Starting /dee2/code/volunteer_pipeline.sh SRR12917581 current disk space = 3089294548992 free memory = 1447356692 SRR12917581 SRAfilesize 439c921c6a97fa5c1820366f72110a66 SRR12917581.sra SRR12917581.sra file validated SRR12917581 is paired end SRR12917581 is conventional basespace SRR12917581 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917581_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5625 37.0 37.0 37.0 37.0 37.0 2 36.3905 37.0 37.0 37.0 37.0 37.0 3 36.5735 37.0 37.0 37.0 37.0 37.0 4 36.6215 37.0 37.0 37.0 37.0 37.0 5 36.662 37.0 37.0 37.0 37.0 37.0 6 36.57 37.0 37.0 37.0 37.0 37.0 7 36.519 37.0 37.0 37.0 37.0 37.0 8 36.487 37.0 37.0 37.0 37.0 37.0 9 36.586 37.0 37.0 37.0 37.0 37.0 10-14 36.5771 37.0 37.0 37.0 37.0 37.0 15-19 36.5993 37.0 37.0 37.0 37.0 37.0 20-24 36.5107 37.0 37.0 37.0 37.0 37.0 25-29 36.4826 37.0 37.0 37.0 37.0 37.0 30-34 36.4505 37.0 37.0 37.0 37.0 37.0 35-39 36.415000000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.437099999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.3791 37.0 37.0 37.0 37.0 37.0 50-54 36.4132 37.0 37.0 37.0 37.0 37.0 55-59 36.3544 37.0 37.0 37.0 37.0 37.0 60-64 36.302800000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2599 37.0 37.0 37.0 37.0 37.0 70-74 36.285900000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.3169 37.0 37.0 37.0 37.0 37.0 80-84 36.321299999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.2653 37.0 37.0 37.0 37.0 37.0 90-94 36.28830000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1579 37.0 37.0 37.0 37.0 37.0 100-104 36.1348 37.0 37.0 37.0 37.0 37.0 105-109 36.088300000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1 37.0 37.0 37.0 37.0 37.0 115-119 36.0496 37.0 37.0 37.0 37.0 37.0 120-124 36.0709 37.0 37.0 37.0 37.0 37.0 125-129 35.886900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.8512 37.0 37.0 37.0 37.0 37.0 135-139 35.7433 37.0 37.0 37.0 37.0 37.0 140-144 35.567899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.380900000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.19975 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 2.0 26 3.0 27 9.0 28 11.0 29 18.0 30 26.0 31 40.0 32 48.0 33 77.0 34 141.0 35 344.0 36 2988.0 37 291.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.6 12.025 6.35 42.025 2 18.9 11.65 36.525 32.925 3 16.150000000000002 14.75 27.55 41.55 4 22.25 22.725 22.925 32.1 5 22.95 28.999999999999996 24.7 23.35 6 21.15 32.9 21.775 24.175 7 15.525 28.499999999999996 39.75 16.225 8 18.15 26.450000000000003 31.95 23.45 9 16.875 23.474999999999998 35.05 24.6 10-14 19.545 29.725 27.815 22.915 15-19 19.595000000000002 27.775 27.99 24.64 20-24 20.330000000000002 28.194999999999997 27.74 23.735 25-29 19.905 28.215 28.035 23.845 30-34 19.85 28.79 27.400000000000002 23.96 35-39 19.919999999999998 28.294999999999998 27.900000000000002 23.885 40-44 20.13 28.915000000000003 27.6 23.355 45-49 20.13 28.24 27.339999999999996 24.29 50-54 19.68 28.54 27.884999999999998 23.895 55-59 20.39 27.455000000000002 28.08 24.075 60-64 20.195 28.315 27.500000000000004 23.990000000000002 65-69 21.005 27.57 27.975 23.45 70-74 20.87 28.37 27.025 23.735 75-79 20.645 28.415000000000003 27.015 23.925 80-84 20.485 27.825 28.355000000000004 23.335 85-89 20.695 28.585 27.325 23.395 90-94 21.2 28.17 27.224999999999998 23.405 95-99 20.865000000000002 27.955000000000002 27.715 23.465 100-104 20.845 28.01 27.750000000000004 23.395 105-109 20.865000000000002 28.18 27.485 23.47 110-114 21.055 28.475 26.815 23.655 115-119 21.02 28.294999999999998 27.139999999999997 23.544999999999998 120-124 20.53 28.115000000000002 27.405 23.95 125-129 20.72 28.299999999999997 26.915 24.065 130-134 20.974999999999998 28.915000000000003 26.400000000000002 23.71 135-139 21.19 28.08 26.66 24.07 140-144 21.490000000000002 27.544999999999998 26.825 24.14 145-149 20.865000000000002 28.144999999999996 26.650000000000002 24.34 150-151 21.425 27.462500000000002 26.5875 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.5 22 1.5 23 0.5 24 0.5 25 2.5 26 4.0 27 5.0 28 8.0 29 10.0 30 16.5 31 23.0 32 25.5 33 34.0 34 49.5 35 66.5 36 91.5 37 101.5 38 106.0 39 147.0 40 178.5 41 198.0 42 219.5 43 253.5 44 282.0 45 275.5 46 263.0 47 249.0 48 231.0 49 214.0 50 189.5 51 162.0 52 139.5 53 110.0 54 86.0 55 66.0 56 47.0 57 38.0 58 29.0 59 19.0 60 15.5 61 14.5 62 8.5 63 3.0 64 2.5 65 2.0 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.025 #Duplication Level Percentage of deduplicated Percentage of total 1 92.06737299646835 84.725 2 7.226297201847324 13.3 3 0.6791632708503124 1.875 4 0.027166530834012496 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.925 0.0125 0.0 0.0 0.0 94-95 1.0375 0.025 0.0 0.0 0.0 96-97 1.3125 0.025 0.0 0.0 0.0 98-99 1.625 0.025 0.0 0.0 0.0 100-101 1.7875 0.025 0.0 0.0 0.0 102-103 2.0125 0.025 0.0 0.0 0.0 104-105 2.3 0.025 0.0 0.0 0.0 106-107 2.5875 0.025 0.0 0.0 0.0 108-109 2.8375 0.025 0.0 0.0 0.0 110-111 3.1375 0.025 0.0 0.0 0.0 112-113 3.4 0.025 0.0 0.0 0.0 114-115 3.7875 0.025 0.0 0.0 0.0 116-117 4.050000000000001 0.025 0.0 0.0 0.0 118-119 4.4375 0.025 0.0 0.0 0.0 120-121 4.8 0.025 0.0 0.0 0.0 122-123 5.362500000000001 0.025 0.0 0.0 0.0 124-125 5.75 0.025 0.0 0.0 0.0 126-127 6.4125 0.025 0.0 0.0 0.0 128-129 6.925 0.025 0.0 0.0 0.0 130-131 7.4625 0.025 0.0 0.0 0.0 132-133 8.1875 0.025 0.0 0.0 0.0 134-135 8.6625 0.025 0.0 0.0 0.0 136-137 9.2625 0.025 0.0 0.0 0.0 138-139 10.0625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12917581 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917581_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.28275 37.0 37.0 37.0 37.0 37.0 2 36.1715 37.0 37.0 37.0 37.0 37.0 3 36.2305 37.0 37.0 37.0 37.0 37.0 4 36.338 37.0 37.0 37.0 37.0 37.0 5 36.4205 37.0 37.0 37.0 37.0 37.0 6 36.199 37.0 37.0 37.0 37.0 37.0 7 36.379 37.0 37.0 37.0 37.0 37.0 8 36.3265 37.0 37.0 37.0 37.0 37.0 9 36.3165 37.0 37.0 37.0 37.0 37.0 10-14 36.2951 37.0 37.0 37.0 37.0 37.0 15-19 36.32959999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.2487 37.0 37.0 37.0 37.0 37.0 25-29 36.174099999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.141200000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.097300000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.0891 37.0 37.0 37.0 37.0 37.0 45-49 36.0541 37.0 37.0 37.0 37.0 37.0 50-54 36.0067 37.0 37.0 37.0 37.0 37.0 55-59 36.0274 37.0 37.0 37.0 37.0 37.0 60-64 36.0398 37.0 37.0 37.0 37.0 37.0 65-69 35.9676 37.0 37.0 37.0 37.0 37.0 70-74 35.991499999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.8411 37.0 37.0 37.0 37.0 37.0 80-84 35.876099999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.9588 37.0 37.0 37.0 37.0 37.0 90-94 35.9013 37.0 37.0 37.0 37.0 37.0 95-99 35.8437 37.0 37.0 37.0 37.0 37.0 100-104 35.779399999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.75770000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.6974 37.0 37.0 37.0 37.0 37.0 115-119 35.666999999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.5457 37.0 37.0 37.0 37.0 37.0 125-129 35.5065 37.0 37.0 37.0 37.0 37.0 130-134 35.384499999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.255 37.0 37.0 37.0 34.6 37.0 140-144 35.0438 37.0 37.0 37.0 27.4 37.0 145-149 34.89620000000001 37.0 37.0 37.0 25.0 37.0 150-151 34.36625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 1.0 17 0.0 18 0.0 19 2.0 20 2.0 21 6.0 22 3.0 23 2.0 24 3.0 25 7.0 26 5.0 27 9.0 28 16.0 29 11.0 30 42.0 31 42.0 32 77.0 33 128.0 34 226.0 35 574.0 36 2663.0 37 178.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.78419604901225 25.506376594148538 10.75268817204301 26.9567391847962 2 27.125 25.275 32.875 14.725 3 19.225 26.650000000000002 34.775 19.35 4 24.15 33.225 23.724999999999998 18.9 5 25.7 37.15 21.375 15.775 6 19.275000000000002 41.05 22.625 17.05 7 21.025 22.725 38.15 18.099999999999998 8 19.925 26.950000000000003 29.725 23.400000000000002 9 23.150000000000002 24.025 30.475 22.35 10-14 23.16 29.294999999999998 26.76 20.785 15-19 22.555 28.43 27.445000000000004 21.57 20-24 22.53 28.675 27.865000000000002 20.93 25-29 22.665 28.22 27.88 21.235 30-34 22.650000000000002 27.810000000000002 27.650000000000002 21.89 35-39 22.765 27.505000000000003 27.834999999999997 21.895 40-44 22.665 27.474999999999998 28.12 21.740000000000002 45-49 22.54 27.215 28.139999999999997 22.105 50-54 22.485 27.43 28.175 21.91 55-59 23.044999999999998 27.58 28.044999999999998 21.33 60-64 22.735 28.13 27.400000000000002 21.735 65-69 23.485 27.61 27.644999999999996 21.26 70-74 23.369999999999997 27.305 27.900000000000002 21.425 75-79 22.975 27.26 27.944999999999997 21.82 80-84 23.369999999999997 27.54 27.71 21.38 85-89 23.365 27.950000000000003 27.1 21.584999999999997 90-94 23.51 28.110000000000003 27.37 21.01 95-99 23.549999999999997 28.03 26.889999999999997 21.529999999999998 100-104 23.575 27.905 27.529999999999998 20.990000000000002 105-109 23.549999999999997 27.67 27.365000000000002 21.415 110-114 23.84 28.055000000000003 27.605 20.5 115-119 24.575 27.505000000000003 27.275 20.645 120-124 24.185000000000002 28.275 26.47 21.07 125-129 25.03 28.025 26.619999999999997 20.325 130-134 25.324999999999996 27.575 26.99 20.11 135-139 25.41 27.115000000000002 26.810000000000002 20.665 140-144 25.430000000000003 27.384999999999998 26.924999999999997 20.26 145-149 26.745 27.11 26.405 19.74 150-151 25.887500000000003 27.6625 26.8 19.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.5 22 1.5 23 0.5 24 1.0 25 1.5 26 3.5 27 9.5 28 11.5 29 6.5 30 10.5 31 17.0 32 29.0 33 39.5 34 55.0 35 70.5 36 91.0 37 109.0 38 129.0 39 160.5 40 185.0 41 210.0 42 244.5 43 253.0 44 265.0 45 281.5 46 267.0 47 241.0 48 218.0 49 211.0 50 168.0 51 144.0 52 130.0 53 99.0 54 82.0 55 65.5 56 49.0 57 32.0 58 21.5 59 19.5 60 18.0 61 14.5 62 10.0 63 5.5 64 3.5 65 1.5 66 0.5 67 0.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 1.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.08947081287506 84.39999999999999 2 6.983087834151664 12.8 3 0.7364975450081833 2.025 4 0.10911074740861974 0.4 5 0.08183306055646482 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.625 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.3 0.0 0.0 0.0 0.0 106-107 2.5875 0.0 0.0 0.0 0.0 108-109 2.8375 0.0 0.0 0.0 0.0 110-111 3.1375 0.0 0.0 0.0 0.0 112-113 3.4124999999999996 0.0 0.0 0.0 0.0 114-115 3.7625 0.0 0.0 0.0 0.0 116-117 4.025 0.0 0.0 0.0 0.0 118-119 4.4375 0.0 0.0 0.0 0.0 120-121 4.8 0.0 0.0 0.0 0.0 122-123 5.362500000000001 0.0 0.0 0.0 0.0 124-125 5.7625 0.0 0.0 0.0 0.0 126-127 6.425000000000001 0.0 0.0 0.0 0.0 128-129 6.9 0.0 0.0 0.0 0.0 130-131 7.4375 0.0 0.0 0.0 0.0 132-133 8.175 0.0 0.0 0.0 0.0 134-135 8.65 0.0 0.0 0.0 0.0 136-137 9.2375 0.0 0.0 0.0 0.0 138-139 10.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAACA 10 0.006830828 145.0 2 CATTCAT 10 0.006830828 145.0 9 ACACATT 10 0.006830828 145.0 6 ACATTCA 10 0.006830828 145.0 8 TAACTGG 10 0.006830828 145.0 3 TAATATT 10 0.006830828 145.0 2 AATATTT 10 0.006830828 145.0 3 >>END_MODULE Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444199 spots for SRR12917581.sra Written 444199 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra Read 444194 spots for SRR12917581.sra Written 444194 spots for SRR12917581.sra SRR ids: ['SRR12917581.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ibity7e_ SRR12917581.sra spots: 8883885 blocks: [[1, 444194], [444195, 888388], [888389, 1332582], [1332583, 1776776], [1776777, 2220970], [2220971, 2665164], [2665165, 3109358], [3109359, 3553552], [3553553, 3997746], [3997747, 4441940], [4441941, 4886134], [4886135, 5330328], [5330329, 5774522], [5774523, 6218716], [6218717, 6662910], [6662911, 7107104], [7107105, 7551298], [7551299, 7995492], [7995493, 8439686], [8439687, 8883885]] SRR12917581 file size 2999612 SRR12917581 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917581 SRR12917581_1.fastq SRR12917581_2.fastq Input file: SRR12917581_1.fastq Paired file: SRR12917581_2.fastq trimmed: SRR12917581-trimmed-pair1.fastq, SRR12917581-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 14:56:32 2025 >> started Thu Feb 13 14:56:42 2025 >> done (10.178s) 8883885 read pairs processed; of these: 70 ( 0.00%) short read pairs filtered out after trimming by size control 2672 ( 0.03%) empty read pairs filtered out after trimming by size control 8881143 (99.97%) read pairs available; of these: 1217250 (13.71%) trimmed read pairs available after processing 7663893 (86.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 17 0.00% 20 7 0.00% 21 3 0.00% 22 7 0.00% 23 8 0.00% 24 4 0.00% 25 6 0.00% 26 7 0.00% 27 7 0.00% 28 8 0.00% 29 12 0.00% 30 13 0.00% 31 8 0.00% 32 7 0.00% 33 9 0.00% 34 12 0.00% 35 6 0.00% 36 9 0.00% 37 17 0.00% 38 13 0.00% 39 20 0.00% 40 21 0.00% 41 13 0.00% 42 13 0.00% 43 20 0.00% 44 26 0.00% 45 18 0.00% 46 18 0.00% 47 41 0.00% 48 36 0.00% 49 36 0.00% 50 56 0.00% 51 61 0.00% 52 65 0.00% 53 75 0.00% 54 77 0.00% 55 91 0.00% 56 105 0.00% 57 112 0.00% 58 150 0.00% 59 139 0.00% 60 192 0.00% 61 273 0.00% 62 290 0.00% 63 356 0.00% 64 394 0.00% 65 419 0.00% 66 503 0.01% 67 540 0.01% 68 611 0.01% 69 668 0.01% 70 785 0.01% 71 911 0.01% 72 1125 0.01% 73 1233 0.01% 74 1497 0.02% 75 1619 0.02% 76 1816 0.02% 77 1907 0.02% 78 1973 0.02% 79 2180 0.02% 80 2435 0.03% 81 2836 0.03% 82 3050 0.03% 83 3304 0.04% 84 3659 0.04% 85 4233 0.05% 86 4333 0.05% 87 4658 0.05% 88 4991 0.06% 89 5042 0.06% 90 5560 0.06% 91 5861 0.07% 92 6262 0.07% 93 6922 0.08% 94 7257 0.08% 95 7921 0.09% 96 8346 0.09% 97 8764 0.10% 98 8920 0.10% 99 9435 0.11% 100 9626 0.11% 101 9824 0.11% 102 10652 0.12% 103 10702 0.12% 104 11393 0.13% 105 12009 0.14% 106 12507 0.14% 107 12684 0.14% 108 13659 0.15% 109 13980 0.16% 110 13864 0.16% 111 14692 0.17% 112 14910 0.17% 113 15339 0.17% 114 15908 0.18% 115 16673 0.19% 116 17294 0.19% 117 17877 0.20% 118 18622 0.21% 119 18885 0.21% 120 19524 0.22% 121 19794 0.22% 122 20005 0.23% 123 20471 0.23% 124 20900 0.24% 125 20830 0.23% 126 22033 0.25% 127 22632 0.25% 128 23420 0.26% 129 23723 0.27% 130 24585 0.28% 131 24652 0.28% 132 24501 0.28% 133 24821 0.28% 134 25146 0.28% 135 25860 0.29% 136 26095 0.29% 137 26708 0.30% 138 27422 0.31% 139 28789 0.32% 140 28553 0.32% 141 29052 0.33% 142 29255 0.33% 143 29157 0.33% 144 29075 0.33% 145 29760 0.34% 146 29738 0.33% 147 30478 0.34% 148 31319 0.35% 149 31262 0.35% 150 32132 0.36% 151 7663893 86.29% 8881143 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=0.75 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=13.06 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=3.3 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=19 prefix-density=0.99 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.19 sequence-density-rank=22 fanout-score=13.79 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=4.2 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATT SRR12917581 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 14:57:27 Started mapping on | Feb 13 14:57:28 Finished on | Feb 13 14:58:28 Mapping speed, Million of reads per hour | 532.87 Number of input reads | 8881143 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 8481681 Uniquely mapped reads % | 95.50% Average mapped length | 293.68 Number of splices: Total | 8491401 Number of splices: Annotated (sjdb) | 8316526 Number of splices: GT/AG | 8311888 Number of splices: GC/AG | 149100 Number of splices: AT/AC | 5416 Number of splices: Non-canonical | 24997 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 186777 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 33490 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.91% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 212685 212685 212685 N_multimapping 186777 186777 186777 N_noFeature 295767 8368076 328115 N_ambiguous 140044 353 58646 UnstrandedReadsAssigned:8045870 PositiveStrandReadsAssigned:113252 NegativeStrandReadsAssigned:8094920 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917581 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917581-trimmed-pair1.fastq SRR12917581-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,881,143 reads, 8,081,943 reads pseudoaligned [quant] estimated average fragment length: 254.393 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 996 rounds 52401 SRR12917581.ke.tsv 34699 SRR12917581.se.tsv 87100 total ==> SRR12917581.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.61 273 17.6945 Potri.005G024800.1.v4.1 1035 781.607 266 38.9239 Potri.004G059700.1.v4.1 961 707.784 20 3.23186 Potri.007G009000.2.v4.1 1416 1162.61 0 0 Potri.003G141000.2.v4.1 2943 2689.61 349 14.8409 Potri.016G087400.1.v4.1 270 91.6299 543.541 678.45 Potri.015G069301.1.v4.1 564 328.102 0 0 Potri.010G195200.1.v4.1 1773 1519.61 22 1.65582 Potri.012G127500.1.v4.1 977 723.693 47 7.4279 ==> SRR12917581.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 143 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 66 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 3 SRR12917581 completed mapping pipeline successfully