Starting /dee2/code/volunteer_pipeline.sh SRR12917584 current disk space = 3089076846592 free memory = 1429547684 SRR12917584 SRAfilesize d1a416c2467a5b193d6d983ce5ad0c8b SRR12917584.sra SRR12917584.sra file validated SRR12917584 is paired end SRR12917584 is conventional basespace SRR12917584 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917584_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.622 37.0 37.0 37.0 37.0 37.0 2 36.529 37.0 37.0 37.0 37.0 37.0 3 36.631 37.0 37.0 37.0 37.0 37.0 4 36.7005 37.0 37.0 37.0 37.0 37.0 5 36.705 37.0 37.0 37.0 37.0 37.0 6 36.6425 37.0 37.0 37.0 37.0 37.0 7 36.529 37.0 37.0 37.0 37.0 37.0 8 36.607 37.0 37.0 37.0 37.0 37.0 9 36.6805 37.0 37.0 37.0 37.0 37.0 10-14 36.67020000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.6455 37.0 37.0 37.0 37.0 37.0 20-24 36.6028 37.0 37.0 37.0 37.0 37.0 25-29 36.5658 37.0 37.0 37.0 37.0 37.0 30-34 36.5029 37.0 37.0 37.0 37.0 37.0 35-39 36.475 37.0 37.0 37.0 37.0 37.0 40-44 36.4593 37.0 37.0 37.0 37.0 37.0 45-49 36.4422 37.0 37.0 37.0 37.0 37.0 50-54 36.4543 37.0 37.0 37.0 37.0 37.0 55-59 36.3908 37.0 37.0 37.0 37.0 37.0 60-64 36.3742 37.0 37.0 37.0 37.0 37.0 65-69 36.306599999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.344699999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.2913 37.0 37.0 37.0 37.0 37.0 80-84 36.2672 37.0 37.0 37.0 37.0 37.0 85-89 36.2312 37.0 37.0 37.0 37.0 37.0 90-94 36.2279 37.0 37.0 37.0 37.0 37.0 95-99 36.175599999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1719 37.0 37.0 37.0 37.0 37.0 105-109 36.0893 37.0 37.0 37.0 37.0 37.0 110-114 36.0944 37.0 37.0 37.0 37.0 37.0 115-119 36.0126 37.0 37.0 37.0 37.0 37.0 120-124 35.9959 37.0 37.0 37.0 37.0 37.0 125-129 35.9171 37.0 37.0 37.0 37.0 37.0 130-134 35.8378 37.0 37.0 37.0 37.0 37.0 135-139 35.71079999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.544200000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.4434 37.0 37.0 37.0 37.0 37.0 150-151 35.21775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 0.0 24 5.0 25 4.0 26 3.0 27 5.0 28 14.0 29 17.0 30 21.0 31 23.0 32 48.0 33 66.0 34 136.0 35 345.0 36 2975.0 37 334.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.84792396198099 11.880940470235117 5.302651325662831 36.96848424212106 2 19.625 11.625 38.725 30.025000000000002 3 17.349999999999998 17.875 28.975 35.8 4 21.675 24.675 24.125 29.525000000000002 5 23.849999999999998 31.55 23.825 20.775 6 19.375 35.475 23.05 22.1 7 14.799999999999999 27.224999999999998 41.175 16.8 8 16.975 26.200000000000003 33.825 23.0 9 18.2 24.575 34.725 22.5 10-14 19.77 29.310000000000002 28.360000000000003 22.56 15-19 19.77 28.444999999999997 28.375 23.41 20-24 19.675 28.185 27.975 24.165 25-29 19.59 28.335 28.645 23.43 30-34 19.689999999999998 29.14 27.560000000000002 23.61 35-39 20.18 28.810000000000002 26.99 24.02 40-44 19.900000000000002 28.804999999999996 27.884999999999998 23.41 45-49 19.66 27.595 28.62 24.125 50-54 20.36 28.24 27.700000000000003 23.7 55-59 20.09 28.74 27.400000000000002 23.77 60-64 20.77 28.59 27.32 23.32 65-69 20.835 28.485 27.445000000000004 23.235 70-74 20.755000000000003 28.765 27.029999999999998 23.45 75-79 20.294999999999998 28.455000000000002 27.994999999999997 23.255 80-84 20.695 28.51 27.72 23.075000000000003 85-89 19.885 29.18 27.495000000000005 23.44 90-94 20.04 29.060000000000002 27.265 23.635 95-99 20.49 27.800000000000004 27.810000000000002 23.9 100-104 20.26 29.03 27.065 23.645 105-109 20.705000000000002 28.105000000000004 27.034999999999997 24.154999999999998 110-114 19.89 28.79 27.955000000000002 23.365 115-119 21.154999999999998 28.645 27.18 23.02 120-124 21.44 27.92 26.740000000000002 23.9 125-129 20.645 27.900000000000002 27.339999999999996 24.115000000000002 130-134 21.224999999999998 28.175 26.735 23.865 135-139 21.21 27.825 27.175 23.79 140-144 21.495 27.71 26.474999999999998 24.32 145-149 20.935000000000002 27.43 26.740000000000002 24.895 150-151 21.337500000000002 26.950000000000003 26.525 25.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 2.0 22 2.0 23 1.5 24 1.5 25 2.5 26 3.5 27 9.0 28 15.5 29 12.5 30 11.0 31 22.0 32 31.5 33 44.0 34 56.0 35 63.5 36 86.0 37 102.0 38 135.0 39 172.0 40 184.0 41 211.5 42 236.5 43 259.0 44 266.0 45 268.0 46 283.0 47 268.0 48 221.0 49 193.5 50 174.5 51 149.5 52 120.5 53 93.0 54 72.0 55 54.5 56 47.0 57 40.5 58 32.5 59 16.5 60 8.0 61 6.5 62 4.5 63 2.0 64 1.0 65 0.5 66 1.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 92.25102319236017 84.52499999999999 2 6.603001364256481 12.1 3 0.9549795361527967 2.625 4 0.1364256480218281 0.5 5 0.054570259208731244 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTAATGGTGGATGACCATCCACAAATGGAAAAAGCCAAGAAATTCCTG 5 0.125 No Hit GGCAGCAAAAGCAGTTTTCAGCCCCAAAACATCAACAAACCTCTCACATG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.4125 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.8374999999999999 0.0 0.0 0.0 0.0 86-87 1.05 0.0 0.0 0.0 0.0 88-89 1.4 0.0 0.0 0.0 0.0 90-91 1.7375 0.0 0.0 0.0 0.0 92-93 1.95 0.0 0.0 0.0 0.0 94-95 2.25 0.0 0.0 0.0 0.0 96-97 2.5250000000000004 0.0 0.0 0.0 0.0 98-99 2.7750000000000004 0.0 0.0 0.0 0.0 100-101 3.05 0.0 0.0 0.0 0.0 102-103 3.3625 0.0 0.0 0.0 0.0 104-105 3.65 0.0 0.0 0.0 0.0 106-107 3.9875 0.0 0.0 0.0 0.0 108-109 4.4625 0.0 0.0 0.0 0.0 110-111 4.9375 0.0 0.0 0.0 0.0 112-113 5.4625 0.0 0.0 0.0 0.0 114-115 5.95 0.0 0.0 0.0 0.0 116-117 6.6 0.0 0.0 0.0 0.0 118-119 7.175 0.0 0.0 0.0 0.0 120-121 7.7125 0.0 0.0 0.0 0.0 122-123 8.4125 0.0 0.0 0.0 0.0 124-125 8.9875 0.0 0.0 0.0 0.0 126-127 9.587499999999999 0.0 0.0 0.0 0.0 128-129 10.5 0.0 0.0 0.0 0.0 130-131 11.175 0.0 0.0 0.0 0.0 132-133 11.675 0.0 0.0 0.0 0.0 134-135 12.537500000000001 0.0 0.0 0.0 0.0 136-137 13.1375 0.0 0.0 0.0 0.0 138-139 14.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCTC 10 0.006830828 145.0 5 CTCCTCT 10 0.006830828 145.0 4 CCTCTCT 10 0.006830828 145.0 6 TCTCTTT 20 3.5877043E-4 108.75 8 CTCTCTT 30 0.0017973486 72.5 7 >>END_MODULE SRR12917584 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12917584_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.24225 37.0 37.0 37.0 37.0 37.0 2 36.2695 37.0 37.0 37.0 37.0 37.0 3 36.1895 37.0 37.0 37.0 37.0 37.0 4 36.418 37.0 37.0 37.0 37.0 37.0 5 36.3945 37.0 37.0 37.0 37.0 37.0 6 36.282 37.0 37.0 37.0 37.0 37.0 7 36.3695 37.0 37.0 37.0 37.0 37.0 8 36.3545 37.0 37.0 37.0 37.0 37.0 9 36.4285 37.0 37.0 37.0 37.0 37.0 10-14 36.3235 37.0 37.0 37.0 37.0 37.0 15-19 36.4063 37.0 37.0 37.0 37.0 37.0 20-24 36.2762 37.0 37.0 37.0 37.0 37.0 25-29 36.235299999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.1536 37.0 37.0 37.0 37.0 37.0 35-39 36.1747 37.0 37.0 37.0 37.0 37.0 40-44 36.13530000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.044 37.0 37.0 37.0 37.0 37.0 50-54 36.0555 37.0 37.0 37.0 37.0 37.0 55-59 36.0742 37.0 37.0 37.0 37.0 37.0 60-64 36.1115 37.0 37.0 37.0 37.0 37.0 65-69 35.9612 37.0 37.0 37.0 37.0 37.0 70-74 35.9825 37.0 37.0 37.0 37.0 37.0 75-79 35.8662 37.0 37.0 37.0 37.0 37.0 80-84 35.9876 37.0 37.0 37.0 37.0 37.0 85-89 35.926 37.0 37.0 37.0 37.0 37.0 90-94 35.9841 37.0 37.0 37.0 37.0 37.0 95-99 35.881099999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.7642 37.0 37.0 37.0 37.0 37.0 105-109 35.7461 37.0 37.0 37.0 37.0 37.0 110-114 35.6986 37.0 37.0 37.0 37.0 37.0 115-119 35.5967 37.0 37.0 37.0 37.0 37.0 120-124 35.4655 37.0 37.0 37.0 37.0 37.0 125-129 35.305600000000005 37.0 37.0 37.0 34.6 37.0 130-134 35.1742 37.0 37.0 37.0 29.8 37.0 135-139 35.0239 37.0 37.0 37.0 27.4 37.0 140-144 34.743100000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.5398 37.0 37.0 37.0 25.0 37.0 150-151 34.005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 3.0 20 2.0 21 4.0 22 3.0 23 1.0 24 8.0 25 3.0 26 8.0 27 15.0 28 12.0 29 16.0 30 40.0 31 47.0 32 61.0 33 125.0 34 236.0 35 665.0 36 2554.0 37 193.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.635408852213054 25.30632658164541 8.477119279819954 24.58114528632158 2 26.25 25.5 32.074999999999996 16.175 3 19.400000000000002 27.3 34.575 18.725 4 24.425 33.175 23.799999999999997 18.6 5 25.025 37.375 21.2 16.400000000000002 6 20.025000000000002 40.25 21.25 18.475 7 21.4 21.625 37.95 19.025 8 18.825 25.85 30.25 25.074999999999996 9 22.15 23.925 30.275000000000002 23.65 10-14 23.580000000000002 29.65 26.290000000000003 20.48 15-19 23.055 27.905 28.21 20.830000000000002 20-24 22.3 28.249999999999996 28.415000000000003 21.035 25-29 22.34 28.139999999999997 28.225 21.295 30-34 22.205 28.215 28.225 21.355 35-39 22.805 28.57 27.779999999999998 20.845 40-44 22.425 27.675 28.794999999999998 21.105 45-49 23.52 27.775 27.71 20.995 50-54 22.755 28.08 28.189999999999998 20.974999999999998 55-59 23.419999999999998 28.09 28.139999999999997 20.349999999999998 60-64 23.05 27.625 28.249999999999996 21.075 65-69 23.435 27.634999999999998 27.689999999999998 21.240000000000002 70-74 22.865 28.199999999999996 28.139999999999997 20.794999999999998 75-79 23.865 27.839999999999996 27.35 20.945 80-84 23.555 27.894999999999996 27.400000000000002 21.15 85-89 23.465 27.97 27.47 21.095 90-94 23.505000000000003 28.000000000000004 27.495000000000005 21.0 95-99 23.630000000000003 27.725 28.035 20.61 100-104 23.715 27.785 27.644999999999996 20.855 105-109 24.065 27.93 27.325 20.68 110-114 23.515 29.044999999999998 27.139999999999997 20.3 115-119 24.834999999999997 27.605 27.365000000000002 20.195 120-124 25.72 27.74 27.0 19.54 125-129 25.555 27.435 27.3 19.71 130-134 26.145000000000003 27.589999999999996 26.045 20.22 135-139 26.255 27.685 27.055 19.005 140-144 27.11 26.595000000000002 26.51 19.785 145-149 28.255000000000003 27.265 25.91 18.57 150-151 28.325 26.637499999999996 26.087500000000002 18.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 2.0 23 2.5 24 2.5 25 6.0 26 8.0 27 8.0 28 11.0 29 12.0 30 13.5 31 16.0 32 25.5 33 37.0 34 49.0 35 72.5 36 94.0 37 111.5 38 140.0 39 165.0 40 198.5 41 234.0 42 252.5 43 259.5 44 271.5 45 267.5 46 260.5 47 250.0 48 218.0 49 209.5 50 178.0 51 129.5 52 106.5 53 86.5 54 67.0 55 56.0 56 44.0 57 35.5 58 25.5 59 19.0 60 16.0 61 7.0 62 4.5 63 5.0 64 3.5 65 1.5 66 1.0 67 1.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 1.5 99 1.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.525 #Duplication Level Percentage of deduplicated Percentage of total 1 92.35181644359464 84.52499999999999 2 6.4736410816716745 11.85 3 0.8740781207320404 2.4 4 0.16388964763725758 0.6 5 0.13657470636438132 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 5 0.125 No Hit AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit AAGAAATTGGGGCAAATGAACGGGGTTGATGTGGTTTTGCAGGCGGTTGC 5 0.125 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit AGAATCTACACTGGCTATGCAAAACCTGCAACCTAAGATAAAAGCTATTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.025 0.0 0.0 70-71 0.175 0.0 0.025 0.0 0.0 72-73 0.1875 0.0 0.025 0.0 0.0 74-75 0.275 0.0 0.025 0.0 0.0 76-77 0.4125 0.0 0.025 0.0 0.0 78-79 0.475 0.0 0.025 0.0 0.0 80-81 0.575 0.0 0.025 0.0 0.0 82-83 0.6875 0.0 0.025 0.0 0.0 84-85 0.8374999999999999 0.0 0.025 0.0 0.0 86-87 1.025 0.0 0.025 0.0 0.0 88-89 1.375 0.0 0.025 0.0 0.0 90-91 1.725 0.0 0.025 0.0 0.0 92-93 1.95 0.0 0.025 0.0 0.0 94-95 2.25 0.0 0.025 0.0 0.0 96-97 2.5250000000000004 0.0 0.025 0.0 0.0 98-99 2.7750000000000004 0.0 0.025 0.0 0.0 100-101 3.075 0.0 0.025 0.0 0.0 102-103 3.3875 0.0 0.025 0.0 0.0 104-105 3.675 0.0 0.025 0.0 0.0 106-107 4.012499999999999 0.0 0.025 0.0 0.0 108-109 4.475 0.0 0.025 0.0 0.0 110-111 4.9875 0.0 0.025 0.0 0.0 112-113 5.5125 0.0 0.025 0.0 0.0 114-115 6.0 0.0 0.025 0.0 0.0 116-117 6.637499999999999 0.0 0.025 0.0 0.0 118-119 7.2 0.0 0.025 0.0 0.0 120-121 7.7375 0.0 0.025 0.0 0.0 122-123 8.4375 0.0 0.025 0.0 0.0 124-125 8.9875 0.0 0.025 0.0 0.0 126-127 9.6125 0.0 0.025 0.0 0.0 128-129 10.55 0.0 0.025 0.0 0.0 130-131 11.2125 0.0 0.025 0.0 0.0 132-133 11.7 0.0 0.025 0.0 0.0 134-135 12.55 0.0 0.025 0.0 0.0 136-137 13.125 0.0 0.025 0.0 0.0 138-139 14.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCACA 10 0.006830828 145.0 2 GTGTTGT 10 0.006830828 145.0 145 ACTTCAC 10 0.006830828 145.0 1 AAAGCTC 10 0.006830828 145.0 8 AAGCTCC 10 0.006830828 145.0 9 TGAAAAC 10 0.006830828 145.0 6 >>END_MODULE Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607781 spots for SRR12917584.sra Written 607781 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra Read 607772 spots for SRR12917584.sra Written 607772 spots for SRR12917584.sra SRR ids: ['SRR12917584.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u7d86w7z SRR12917584.sra spots: 12155449 blocks: [[1, 607772], [607773, 1215544], [1215545, 1823316], [1823317, 2431088], [2431089, 3038860], [3038861, 3646632], [3646633, 4254404], [4254405, 4862176], [4862177, 5469948], [5469949, 6077720], [6077721, 6685492], [6685493, 7293264], [7293265, 7901036], [7901037, 8508808], [8508809, 9116580], [9116581, 9724352], [9724353, 10332124], [10332125, 10939896], [10939897, 11547668], [11547669, 12155449]] SRR12917584 file size 4109252 SRR12917584 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12917584 SRR12917584_1.fastq SRR12917584_2.fastq Input file: SRR12917584_1.fastq Paired file: SRR12917584_2.fastq trimmed: SRR12917584-trimmed-pair1.fastq, SRR12917584-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 15:17:48 2025 >> started Thu Feb 13 15:18:01 2025 >> done (13.135s) 12155449 read pairs processed; of these: 175 ( 0.00%) short read pairs filtered out after trimming by size control 1796 ( 0.01%) empty read pairs filtered out after trimming by size control 12153478 (99.98%) read pairs available; of these: 2329207 (19.16%) trimmed read pairs available after processing 9824271 (80.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 20 0.00% 20 19 0.00% 21 18 0.00% 22 14 0.00% 23 24 0.00% 24 25 0.00% 25 17 0.00% 26 19 0.00% 27 15 0.00% 28 27 0.00% 29 15 0.00% 30 23 0.00% 31 23 0.00% 32 24 0.00% 33 21 0.00% 34 38 0.00% 35 25 0.00% 36 35 0.00% 37 34 0.00% 38 41 0.00% 39 43 0.00% 40 57 0.00% 41 59 0.00% 42 44 0.00% 43 47 0.00% 44 55 0.00% 45 76 0.00% 46 69 0.00% 47 98 0.00% 48 105 0.00% 49 154 0.00% 50 162 0.00% 51 204 0.00% 52 184 0.00% 53 242 0.00% 54 308 0.00% 55 268 0.00% 56 359 0.00% 57 442 0.00% 58 441 0.00% 59 560 0.00% 60 659 0.01% 61 790 0.01% 62 893 0.01% 63 1024 0.01% 64 1166 0.01% 65 1338 0.01% 66 1506 0.01% 67 1660 0.01% 68 1929 0.02% 69 2204 0.02% 70 2554 0.02% 71 2960 0.02% 72 3242 0.03% 73 3869 0.03% 74 4193 0.03% 75 4711 0.04% 76 5186 0.04% 77 5545 0.05% 78 5891 0.05% 79 6608 0.05% 80 7148 0.06% 81 7891 0.06% 82 8810 0.07% 83 9515 0.08% 84 10672 0.09% 85 11419 0.09% 86 11826 0.10% 87 12714 0.10% 88 13019 0.11% 89 13601 0.11% 90 14412 0.12% 91 15417 0.13% 92 16147 0.13% 93 17416 0.14% 94 18633 0.15% 95 20126 0.17% 96 20376 0.17% 97 20919 0.17% 98 21658 0.18% 99 22124 0.18% 100 22644 0.19% 101 23230 0.19% 102 24443 0.20% 103 25041 0.21% 104 26124 0.21% 105 27158 0.22% 106 28184 0.23% 107 29154 0.24% 108 29381 0.24% 109 29999 0.25% 110 30061 0.25% 111 30888 0.25% 112 31551 0.26% 113 31880 0.26% 114 32974 0.27% 115 34009 0.28% 116 34850 0.29% 117 35659 0.29% 118 36693 0.30% 119 36883 0.30% 120 37696 0.31% 121 37698 0.31% 122 38269 0.31% 123 39002 0.32% 124 39349 0.32% 125 39788 0.33% 126 41272 0.34% 127 41952 0.35% 128 42162 0.35% 129 43385 0.36% 130 43282 0.36% 131 43135 0.35% 132 43323 0.36% 133 43802 0.36% 134 43589 0.36% 135 44081 0.36% 136 45389 0.37% 137 45485 0.37% 138 45911 0.38% 139 47327 0.39% 140 46665 0.38% 141 47250 0.39% 142 46944 0.39% 143 46973 0.39% 144 47250 0.39% 145 47747 0.39% 146 47707 0.39% 147 48281 0.40% 148 49332 0.41% 149 48688 0.40% 150 49430 0.41% 151 9824271 80.84% 12153478 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.68 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=32.10 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=9.5 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=22 prefix-density=0.53 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=83.99 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.8 sequence=ACAACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTACAATAAAAGGGGTGCTCGAGCATGTTTGAGCT SRR12917584 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 15:18:40 Started mapping on | Feb 13 15:18:41 Finished on | Feb 13 15:19:52 Mapping speed, Million of reads per hour | 616.23 Number of input reads | 12153478 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 11484906 Uniquely mapped reads % | 94.50% Average mapped length | 289.21 Number of splices: Total | 10985136 Number of splices: Annotated (sjdb) | 10734188 Number of splices: GT/AG | 10757499 Number of splices: GC/AG | 180865 Number of splices: AT/AC | 6868 Number of splices: Non-canonical | 39904 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275532 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 26189 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 393040 393040 393040 N_multimapping 275532 275532 275532 N_noFeature 454669 11330021 522608 N_ambiguous 175159 625 87860 UnstrandedReadsAssigned:10855078 PositiveStrandReadsAssigned:154260 NegativeStrandReadsAssigned:10874438 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12917584 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12917584-trimmed-pair1.fastq SRR12917584-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,153,478 reads, 10,889,408 reads pseudoaligned [quant] estimated average fragment length: 233.206 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52401 SRR12917584.ke.tsv 34699 SRR12917584.se.tsv 87100 total ==> SRR12917584.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.79 387 21.1641 Potri.005G024800.1.v4.1 1035 802.794 133 16.1796 Potri.004G059700.1.v4.1 961 728.943 22 2.94747 Potri.007G009000.2.v4.1 1416 1183.79 0 0 Potri.003G141000.2.v4.1 2943 2710.79 484 17.4369 Potri.016G087400.1.v4.1 270 99.8184 544 532.24 Potri.015G069301.1.v4.1 564 344.245 0 0 Potri.010G195200.1.v4.1 1773 1540.79 10 0.633833 Potri.012G127500.1.v4.1 977 744.857 72 9.44016 ==> SRR12917584.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 116 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 92 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 16 Potri.001G452600.v4.1 3 SRR12917584 completed mapping pipeline successfully