.384999999999998 21.005 85-89 24.355 27.825 27.48 20.34 90-94 24.565 28.249999999999996 26.615 20.57 95-99 25.185000000000002 28.155 26.8 19.86 100-104 25.395 27.794999999999998 26.540000000000003 20.27 105-109 25.47 27.474999999999998 27.305 19.75 110-114 26.035000000000004 27.689999999999998 26.08 20.195 115-119 26.755000000000003 28.405 25.645 19.195 120-124 27.115000000000002 27.145000000000003 26.674999999999997 19.064999999999998 125-129 27.77 26.695 26.845000000000002 18.69 130-134 29.125 27.189999999999998 25.795 17.89 135-139 29.735 26.855 25.180000000000003 18.23 140-144 30.85 25.905 25.474999999999998 17.77 145-149 32.43 25.1 25.025 17.445 150-151 33.537499999999994 24.8 25.0 16.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 2.0 20 2.0 21 0.5 22 1.5 23 3.5 24 4.5 25 5.5 26 6.0 27 7.0 28 7.5 29 14.5 30 21.0 31 19.5 32 26.5 33 41.5 34 56.5 35 75.5 36 85.0 37 99.0 38 128.0 39 144.5 40 160.0 41 195.5 42 230.5 43 251.0 44 266.0 45 285.0 46 289.5 47 257.0 48 224.0 49 213.0 50 182.0 51 142.0 52 126.0 53 102.0 54 79.5 55 59.5 56 40.0 57 36.5 58 24.0 59 14.0 60 13.0 61 10.5 62 10.5 63 8.0 64 4.5 65 2.5 66 1.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 1.0 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.6231804449327 83.39999999999999 2 7.250755287009064 13.200000000000001 3 0.906344410876133 2.475 4 0.16478989288656962 0.6 5 0.027464982147761604 0.125 6 0.0 0.0 7 0.0 0.0 8 0.027464982147761604 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit GGAAAGGTGGTAATTGATGCCTTCCGTTTGATTAACCCACAAACAATGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.0625 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.3375 0.0 0.0 0.0 0.0 66-67 0.4125 0.0 0.0 0.0 0.0 68-69 0.5 0.0 0.0 0.0 0.0 70-71 0.5625 0.0 0.0 0.0 0.0 72-73 0.6875 0.0 0.0 0.0 0.0 74-75 0.9 0.0 0.0 0.0 0.0 76-77 1.1375000000000002 0.0 0.0 0.0 0.0 78-79 1.5125000000000002 0.0 0.0 0.0 0.0 80-81 1.8 0.0 0.0 0.0 0.0 82-83 2.0625 0.0 0.0 0.0 0.0 84-85 2.3375 0.0 0.0 0.0 0.0 86-87 2.7 0.0 0.0 0.0 0.0 88-89 3.225 0.0 0.0 0.0 0.0 90-91 3.875 0.0 0.0 0.0 0.0 92-93 4.25 0.0 0.0 0.0 0.0 94-95 5.025 0.0 0.0 0.0 0.0 96-97 5.6125 0.0 0.0 0.0 0.0 98-99 6.3875 0.0 0.0 0.0 0.0 100-101 7.0625 0.0 0.0 0.0 0.0 102-103 7.9 0.0 0.0 0.0 0.0 104-105 8.625 0.0 0.0 0.0 0.0 106-107 9.3375 0.0 0.0 0.0 0.0 108-109 10.35 0.0 0.0 0.0 0.0 110-111 11.3875 0.0 0.0 0.0 0.0 112-113 12.212499999999999 0.0 0.0 0.0 0.0 114-115 13.175 0.0 0.0 0.0 0.0 116-117 14.05 0.0 0.0 0.0 0.0 118-119 14.875 0.0 0.0 0.0 0.0 120-121 15.600000000000001 0.0 0.0 0.0 0.0 122-123 16.424999999999997 0.0 0.0 0.0 0.0 124-125 17.174999999999997 0.0 0.0 0.0 0.0 126-127 17.950000000000003 0.0 0.0 0.0 0.0 128-129 18.775 0.0 0.0 0.0 0.0 130-131 19.612499999999997 0.0 0.0 0.0 0.0 132-133 20.4375 0.0 0.0 0.0 0.0 134-135 21.450000000000003 0.0 0.0 0.0 0.0 136-137 22.475 0.0 0.0 0.0 0.0 138-139 23.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAGGT 10 0.006830828 145.0 7 AGAGAGG 20 3.5877043E-4 108.75 6 GGGGGGG 165 1.6352715E-9 13.181819 140-144 >>END_MODULE Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574511 spots for SRR12917580.sra Written 574511 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra Read 574501 spots for SRR12917580.sra Written 574501 spots for SRR12917580.sra SRR ids: ['SRR12917580.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t4ua3bxz SRR12917580.sra spots: 11490030 blocks: [[1, 574501], [574502, 1149002], [1149003, 1723503], [1723504, 2298004], [2298005, 2872505], [2872506, 3447006], [3447007, 4021507], [4021508, 4596008], [4596009, 5170509], [5170510, 5745010], [5745011, 6319511], [6319512, 6894012], [6894013, 7468513], [7468514, 8043014], [8043015, 8617515], [8617516, 9192016], [9192017, 9766517], [9766518, 10341018], [10341019, 10915519], [10915520, 11490030]] SRR12917580 file size 3883114 SRR12917580 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917580 SRR12917580_1.fastq SRR12917580_2.fastq Input file: SRR12917580_1.fastq Paired file: SRR12917580_2.fastq trimmed: SRR12917580-trimmed-pair1.fastq, SRR12917580-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:47:26 2025 >> started Thu Feb 13 15:47:38 2025 >> done (12.330s) 11490030 read pairs processed; of these: 128 ( 0.00%) short read pairs filtered out after trimming by size control 4724 ( 0.04%) empty read pairs filtered out after trimming by size control 11485178 (99.96%) read pairs available; of these: 3451174 (30.05%) trimmed read pairs available after processing 8034004 (69.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 8 0.00% 21 8 0.00% 22 14 0.00% 23 8 0.00% 24 7 0.00% 25 16 0.00% 26 11 0.00% 27 18 0.00% 28 12 0.00% 29 17 0.00% 30 18 0.00% 31 18 0.00% 32 31 0.00% 33 37 0.00% 34 31 0.00% 35 31 0.00% 36 31 0.00% 37 62 0.00% 38 48 0.00% 39 56 0.00% 40 107 0.00% 41 84 0.00% 42 111 0.00% 43 121 0.00% 44 140 0.00% 45 155 0.00% 46 182 0.00% 47 226 0.00% 48 293 0.00% 49 357 0.00% 50 406 0.00% 51 515 0.00% 52 640 0.01% 53 719 0.01% 54 803 0.01% 55 936 0.01% 56 980 0.01% 57 1141 0.01% 58 1443 0.01% 59 1624 0.01% 60 1978 0.02% 61 2398 0.02% 62 2748 0.02% 63 3099 0.03% 64 3653 0.03% 65 4034 0.04% 66 4598 0.04% 67 5154 0.04% 68 5656 0.05% 69 6431 0.06% 70 7355 0.06% 71 8442 0.07% 72 9605 0.08% 73 10777 0.09% 74 12259 0.11% 75 13479 0.12% 76 14416 0.13% 77 15499 0.13% 78 16278 0.14% 79 17692 0.15% 80 18568 0.16% 81 20846 0.18% 82 22747 0.20% 83 24122 0.21% 84 25990 0.23% 85 27740 0.24% 86 29160 0.25% 87 30355 0.26% 88 31529 0.27% 89 32183 0.28% 90 32645 0.28% 91 34000 0.30% 92 35258 0.31% 93 37329 0.33% 94 38955 0.34% 95 40555 0.35% 96 41651 0.36% 97 43606 0.38% 98 43248 0.38% 99 43593 0.38% 100 44110 0.38% 101 43988 0.38% 102 44728 0.39% 103 45992 0.40% 104 46629 0.41% 105 47535 0.41% 106 48729 0.42% 107 49793 0.43% 108 49934 0.43% 109 50445 0.44% 110 49512 0.43% 111 50162 0.44% 112 49624 0.43% 113 49311 0.43% 114 50247 0.44% 115 51484 0.45% 116 52626 0.46% 117 52958 0.46% 118 53792 0.47% 119 53218 0.46% 120 53586 0.47% 121 53037 0.46% 122 52741 0.46% 123 53121 0.46% 124 53095 0.46% 125 52576 0.46% 126 53392 0.46% 127 53651 0.47% 128 54136 0.47% 129 54830 0.48% 130 54287 0.47% 131 53643 0.47% 132 53172 0.46% 133 53020 0.46% 134 52091 0.45% 135 52902 0.46% 136 52695 0.46% 137 52272 0.46% 138 52691 0.46% 139 53736 0.47% 140 52976 0.46% 141 52848 0.46% 142 51725 0.45% 143 51994 0.45% 144 52509 0.46% 145 51510 0.45% 146 51124 0.45% 147 50658 0.44% 148 51821 0.45% 149 51423 0.45% 150 51981 0.45% 151 8034004 69.95% 11485178 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=26 prefix-density=0.43 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=31.42 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=9.7 sequence=TCCTTCAACAGCTCCCTGTGCCGTAGACATCACCTGTTGACCAGCCCCTTGCACTGATTCCTTTGCATATTGAGCAGCAGTACCAGCTTTGTCCATCATGGTAGGACTGGTCTTCTCCCCTACGACTGATTCCTT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=24.21 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=4.6 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR12917580 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:48:26 Started mapping on | Feb 13 15:48:26 Finished on | Feb 13 15:49:24 Mapping speed, Million of reads per hour | 712.87 Number of input reads | 11485178 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 10927248 Uniquely mapped reads % | 95.14% Average mapped length | 279.79 Number of splices: Total | 9788815 Number of splices: Annotated (sjdb) | 9564794 Number of splices: GT/AG | 9592978 Number of splices: GC/AG | 153658 Number of splices: AT/AC | 7211 Number of splices: Non-canonical | 34968 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.03% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282018 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 73670 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.59% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 275912 275912 275912 N_multimapping 282018 282018 282018 N_noFeature 441175 10752226 515948 N_ambiguous 165320 583 64732 UnstrandedReadsAssigned:10320753 PositiveStrandReadsAssigned:174439 NegativeStrandReadsAssigned:10346568 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=129 echo kmer=125 SRR12917580 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917580-trimmed-pair1.fastq SRR12917580-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,485,178 reads, 10,420,553 reads pseudoaligned [quant] estimated average fragment length: 204.809 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR12917580.ke.tsv 34699 SRR12917580.se.tsv 87100 total ==> SRR12917580.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1814.19 354 18.7942 Potri.005G024800.1.v4.1 1035 831.191 362 41.948 Potri.004G059700.1.v4.1 961 757.263 26 3.30697 Potri.007G009000.2.v4.1 1416 1212.19 0 0 Potri.003G141000.2.v4.1 2943 2739.19 488.736 17.1852 Potri.016G087400.1.v4.1 270 114.548 562 472.556 Potri.015G069301.1.v4.1 564 369.473 0 0 Potri.010G195200.1.v4.1 1773 1569.19 43 2.63934 Potri.012G127500.1.v4.1 977 773.247 783 97.5318 ==> SRR12917580.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 81 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 189 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR12917580 completed mapping pipeline successfully