Starting /dee2/code/volunteer_pipeline.sh SRR12917583 current disk space = 3088711102464 free memory = 1577685772 SRR12917583 SRAfilesize e2ec951352f54353f89a9cbf7dcadbab SRR12917583.sra SRR12917583.sra file validated SRR12917583 is paired end SRR12917583 is conventional basespace SRR12917583 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917583_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5095 37.0 37.0 37.0 37.0 37.0 2 36.4595 37.0 37.0 37.0 37.0 37.0 3 36.558 37.0 37.0 37.0 37.0 37.0 4 36.71 37.0 37.0 37.0 37.0 37.0 5 36.701 37.0 37.0 37.0 37.0 37.0 6 36.723 37.0 37.0 37.0 37.0 37.0 7 36.5415 37.0 37.0 37.0 37.0 37.0 8 36.664 37.0 37.0 37.0 37.0 37.0 9 36.6475 37.0 37.0 37.0 37.0 37.0 10-14 36.621900000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.6006 37.0 37.0 37.0 37.0 37.0 20-24 36.5577 37.0 37.0 37.0 37.0 37.0 25-29 36.5646 37.0 37.0 37.0 37.0 37.0 30-34 36.4922 37.0 37.0 37.0 37.0 37.0 35-39 36.5049 37.0 37.0 37.0 37.0 37.0 40-44 36.4899 37.0 37.0 37.0 37.0 37.0 45-49 36.4752 37.0 37.0 37.0 37.0 37.0 50-54 36.4435 37.0 37.0 37.0 37.0 37.0 55-59 36.3715 37.0 37.0 37.0 37.0 37.0 60-64 36.3408 37.0 37.0 37.0 37.0 37.0 65-69 36.2894 37.0 37.0 37.0 37.0 37.0 70-74 36.2684 37.0 37.0 37.0 37.0 37.0 75-79 36.3009 37.0 37.0 37.0 37.0 37.0 80-84 36.3076 37.0 37.0 37.0 37.0 37.0 85-89 36.2726 37.0 37.0 37.0 37.0 37.0 90-94 36.2872 37.0 37.0 37.0 37.0 37.0 95-99 36.1577 37.0 37.0 37.0 37.0 37.0 100-104 36.2016 37.0 37.0 37.0 37.0 37.0 105-109 36.1016 37.0 37.0 37.0 37.0 37.0 110-114 36.111799999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.058 37.0 37.0 37.0 37.0 37.0 120-124 35.982299999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.9267 37.0 37.0 37.0 37.0 37.0 130-134 35.8164 37.0 37.0 37.0 37.0 37.0 135-139 35.643499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.427800000000005 37.0 37.0 37.0 34.6 37.0 145-149 35.1727 37.0 37.0 37.0 29.8 37.0 150-151 34.960499999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 6.0 26 4.0 27 5.0 28 11.0 29 17.0 30 28.0 31 26.0 32 48.0 33 94.0 34 125.0 35 367.0 36 2945.0 37 321.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.675 10.825 7.575 48.925000000000004 2 17.974999999999998 12.075 39.324999999999996 30.625000000000004 3 17.25 15.0 28.000000000000004 39.75 4 20.724999999999998 22.575 24.275 32.425 5 23.599999999999998 29.9 24.125 22.375 6 20.775 34.575 23.3 21.349999999999998 7 15.925 28.1 39.45 16.525000000000002 8 17.224999999999998 26.974999999999998 33.175 22.625 9 18.025 23.825 34.975 23.175 10-14 19.97 30.555 27.025 22.45 15-19 19.794999999999998 28.73 27.845 23.630000000000003 20-24 19.845 28.915000000000003 27.77 23.47 25-29 20.01 29.15 27.315 23.525 30-34 19.435 28.985 27.589999999999996 23.990000000000002 35-39 19.705000000000002 28.84 27.57 23.885 40-44 19.89 28.62 27.589999999999996 23.9 45-49 19.81 28.075 27.93 24.185000000000002 50-54 20.18 28.285 27.48 24.055 55-59 20.3 28.494999999999997 27.245 23.96 60-64 20.195 28.294999999999998 27.48 24.03 65-69 19.875 28.7 27.675 23.75 70-74 19.61 28.904999999999998 27.27 24.215 75-79 20.29 28.449999999999996 27.415 23.845 80-84 20.275000000000002 28.515 27.445000000000004 23.765 85-89 21.085 27.639999999999997 28.04 23.235 90-94 20.265 28.965000000000003 27.075 23.695 95-99 20.674999999999997 28.415000000000003 27.72 23.189999999999998 100-104 20.97 28.685 26.91 23.435 105-109 21.01 28.48 26.995 23.515 110-114 21.495 28.53 26.619999999999997 23.355 115-119 21.16 28.38 26.325 24.135 120-124 20.785 27.99 26.27 24.955 125-129 20.62 28.199999999999996 26.384999999999998 24.795 130-134 20.68 28.825 25.86 24.635 135-139 20.585 28.07 26.02 25.324999999999996 140-144 20.96 27.61 25.740000000000002 25.69 145-149 20.26 28.194999999999997 25.885 25.66 150-151 21.087500000000002 27.8875 25.4875 25.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.5 23 1.5 24 2.0 25 2.0 26 2.0 27 6.5 28 9.5 29 13.0 30 19.5 31 25.5 32 33.5 33 39.0 34 57.5 35 68.5 36 78.5 37 107.0 38 137.5 39 168.0 40 188.0 41 201.5 42 219.0 43 248.0 44 264.5 45 272.0 46 267.5 47 252.5 48 246.5 49 212.0 50 176.0 51 145.5 52 105.5 53 93.5 54 83.5 55 62.0 56 50.0 57 42.5 58 35.5 59 24.5 60 13.5 61 7.5 62 3.0 63 0.5 64 2.0 65 2.5 66 1.5 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.425 #Duplication Level Percentage of deduplicated Percentage of total 1 92.77792804977008 85.75 2 6.5728969434676765 12.15 3 0.4868812550716798 1.35 4 0.054097917230186636 0.2 5 0.08114687584527995 0.375 6 0.0 0.0 7 0.027048958615093318 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCTCCTCCCCATAGTTTTCACATCTAGACAAAGCATTTTTCTCCCCTT 7 0.17500000000000002 No Hit CCTCTATCAATGGAATCTTGATTGGCTTCACCAAGAGAAGCCTCGCTCAG 5 0.125 No Hit GTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG 5 0.125 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.45 0.0 0.0 0.0 0.0 78-79 0.6375 0.0 0.0 0.0 0.0 80-81 0.7625 0.0 0.0 0.0 0.0 82-83 0.8999999999999999 0.0 0.0 0.0 0.0 84-85 1.0 0.0 0.0 0.0 0.0 86-87 1.2625000000000002 0.0 0.0 0.0 0.0 88-89 1.65 0.0 0.0 0.0 0.0 90-91 2.0999999999999996 0.0 0.0 0.0 0.0 92-93 2.45 0.0 0.0 0.0 0.0 94-95 2.9124999999999996 0.0 0.0 0.0 0.0 96-97 3.375 0.0 0.0 0.0 0.0 98-99 3.7875 0.0 0.0 0.0 0.0 100-101 4.0875 0.0 0.0 0.0 0.0 102-103 4.625 0.0 0.0 0.0 0.0 104-105 5.35 0.0 0.0 0.0 0.0 106-107 5.9375 0.0 0.0 0.0 0.0 108-109 6.5375 0.0 0.0 0.0 0.0 110-111 7.4375 0.0 0.0 0.0 0.0 112-113 8.175 0.0 0.0 0.0 0.0 114-115 8.899999999999999 0.0 0.0 0.0 0.0 116-117 9.675 0.0 0.0 0.0 0.0 118-119 10.2875 0.0 0.0 0.0 0.0 120-121 11.0125 0.0 0.0 0.0 0.0 122-123 11.787500000000001 0.0 0.0 0.0 0.0 124-125 12.45 0.0 0.0 0.0 0.0 126-127 13.1125 0.0 0.0 0.0 0.0 128-129 13.8375 0.0 0.0 0.0 0.0 130-131 14.75 0.0 0.0 0.0 0.0 132-133 15.7 0.0 0.0 0.0 0.0 134-135 16.4625 0.0 0.0 0.0 0.0 136-137 17.225 0.0 0.0 0.0 0.0 138-139 18.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGGA 10 0.006830828 145.0 8 CGCCACC 10 0.006830828 145.0 1 ATGAAGA 10 0.006830828 145.0 9 TCAATGG 10 0.006830828 145.0 7 AAGATGA 10 0.006830828 145.0 6 AATGGAA 10 0.006830828 145.0 9 ATCAATG 10 0.006830828 145.0 6 GTGAAGA 10 0.006830828 145.0 3 >>END_MODULE SRR12917583 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917583_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3635 37.0 37.0 37.0 37.0 37.0 2 36.289 37.0 37.0 37.0 37.0 37.0 3 36.2625 37.0 37.0 37.0 37.0 37.0 4 36.1985 37.0 37.0 37.0 37.0 37.0 5 36.412 37.0 37.0 37.0 37.0 37.0 6 36.2605 37.0 37.0 37.0 37.0 37.0 7 36.283 37.0 37.0 37.0 37.0 37.0 8 36.3745 37.0 37.0 37.0 37.0 37.0 9 36.387 37.0 37.0 37.0 37.0 37.0 10-14 36.3668 37.0 37.0 37.0 37.0 37.0 15-19 36.3532 37.0 37.0 37.0 37.0 37.0 20-24 36.27890000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.2551 37.0 37.0 37.0 37.0 37.0 30-34 36.19179999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.1296 37.0 37.0 37.0 37.0 37.0 40-44 36.112 37.0 37.0 37.0 37.0 37.0 45-49 36.0684 37.0 37.0 37.0 37.0 37.0 50-54 36.1012 37.0 37.0 37.0 37.0 37.0 55-59 36.073899999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.12910000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.9764 37.0 37.0 37.0 37.0 37.0 70-74 35.9987 37.0 37.0 37.0 37.0 37.0 75-79 35.891000000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.882600000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.893299999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.9405 37.0 37.0 37.0 37.0 37.0 95-99 35.9101 37.0 37.0 37.0 37.0 37.0 100-104 35.8601 37.0 37.0 37.0 37.0 37.0 105-109 35.8082 37.0 37.0 37.0 37.0 37.0 110-114 35.7459 37.0 37.0 37.0 37.0 37.0 115-119 35.6588 37.0 37.0 37.0 37.0 37.0 120-124 35.5342 37.0 37.0 37.0 37.0 37.0 125-129 35.4183 37.0 37.0 37.0 37.0 37.0 130-134 35.280100000000004 37.0 37.0 37.0 34.6 37.0 135-139 35.165000000000006 37.0 37.0 37.0 27.4 37.0 140-144 34.7843 37.0 37.0 37.0 25.0 37.0 145-149 34.56859999999999 37.0 37.0 37.0 25.0 37.0 150-151 34.1465 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 2.0 16 1.0 17 0.0 18 0.0 19 1.0 20 3.0 21 2.0 22 1.0 23 5.0 24 3.0 25 4.0 26 7.0 27 12.0 28 12.0 29 21.0 30 19.0 31 40.0 32 72.0 33 138.0 34 253.0 35 625.0 36 2570.0 37 206.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.6 22.75 11.625 34.025 2 25.1 25.825 32.5 16.575 3 19.900000000000002 26.900000000000002 33.225 19.975 4 23.849999999999998 32.2 24.65 19.3 5 26.275 34.975 22.375 16.375 6 19.725 40.375 21.8 18.099999999999998 7 19.900000000000002 22.025 38.275 19.8 8 18.2 26.525 31.225 24.05 9 21.775 24.725 30.925000000000004 22.575 10-14 22.935 28.87 26.66 21.535 15-19 22.905 27.735 27.67 21.69 20-24 22.509999999999998 28.77 27.779999999999998 20.94 25-29 22.955000000000002 27.894999999999996 27.939999999999998 21.21 30-34 22.945 27.875 27.994999999999997 21.185000000000002 35-39 23.01 27.634999999999998 28.025 21.33 40-44 23.745 26.965 28.29 21.0 45-49 23.305 27.6 27.72 21.375 50-54 23.375 27.439999999999998 28.075 21.11 55-59 23.05 27.62 28.04 21.29 60-64 23.13 27.875 27.779999999999998 21.215 65-69 23.28 27.250000000000004 27.860000000000003 21.61 70-74 24.255 27.465 27.810000000000002 20.47 75-79 22.93 28.525 27.655 20.89 80-84 23.705000000000002 28.415000000000003 26.97 20.91 85-89 24.005000000000003 27.445000000000004 27.16 21.39 90-94 24.265 27.794999999999998 27.045 20.895 95-99 24.455 27.800000000000004 27.284999999999997 20.46 100-104 24.93 27.950000000000003 26.419999999999998 20.7 105-109 24.695 27.99 27.165 20.150000000000002 110-114 24.775 28.975 26.495 19.755 115-119 24.825 27.450000000000003 27.04 20.685000000000002 120-124 25.825 27.825 26.540000000000003 19.81 125-129 25.855 27.73 26.185000000000002 20.23 130-134 26.290000000000003 28.24 25.86 19.61 135-139 25.96 28.165000000000003 26.534999999999997 19.34 140-144 27.689999999999998 27.08 26.090000000000003 19.139999999999997 145-149 28.634999999999998 26.340000000000003 25.885 19.139999999999997 150-151 29.7125 26.125 25.85 18.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 4.0 24 3.5 25 3.5 26 7.0 27 7.0 28 8.0 29 10.5 30 17.0 31 24.5 32 28.0 33 33.0 34 41.5 35 63.5 36 89.0 37 114.5 38 137.5 39 152.5 40 180.5 41 221.0 42 242.5 43 251.5 44 259.5 45 247.5 46 256.5 47 245.0 48 221.5 49 210.0 50 173.5 51 144.0 52 121.0 53 101.5 54 88.5 55 71.0 56 52.0 57 44.0 58 34.5 59 26.0 60 17.5 61 11.0 62 10.0 63 5.0 64 1.0 65 3.0 66 2.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.99002426530062 86.225 2 6.36290105149636 11.799999999999999 3 0.5392289026691831 1.5 4 0.08088433540037746 0.3 5 0.0 0.0 6 0.0 0.0 7 0.026961445133459154 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATCATCAGACTCTGAAGAGAGCGGAGGCCCAAAGCTAAATACTGGACCA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.45 0.0 0.0 0.0 0.0 78-79 0.6375 0.0 0.0 0.0 0.0 80-81 0.7625 0.0 0.0 0.0 0.0 82-83 0.8999999999999999 0.0 0.0 0.0 0.0 84-85 1.0 0.0 0.0 0.0 0.0 86-87 1.275 0.0 0.0 0.0 0.0 88-89 1.675 0.0 0.0 0.0 0.0 90-91 2.125 0.0 0.0 0.0 0.0 92-93 2.475 0.0 0.0 0.0 0.0 94-95 2.9375 0.0 0.0 0.0 0.0 96-97 3.4 0.0 0.0 0.0 0.0 98-99 3.8125 0.0 0.0 0.0 0.0 100-101 4.112500000000001 0.0 0.0 0.0 0.0 102-103 4.637499999999999 0.0 0.0 0.0 0.0 104-105 5.35 0.0 0.0 0.0 0.0 106-107 5.9375 0.0 0.0 0.0 0.0 108-109 6.5375 0.0 0.0 0.0 0.0 110-111 7.45 0.0 0.0 0.0 0.0 112-113 8.2 0.0 0.0 0.0 0.0 114-115 8.925 0.0 0.0 0.0 0.0 116-117 9.7 0.0 0.0 0.0 0.0 118-119 10.3125 0.0 0.0 0.0 0.0 120-121 11.0625 0.0 0.0 0.0 0.0 122-123 11.837499999999999 0.0 0.0 0.0 0.0 124-125 12.5 0.0 0.0 0.0 0.0 126-127 13.1625 0.0 0.0 0.0 0.0 128-129 13.9125 0.0 0.0 0.0 0.0 130-131 14.875 0.0 0.0 0.0 0.0 132-133 15.825 0.0 0.0 0.0 0.0 134-135 16.5875 0.0 0.0 0.0 0.0 136-137 17.325 0.0 0.0 0.0 0.0 138-139 18.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCAGC 10 0.006830828 145.0 7 GGGGGGG 45 6.5511256E-4 19.333332 140-144 >>END_MODULE Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509251 spots for SRR12917583.sra Written 509251 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra Read 509232 spots for SRR12917583.sra Written 509232 spots for SRR12917583.sra SRR ids: ['SRR12917583.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__v1fcjty SRR12917583.sra spots: 10184659 blocks: [[1, 509232], [509233, 1018464], [1018465, 1527696], [1527697, 2036928], [2036929, 2546160], [2546161, 3055392], [3055393, 3564624], [3564625, 4073856], [4073857, 4583088], [4583089, 5092320], [5092321, 5601552], [5601553, 6110784], [6110785, 6620016], [6620017, 7129248], [7129249, 7638480], [7638481, 8147712], [8147713, 8656944], [8656945, 9166176], [9166177, 9675408], [9675409, 10184659]] SRR12917583 file size 3439492 SRR12917583 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917583 SRR12917583_1.fastq SRR12917583_2.fastq Input file: SRR12917583_1.fastq Paired file: SRR12917583_2.fastq trimmed: SRR12917583-trimmed-pair1.fastq, SRR12917583-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:52:23 2025 >> started Thu Feb 13 15:52:33 2025 >> done (10.664s) 10184659 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 4965 ( 0.05%) empty read pairs filtered out after trimming by size control 10179667 (99.95%) read pairs available; of these: 2289332 (22.49%) trimmed read pairs available after processing 7890335 (77.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 5 0.00% 21 9 0.00% 22 5 0.00% 23 3 0.00% 24 4 0.00% 25 5 0.00% 26 6 0.00% 27 2 0.00% 28 5 0.00% 29 10 0.00% 30 4 0.00% 31 14 0.00% 32 11 0.00% 33 16 0.00% 34 8 0.00% 35 17 0.00% 36 15 0.00% 37 19 0.00% 38 12 0.00% 39 23 0.00% 40 20 0.00% 41 37 0.00% 42 32 0.00% 43 49 0.00% 44 54 0.00% 45 61 0.00% 46 71 0.00% 47 60 0.00% 48 93 0.00% 49 125 0.00% 50 135 0.00% 51 186 0.00% 52 218 0.00% 53 229 0.00% 54 271 0.00% 55 318 0.00% 56 356 0.00% 57 443 0.00% 58 500 0.00% 59 613 0.01% 60 675 0.01% 61 835 0.01% 62 1039 0.01% 63 1165 0.01% 64 1387 0.01% 65 1519 0.01% 66 1728 0.02% 67 1973 0.02% 68 2243 0.02% 69 2639 0.03% 70 2811 0.03% 71 3329 0.03% 72 3885 0.04% 73 4373 0.04% 74 5114 0.05% 75 5497 0.05% 76 5992 0.06% 77 6574 0.06% 78 6972 0.07% 79 7632 0.07% 80 8378 0.08% 81 9300 0.09% 82 10390 0.10% 83 11010 0.11% 84 12291 0.12% 85 13104 0.13% 86 13884 0.14% 87 14783 0.15% 88 15178 0.15% 89 16043 0.16% 90 16334 0.16% 91 17277 0.17% 92 18325 0.18% 93 19201 0.19% 94 20505 0.20% 95 21771 0.21% 96 22225 0.22% 97 23487 0.23% 98 23809 0.23% 99 24176 0.24% 100 24827 0.24% 101 25369 0.25% 102 26043 0.26% 103 27049 0.27% 104 27896 0.27% 105 28445 0.28% 106 29648 0.29% 107 30530 0.30% 108 30719 0.30% 109 31855 0.31% 110 31552 0.31% 111 31566 0.31% 112 31910 0.31% 113 32578 0.32% 114 33085 0.33% 115 34214 0.34% 116 35274 0.35% 117 36014 0.35% 118 36799 0.36% 119 37127 0.36% 120 37421 0.37% 121 37089 0.36% 122 37600 0.37% 123 37599 0.37% 124 37897 0.37% 125 38510 0.38% 126 38914 0.38% 127 40114 0.39% 128 40247 0.40% 129 40205 0.39% 130 41100 0.40% 131 40844 0.40% 132 40772 0.40% 133 40766 0.40% 134 40457 0.40% 135 40700 0.40% 136 41272 0.41% 137 41139 0.40% 138 42271 0.42% 139 42800 0.42% 140 42483 0.42% 141 42582 0.42% 142 42734 0.42% 143 42016 0.41% 144 42192 0.41% 145 42211 0.41% 146 41675 0.41% 147 41853 0.41% 148 42393 0.42% 149 42709 0.42% 150 43349 0.43% 151 7890335 77.51% 10179667 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=18 prefix-density=0.67 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=68.24 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=2.1 sequence=TGAATGGTGCACATTACGGGTCCATGGCACAAAATCAGAGGATAACAATATCCATTCAAGACTATGCAACAATATAATTTGATTATCCTTAGAAAGTGCTTCTCCTTACACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=19 prefix-density=0.78 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=25 fanout-score=24.01 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=5.5 sequence=CAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR12917583 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:53:14 Started mapping on | Feb 13 15:53:14 Finished on | Feb 13 15:54:13 Mapping speed, Million of reads per hour | 621.13 Number of input reads | 10179667 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 9667771 Uniquely mapped reads % | 94.97% Average mapped length | 286.89 Number of splices: Total | 9215517 Number of splices: Annotated (sjdb) | 9033967 Number of splices: GT/AG | 9005256 Number of splices: GC/AG | 178186 Number of splices: AT/AC | 6133 Number of splices: Non-canonical | 25942 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 240056 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 45927 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.10% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 271840 271840 271840 N_multimapping 240056 240056 240056 N_noFeature 324585 9552060 360400 N_ambiguous 147505 450 67411 UnstrandedReadsAssigned:9195681 PositiveStrandReadsAssigned:115261 NegativeStrandReadsAssigned:9239960 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR12917583 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917583-trimmed-pair1.fastq SRR12917583-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,179,667 reads, 9,306,716 reads pseudoaligned [quant] estimated average fragment length: 229.307 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52401 SRR12917583.ke.tsv 34699 SRR12917583.se.tsv 87100 total ==> SRR12917583.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.69 199 12.0599 Potri.005G024800.1.v4.1 1035 806.693 142 19.0919 Potri.004G059700.1.v4.1 961 732.83 20 2.96003 Potri.007G009000.2.v4.1 1416 1187.69 0 0 Potri.003G141000.2.v4.1 2943 2714.69 241.546 9.65049 Potri.016G087400.1.v4.1 270 105.572 617 633.88 Potri.015G069301.1.v4.1 564 350.503 0 0 Potri.010G195200.1.v4.1 1773 1544.69 10 0.702146 Potri.012G127500.1.v4.1 977 748.75 296 42.877 ==> SRR12917583.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 92 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 137 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 0 SRR12917583 completed mapping pipeline successfully