Starting /dee2/code/volunteer_pipeline.sh SRR12917582 current disk space = 3088806162432 free memory = 1578866308 SRR12917582 SRAfilesize 51079de69420c1704ccb10b607137fbb SRR12917582.sra SRR12917582.sra file validated SRR12917582 is paired end SRR12917582 is conventional basespace SRR12917582 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917582_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.53725 37.0 37.0 37.0 37.0 37.0 2 36.46 37.0 37.0 37.0 37.0 37.0 3 36.629 37.0 37.0 37.0 37.0 37.0 4 36.663 37.0 37.0 37.0 37.0 37.0 5 36.609 37.0 37.0 37.0 37.0 37.0 6 36.6735 37.0 37.0 37.0 37.0 37.0 7 36.5685 37.0 37.0 37.0 37.0 37.0 8 36.5685 37.0 37.0 37.0 37.0 37.0 9 36.6715 37.0 37.0 37.0 37.0 37.0 10-14 36.6246 37.0 37.0 37.0 37.0 37.0 15-19 36.6261 37.0 37.0 37.0 37.0 37.0 20-24 36.538799999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.519499999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.5107 37.0 37.0 37.0 37.0 37.0 35-39 36.4979 37.0 37.0 37.0 37.0 37.0 40-44 36.5261 37.0 37.0 37.0 37.0 37.0 45-49 36.4709 37.0 37.0 37.0 37.0 37.0 50-54 36.43390000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.4037 37.0 37.0 37.0 37.0 37.0 60-64 36.357099999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2813 37.0 37.0 37.0 37.0 37.0 70-74 36.3137 37.0 37.0 37.0 37.0 37.0 75-79 36.3698 37.0 37.0 37.0 37.0 37.0 80-84 36.3728 37.0 37.0 37.0 37.0 37.0 85-89 36.2795 37.0 37.0 37.0 37.0 37.0 90-94 36.3052 37.0 37.0 37.0 37.0 37.0 95-99 36.213499999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1577 37.0 37.0 37.0 37.0 37.0 105-109 36.095299999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.1168 37.0 37.0 37.0 37.0 37.0 115-119 36.0447 37.0 37.0 37.0 37.0 37.0 120-124 36.0096 37.0 37.0 37.0 37.0 37.0 125-129 35.849599999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.7303 37.0 37.0 37.0 37.0 37.0 135-139 35.571 37.0 37.0 37.0 37.0 37.0 140-144 35.339600000000004 37.0 37.0 37.0 34.6 37.0 145-149 35.093900000000005 37.0 37.0 37.0 29.8 37.0 150-151 34.85975 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 4.0 26 3.0 27 7.0 28 11.0 29 16.0 30 15.0 31 35.0 32 64.0 33 101.0 34 134.0 35 327.0 36 2962.0 37 316.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.109777444361086 11.952988247061766 5.226306576644161 43.71092773193298 2 17.525 10.85 43.8 27.825 3 16.775000000000002 15.45 29.849999999999998 37.925 4 21.675 22.5 25.25 30.575000000000003 5 23.425 29.95 25.324999999999996 21.3 6 21.05 34.475 22.650000000000002 21.825 7 14.725 27.925 40.775 16.575 8 15.075 24.75 35.3 24.875 9 16.325 23.974999999999998 37.525 22.175 10-14 19.375 29.9 28.12 22.605 15-19 20.57 27.72 27.61 24.099999999999998 20-24 19.945 28.895 27.755000000000003 23.405 25-29 19.685 28.494999999999997 27.834999999999997 23.985 30-34 19.655 29.04 27.61 23.695 35-39 20.294999999999998 29.044999999999998 26.945000000000004 23.715 40-44 20.119999999999997 28.64 27.62 23.62 45-49 19.994999999999997 28.439999999999998 27.744999999999997 23.82 50-54 20.115 28.439999999999998 27.295 24.15 55-59 19.55 29.13 27.54 23.78 60-64 20.119999999999997 28.09 28.000000000000004 23.79 65-69 20.315 28.470000000000002 27.705000000000002 23.51 70-74 20.345 28.845 27.055 23.755000000000003 75-79 20.22 28.365000000000002 27.334999999999997 24.08 80-84 20.115 28.444999999999997 27.775 23.665 85-89 20.625 28.845 27.084999999999997 23.445 90-94 20.59 28.16 27.025 24.224999999999998 95-99 20.849999999999998 28.67 26.75 23.73 100-104 21.154999999999998 28.675 26.985 23.185 105-109 20.47 28.465 26.939999999999998 24.125 110-114 21.060000000000002 28.744999999999997 27.02 23.175 115-119 21.115000000000002 28.15 26.545 24.19 120-124 20.64 28.74 26.695 23.925 125-129 21.245 28.349999999999998 26.1 24.305 130-134 21.884999999999998 28.095 26.5 23.52 135-139 20.985 27.555000000000003 26.035000000000004 25.424999999999997 140-144 21.240000000000002 27.555000000000003 26.68 24.525 145-149 21.790000000000003 28.175 25.25 24.785 150-151 21.337500000000002 28.3875 25.874999999999996 24.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.5 22 2.0 23 1.0 24 3.0 25 6.5 26 8.0 27 12.0 28 14.5 29 17.0 30 16.5 31 20.5 32 38.0 33 51.0 34 50.5 35 62.0 36 85.0 37 117.0 38 139.5 39 146.0 40 172.5 41 191.0 42 218.5 43 261.5 44 248.5 45 248.5 46 278.0 47 256.0 48 238.0 49 208.5 50 168.5 51 154.5 52 121.0 53 88.5 54 88.0 55 76.0 56 52.5 57 42.0 58 33.5 59 18.5 60 11.0 61 11.5 62 8.5 63 6.0 64 1.0 65 0.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.3175303197354 82.825 2 7.552370452039692 13.700000000000001 3 0.7993384785005513 2.175 4 0.27563395810363833 1.0 5 0.027563395810363836 0.125 6 0.0 0.0 7 0.027563395810363836 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAGCTCAGGATTCCGGTCCATAATCTCACGCATCTGAGGATTACTCAT 7 0.17500000000000002 No Hit GTCATACTTGAGAAGGTGGGAGGCCTGCTTAACACCACCAGTGTCGTTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2125 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.5625 0.0 0.0 0.0 0.0 80-81 0.7250000000000001 0.0 0.0 0.0 0.0 82-83 0.975 0.0 0.0 0.0 0.0 84-85 1.1749999999999998 0.0 0.0 0.0 0.0 86-87 1.4 0.0 0.0 0.0 0.0 88-89 1.5875 0.0 0.0 0.0 0.0 90-91 1.7875 0.0 0.0 0.0 0.0 92-93 1.9375 0.0 0.0 0.0 0.0 94-95 2.3 0.0 0.0 0.0 0.0 96-97 2.625 0.0 0.0 0.0 0.0 98-99 3.0625 0.0 0.0 0.0 0.0 100-101 3.4625000000000004 0.0 0.0 0.0 0.0 102-103 3.7375 0.0 0.0 0.0 0.0 104-105 4.112500000000001 0.0 0.0 0.0 0.0 106-107 4.475 0.0 0.0 0.0 0.0 108-109 5.074999999999999 0.0 0.0 0.0 0.0 110-111 5.5375 0.0 0.0 0.0 0.0 112-113 6.2125 0.0 0.0 0.0 0.0 114-115 7.0 0.0 0.0 0.0 0.0 116-117 7.4 0.0 0.0 0.0 0.0 118-119 7.875 0.0 0.0 0.0 0.0 120-121 8.537500000000001 0.0 0.0 0.0 0.0 122-123 9.5 0.0 0.0 0.0 0.0 124-125 10.2375 0.0 0.0 0.0 0.0 126-127 11.0625 0.0 0.0 0.0 0.0 128-129 11.7 0.0 0.0 0.0 0.0 130-131 12.3875 0.0 0.0 0.0 0.0 132-133 13.125 0.0 0.0 0.0 0.0 134-135 13.8875 0.0 0.0 0.0 0.0 136-137 14.8 0.0 0.0 0.0 0.0 138-139 15.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATAC 10 0.006830828 145.0 1 TCCAGTT 10 0.006830828 145.0 2 TACTTGA 10 0.006830828 145.0 5 >>END_MODULE SRR12917582 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917582_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4045 37.0 37.0 37.0 37.0 37.0 2 36.238 37.0 37.0 37.0 37.0 37.0 3 36.228 37.0 37.0 37.0 37.0 37.0 4 36.2605 37.0 37.0 37.0 37.0 37.0 5 36.45 37.0 37.0 37.0 37.0 37.0 6 36.2865 37.0 37.0 37.0 37.0 37.0 7 36.3875 37.0 37.0 37.0 37.0 37.0 8 36.378 37.0 37.0 37.0 37.0 37.0 9 36.336 37.0 37.0 37.0 37.0 37.0 10-14 36.4008 37.0 37.0 37.0 37.0 37.0 15-19 36.3947 37.0 37.0 37.0 37.0 37.0 20-24 36.3623 37.0 37.0 37.0 37.0 37.0 25-29 36.3035 37.0 37.0 37.0 37.0 37.0 30-34 36.2499 37.0 37.0 37.0 37.0 37.0 35-39 36.1578 37.0 37.0 37.0 37.0 37.0 40-44 36.1752 37.0 37.0 37.0 37.0 37.0 45-49 36.0581 37.0 37.0 37.0 37.0 37.0 50-54 36.0984 37.0 37.0 37.0 37.0 37.0 55-59 36.0974 37.0 37.0 37.0 37.0 37.0 60-64 36.0616 37.0 37.0 37.0 37.0 37.0 65-69 36.056200000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0141 37.0 37.0 37.0 37.0 37.0 75-79 35.9702 37.0 37.0 37.0 37.0 37.0 80-84 35.98870000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.9697 37.0 37.0 37.0 37.0 37.0 90-94 35.9861 37.0 37.0 37.0 37.0 37.0 95-99 35.9125 37.0 37.0 37.0 37.0 37.0 100-104 35.91109999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.7939 37.0 37.0 37.0 37.0 37.0 110-114 35.8197 37.0 37.0 37.0 37.0 37.0 115-119 35.6957 37.0 37.0 37.0 37.0 37.0 120-124 35.5107 37.0 37.0 37.0 37.0 37.0 125-129 35.5483 37.0 37.0 37.0 37.0 37.0 130-134 35.3182 37.0 37.0 37.0 34.6 37.0 135-139 35.34599999999999 37.0 37.0 37.0 34.6 37.0 140-144 34.9996 37.0 37.0 37.0 25.0 37.0 145-149 34.8023 37.0 37.0 37.0 25.0 37.0 150-151 34.1755 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 0.0 18 3.0 19 0.0 20 2.0 21 0.0 22 1.0 23 5.0 24 3.0 25 5.0 26 8.0 27 9.0 28 8.0 29 22.0 30 19.0 31 46.0 32 62.0 33 115.0 34 228.0 35 668.0 36 2581.0 37 212.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.65 26.400000000000002 8.575000000000001 28.375 2 26.1 25.55 33.650000000000006 14.7 3 18.8 28.349999999999998 33.074999999999996 19.775000000000002 4 23.45 34.050000000000004 24.099999999999998 18.4 5 26.75 37.875 19.650000000000002 15.725 6 20.625 41.199999999999996 21.0 17.175 7 20.45 22.650000000000002 37.6 19.3 8 19.75 25.525 31.15 23.575 9 21.9 23.825 31.45 22.825 10-14 22.325 29.315 27.089999999999996 21.27 15-19 23.405 27.639999999999997 27.36 21.595 20-24 22.625 29.275000000000002 27.395000000000003 20.705000000000002 25-29 22.634999999999998 27.87 28.1 21.395 30-34 22.535 28.185 27.584999999999997 21.695 35-39 23.03 27.889999999999997 27.525 21.555 40-44 22.615 27.77 28.720000000000002 20.895 45-49 22.64 27.6 28.43 21.33 50-54 22.655 27.92 28.134999999999998 21.29 55-59 23.095 27.565 27.810000000000002 21.529999999999998 60-64 22.91 27.779999999999998 27.96 21.349999999999998 65-69 23.335 27.725 27.73 21.21 70-74 23.330000000000002 27.29 28.355000000000004 21.025 75-79 22.85 27.750000000000004 28.244999999999997 21.154999999999998 80-84 22.765 28.144999999999996 27.584999999999997 21.505 85-89 24.235 27.694999999999997 27.275 20.794999999999998 90-94 23.385 28.375 27.21 21.029999999999998 95-99 23.665 27.73 27.845 20.76 100-104 24.33 27.065 28.144999999999996 20.46 105-109 24.22 27.589999999999996 27.495000000000005 20.695 110-114 24.740000000000002 27.634999999999998 27.52 20.105 115-119 24.615000000000002 27.605 27.305 20.474999999999998 120-124 24.51 28.23 26.69 20.57 125-129 25.230000000000004 27.595 26.69 20.485 130-134 26.32 27.625 26.685 19.37 135-139 25.85 27.72 26.840000000000003 19.59 140-144 26.51 26.900000000000002 26.779999999999998 19.81 145-149 27.195000000000004 27.73 26.064999999999998 19.009999999999998 150-151 26.8625 27.0875 26.825 19.225 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 2.5 23 1.0 24 1.5 25 3.5 26 5.0 27 5.5 28 6.0 29 13.0 30 20.0 31 26.5 32 34.0 33 35.5 34 43.5 35 59.5 36 84.0 37 105.0 38 124.5 39 164.0 40 207.0 41 231.5 42 249.0 43 281.5 44 283.0 45 249.0 46 261.0 47 261.5 48 216.5 49 199.0 50 166.5 51 141.5 52 123.0 53 86.0 54 74.5 55 59.0 56 39.0 57 31.0 58 26.5 59 23.0 60 19.0 61 11.5 62 7.5 63 4.0 64 0.5 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.05 #Duplication Level Percentage of deduplicated Percentage of total 1 91.51565074135091 83.325 2 7.413509060955518 13.5 3 0.8786381109280615 2.4 4 0.16474464579901155 0.6 5 0.0 0.0 6 0.0 0.0 7 0.027457440966501923 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGGTTGATTTATAAAGGTCGGATTTTGAAGGATGACCAGACCCTTCT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2125 0.0 0.0 0.0 0.0 74-75 0.4125 0.0 0.0 0.0 0.0 76-77 0.45 0.0 0.0 0.0 0.0 78-79 0.5375000000000001 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.95 0.0 0.0 0.0 0.0 84-85 1.15 0.0 0.0 0.0 0.0 86-87 1.375 0.0 0.0 0.0 0.0 88-89 1.5625 0.0 0.0 0.0 0.0 90-91 1.7625000000000002 0.0 0.0 0.0 0.0 92-93 1.9125 0.0 0.0 0.0 0.0 94-95 2.2874999999999996 0.0 0.0 0.0 0.0 96-97 2.625 0.0 0.0 0.0 0.0 98-99 3.0625 0.0 0.0 0.0 0.0 100-101 3.4625000000000004 0.0 0.0 0.0 0.0 102-103 3.7375 0.0 0.0 0.0 0.0 104-105 4.137499999999999 0.0 0.0 0.0 0.0 106-107 4.5 0.0 0.0 0.0 0.0 108-109 5.1125 0.0 0.0 0.0 0.0 110-111 5.6125 0.0 0.0 0.0 0.0 112-113 6.3 0.0 0.0 0.0 0.0 114-115 7.1125 0.0 0.0 0.0 0.0 116-117 7.5 0.0 0.0 0.0 0.0 118-119 7.975 0.0 0.0 0.0 0.0 120-121 8.6375 0.0 0.0 0.0 0.0 122-123 9.6125 0.0 0.0 0.0 0.0 124-125 10.3625 0.0 0.0 0.0 0.0 126-127 11.1875 0.0 0.0 0.0 0.0 128-129 11.825 0.0 0.0 0.0 0.0 130-131 12.5 0.0 0.0 0.0 0.0 132-133 13.225 0.0 0.0 0.0 0.0 134-135 14.0125 0.0 0.0 0.0 0.0 136-137 14.95 0.0 0.0 0.0 0.0 138-139 15.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCACAA 10 0.006830828 145.0 3 >>END_MODULE Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581241 spots for SRR12917582.sra Written 581241 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra Read 581233 spots for SRR12917582.sra Written 581233 spots for SRR12917582.sra SRR ids: ['SRR12917582.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tg2rufne SRR12917582.sra spots: 11624668 blocks: [[1, 581233], [581234, 1162466], [1162467, 1743699], [1743700, 2324932], [2324933, 2906165], [2906166, 3487398], [3487399, 4068631], [4068632, 4649864], [4649865, 5231097], [5231098, 5812330], [5812331, 6393563], [6393564, 6974796], [6974797, 7556029], [7556030, 8137262], [8137263, 8718495], [8718496, 9299728], [9299729, 9880961], [9880962, 10462194], [10462195, 11043427], [11043428, 11624668]] SRR12917582 file size 3928870 SRR12917582 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917582 SRR12917582_1.fastq SRR12917582_2.fastq Input file: SRR12917582_1.fastq Paired file: SRR12917582_2.fastq trimmed: SRR12917582-trimmed-pair1.fastq, SRR12917582-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:47:17 2025 >> started Thu Feb 13 15:47:29 2025 >> done (12.094s) 11624668 read pairs processed; of these: 306 ( 0.00%) short read pairs filtered out after trimming by size control 841 ( 0.01%) empty read pairs filtered out after trimming by size control 11623521 (99.99%) read pairs available; of these: 2413009 (20.76%) trimmed read pairs available after processing 9210512 (79.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 28 0.00% 20 14 0.00% 21 26 0.00% 22 27 0.00% 23 23 0.00% 24 30 0.00% 25 40 0.00% 26 35 0.00% 27 40 0.00% 28 45 0.00% 29 56 0.00% 30 38 0.00% 31 40 0.00% 32 58 0.00% 33 50 0.00% 34 64 0.00% 35 72 0.00% 36 52 0.00% 37 59 0.00% 38 64 0.00% 39 50 0.00% 40 66 0.00% 41 65 0.00% 42 78 0.00% 43 89 0.00% 44 88 0.00% 45 78 0.00% 46 95 0.00% 47 116 0.00% 48 152 0.00% 49 184 0.00% 50 181 0.00% 51 236 0.00% 52 274 0.00% 53 269 0.00% 54 322 0.00% 55 380 0.00% 56 428 0.00% 57 492 0.00% 58 595 0.01% 59 718 0.01% 60 910 0.01% 61 997 0.01% 62 1194 0.01% 63 1414 0.01% 64 1598 0.01% 65 1847 0.02% 66 1986 0.02% 67 2269 0.02% 68 2601 0.02% 69 2962 0.03% 70 3314 0.03% 71 3941 0.03% 72 4510 0.04% 73 5087 0.04% 74 5768 0.05% 75 6227 0.05% 76 6544 0.06% 77 7025 0.06% 78 7840 0.07% 79 8198 0.07% 80 9198 0.08% 81 9884 0.09% 82 11008 0.09% 83 12034 0.10% 84 12951 0.11% 85 14129 0.12% 86 14583 0.13% 87 15499 0.13% 88 16062 0.14% 89 16433 0.14% 90 16967 0.15% 91 17800 0.15% 92 18492 0.16% 93 20278 0.17% 94 21576 0.19% 95 22682 0.20% 96 23130 0.20% 97 23903 0.21% 98 24529 0.21% 99 24912 0.21% 100 25714 0.22% 101 25461 0.22% 102 26769 0.23% 103 27574 0.24% 104 28865 0.25% 105 29981 0.26% 106 30619 0.26% 107 31213 0.27% 108 31613 0.27% 109 32224 0.28% 110 32083 0.28% 111 32539 0.28% 112 33362 0.29% 113 33602 0.29% 114 34474 0.30% 115 35704 0.31% 116 36392 0.31% 117 37752 0.32% 118 38541 0.33% 119 38099 0.33% 120 38916 0.33% 121 38770 0.33% 122 39328 0.34% 123 39422 0.34% 124 39571 0.34% 125 40420 0.35% 126 41354 0.36% 127 41823 0.36% 128 41855 0.36% 129 43263 0.37% 130 42868 0.37% 131 42462 0.37% 132 42525 0.37% 133 42765 0.37% 134 42633 0.37% 135 43030 0.37% 136 44043 0.38% 137 44169 0.38% 138 45130 0.39% 139 45772 0.39% 140 45337 0.39% 141 45301 0.39% 142 45166 0.39% 143 45400 0.39% 144 45474 0.39% 145 44835 0.39% 146 45446 0.39% 147 45239 0.39% 148 46595 0.40% 149 46297 0.40% 150 47088 0.41% 151 9210512 79.24% 11623521 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=22 prefix-density=0.69 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=10.82 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=4.0 sequence=ACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=18 prefix-density=0.84 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=71.69 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=3.6 sequence=CAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTT SRR12917582 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:48:23 Started mapping on | Feb 13 15:48:24 Finished on | Feb 13 15:49:37 Mapping speed, Million of reads per hour | 573.21 Number of input reads | 11623521 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 10881994 Uniquely mapped reads % | 93.62% Average mapped length | 287.63 Number of splices: Total | 10514236 Number of splices: Annotated (sjdb) | 10307908 Number of splices: GT/AG | 10294468 Number of splices: GC/AG | 179490 Number of splices: AT/AC | 6093 Number of splices: Non-canonical | 34185 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 288725 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 30482 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 452802 452802 452802 N_multimapping 288725 288725 288725 N_noFeature 353115 10736440 400590 N_ambiguous 177709 482 79397 UnstrandedReadsAssigned:10351170 PositiveStrandReadsAssigned:145072 NegativeStrandReadsAssigned:10402007 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR12917582 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917582-trimmed-pair1.fastq SRR12917582-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,623,521 reads, 10,438,342 reads pseudoaligned [quant] estimated average fragment length: 232.352 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR12917582.ke.tsv 34699 SRR12917582.se.tsv 87100 total ==> SRR12917582.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.65 271 14.218 Potri.005G024800.1.v4.1 1035 803.648 116 13.5301 Potri.004G059700.1.v4.1 961 729.803 29 3.72478 Potri.007G009000.2.v4.1 1416 1184.65 0 0 Potri.003G141000.2.v4.1 2943 2711.65 387 13.3778 Potri.016G087400.1.v4.1 270 102.733 612 558.406 Potri.015G069301.1.v4.1 564 346.782 0 0 Potri.010G195200.1.v4.1 1773 1541.65 10 0.608028 Potri.012G127500.1.v4.1 977 745.706 89 11.1875 ==> SRR12917582.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 211 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 126 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR12917582 completed mapping pipeline successfully